ID: 1161616907

View in Genome Browser
Species Human (GRCh38)
Location 19:5276019-5276041
Sequence CCTCACATGTAAAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1053
Summary {0: 1, 1: 4, 2: 34, 3: 232, 4: 782}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161616907_1161616912 -3 Left 1161616907 19:5276019-5276041 CCATCCCCATTTTACATGTGAGG 0: 1
1: 4
2: 34
3: 232
4: 782
Right 1161616912 19:5276039-5276061 AGGAAACTGAGACACAAACCAGG 0: 1
1: 0
2: 10
3: 86
4: 781
1161616907_1161616917 18 Left 1161616907 19:5276019-5276041 CCATCCCCATTTTACATGTGAGG 0: 1
1: 4
2: 34
3: 232
4: 782
Right 1161616917 19:5276060-5276082 GGCAAGGGACTTGCTTTGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 181
1161616907_1161616913 2 Left 1161616907 19:5276019-5276041 CCATCCCCATTTTACATGTGAGG 0: 1
1: 4
2: 34
3: 232
4: 782
Right 1161616913 19:5276044-5276066 ACTGAGACACAAACCAGGCAAGG 0: 1
1: 0
2: 0
3: 36
4: 369
1161616907_1161616914 3 Left 1161616907 19:5276019-5276041 CCATCCCCATTTTACATGTGAGG 0: 1
1: 4
2: 34
3: 232
4: 782
Right 1161616914 19:5276045-5276067 CTGAGACACAAACCAGGCAAGGG 0: 1
1: 0
2: 1
3: 40
4: 334
1161616907_1161616915 14 Left 1161616907 19:5276019-5276041 CCATCCCCATTTTACATGTGAGG 0: 1
1: 4
2: 34
3: 232
4: 782
Right 1161616915 19:5276056-5276078 ACCAGGCAAGGGACTTGCTTTGG 0: 1
1: 0
2: 0
3: 16
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161616907 Original CRISPR CCTCACATGTAAAATGGGGA TGG (reversed) Intronic
900168677 1:1255609-1255631 CCTCACCTGTGAGATGGGGTCGG - Intronic
900241294 1:1618736-1618758 CCTCTCATGAACAATGGGAATGG + Intronic
900932942 1:5748027-5748049 CCCCACATGTAAAATGGGCTCGG + Intergenic
901041699 1:6368160-6368182 CCTCACCTTCAAACTGGGGAGGG - Intronic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902232985 1:15040076-15040098 TCCCACCTGTAAAATGGGGCTGG - Intronic
902233524 1:15043397-15043419 CCCCTTATGTAAAATGGGGCAGG - Intronic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902617284 1:17630691-17630713 CCTCACCTGGGCAATGGGGATGG + Intronic
902623468 1:17663748-17663770 CCCCATCTGTAAAATGGGGTGGG - Intronic
902634845 1:17728551-17728573 CCTCCCTTGTAAAATGCAGAGGG - Intergenic
902657397 1:17878798-17878820 CCTCATCTGTAAAATAGGAAGGG - Intergenic
902689452 1:18101123-18101145 CCTCATCTGTAAAATGGGACTGG - Intergenic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902936906 1:19771027-19771049 CCTCAACTATGAAATGGGGATGG + Intronic
903000900 1:20264992-20265014 TCTAACCTGTAAAGTGGGGATGG + Intergenic
903137726 1:21320286-21320308 TCTCATTTATAAAATGGGGATGG + Intronic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903168975 1:21540509-21540531 CCTCACCTGTAAAATGGAGCTGG + Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903481591 1:23657401-23657423 CCCCACCTGTAAAATGGAAATGG + Intergenic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903812413 1:26042091-26042113 CCCCATCTGTCAAATGGGGACGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903898083 1:26621627-26621649 CCCCATCTCTAAAATGGGGAAGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904047524 1:27617390-27617412 CCCCATGTGTAAAATGGGGCTGG + Intronic
904254954 1:29248980-29249002 CCTCACCTGTAAAATGAGAGTGG - Intronic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904318934 1:29684035-29684057 CCCCATCTATAAAATGGGGATGG + Intergenic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904642863 1:31943804-31943826 CCTCATCTGTAATATGGGCATGG + Intronic
904819254 1:33230185-33230207 CCTCACTTGTAAACTGGGAATGG + Intergenic
904899407 1:33844700-33844722 CCTCAACTGTAAAATGGGACGGG + Intronic
904918366 1:33986432-33986454 CTTCAGCTGTAAAATGGGCATGG - Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905244741 1:36604771-36604793 CCTTTCTTGTAAAATGGGGGTGG + Intergenic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905447586 1:38037091-38037113 CCTCACCTGTAGGCTGGGGATGG + Intergenic
905458683 1:38106559-38106581 AGTCACCTGTAAACTGGGGATGG + Intergenic
906041096 1:42788278-42788300 CCTCACATCTGAAATGGGTGAGG + Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906218445 1:44058591-44058613 CCTTACATATAAAAGGGCGATGG - Intergenic
906475026 1:46163815-46163837 CCTCAGCTGTAAAATAGAGACGG + Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906960335 1:50416089-50416111 CCTCCTCTGTAAAATGGGGCCGG + Intergenic
907289797 1:53406484-53406506 CCCCATGTGTAAAATGGAGATGG - Intergenic
907331464 1:53674490-53674512 CCACATGTGTAAAATGGGGACGG + Intronic
907715857 1:56925405-56925427 CCTCATCTGTGAGATGGGGATGG - Intergenic
908029826 1:59987416-59987438 TCTCACCTGTACAATGGGCATGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908570794 1:65408019-65408041 CCTCATCCATAAAATGGGGATGG - Intronic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909852106 1:80480383-80480405 CCTCACCTGTATAATGGGGTTGG - Intergenic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
910724506 1:90324366-90324388 CCTCACATATAAAATGGTGATGG - Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911054708 1:93699973-93699995 CCTTACCTGTAAAATGGGGTGGG - Intronic
911111650 1:94194592-94194614 CCTCACATGATAGAAGGGGAAGG + Intronic
911145897 1:94552310-94552332 TCTCAAGGGTAAAATGGGGAAGG - Intergenic
911224036 1:95284747-95284769 CCTCATAAGTAAAATGGTTATGG - Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911587977 1:99713189-99713211 ACTCACCTGTAAAATGGGGGTGG - Intronic
912324417 1:108744473-108744495 TCTCATATGTAAAATGGCAATGG + Intergenic
912363963 1:109117594-109117616 CCTGATCTGTGAAATGGGGATGG + Intronic
913050289 1:115111658-115111680 CCTCACATGGTAGAAGGGGAAGG - Intergenic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
913451537 1:118996103-118996125 TCTCATGTGTAAAATGGGGCCGG - Intergenic
913614039 1:120538513-120538535 CCTCAAATGTAAAAAGGAAATGG + Intergenic
914287074 1:146236881-146236903 CCTCACATTTAAAATGTTGGTGG - Intergenic
914548106 1:148687623-148687645 CCTCACATTTAAAATGTTGGTGG - Intergenic
914576229 1:148972380-148972402 CCTCAAATGTAAAAAGGAAATGG - Intronic
914923641 1:151864906-151864928 CCTCACATGGAAAACAGGGTGGG + Intergenic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
917087639 1:171319557-171319579 TCTCACCTGTAAAATGTGAATGG - Intronic
917202918 1:172536147-172536169 CCTCACATGTAAAATGCAAAAGG - Intronic
917268899 1:173251649-173251671 CCTTATATGTACAATAGGGATGG + Intergenic
917273084 1:173299797-173299819 CCCAACATGTAAAGTTGGGAGGG + Intergenic
917495916 1:175540072-175540094 TCTCAGATGTAGAGTGGGGAGGG + Intronic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
918324110 1:183393322-183393344 CCTCATCTGTAAAATGGGATTGG - Intronic
919656961 1:200206523-200206545 ACTCATATGTATGATGGGGAAGG - Intergenic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920977851 1:210802700-210802722 TCCCACCTGTAAAATGGAGAGGG - Intronic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921075306 1:211695841-211695863 CCTCATCTGTAAAATAGAGATGG - Intergenic
921125930 1:212178126-212178148 CCTTAGTTATAAAATGGGGACGG - Intergenic
921364941 1:214364719-214364741 CTTCGCATGTAAGTTGGGGAGGG + Intronic
921439700 1:215170990-215171012 TCTCACAGGTAAGATGAGGATGG + Intronic
921445438 1:215241793-215241815 CCTAATATGTAAAATGACGATGG + Intergenic
921812434 1:219530083-219530105 TCTCACTTTTAAAATGAGGAGGG - Intergenic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
922053166 1:222014440-222014462 CTTTACCTGTAAAATGGAGAGGG - Intergenic
923220648 1:231889578-231889600 CCTCAACTGTAAAACTGGGAAGG - Intronic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924290280 1:242529456-242529478 CCTCATCTGTAACATAGGGATGG - Intergenic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1063001646 10:1929808-1929830 CTTCACACGTAGAGTGGGGATGG + Intergenic
1063078936 10:2746501-2746523 CCTCAATTGTAAAATGTGGGTGG - Intergenic
1063181126 10:3601426-3601448 CCTCTCATGGAAAAGGTGGAAGG + Intergenic
1063349036 10:5337642-5337664 CCCCACATGTCAGATGGGGCTGG - Intergenic
1063438039 10:6050331-6050353 CCTCATCCGTAAAATGGGAATGG + Intronic
1064220096 10:13432932-13432954 TCTCACCTGTGAAGTGGGGATGG + Intergenic
1064562220 10:16604654-16604676 CCCCACCTGTCAAATGGGAATGG - Intronic
1065263655 10:23952665-23952687 CCTAACCTGTAAAATGGGAATGG + Intronic
1065963057 10:30749977-30749999 CCTCACCTGTAAAAAGAAGAAGG - Intergenic
1067229116 10:44394764-44394786 CCTCACTGGCGAAATGGGGATGG - Intergenic
1067585772 10:47475159-47475181 CCTCATTTGTACAATGGGGGTGG + Intronic
1067844899 10:49711829-49711851 TCTCACCTATAAAATGGGGGTGG + Intergenic
1067961662 10:50859753-50859775 CCTAAGATGCAAAATGGGAATGG - Intronic
1068154554 10:53181366-53181388 CCTTACATGTAAAATGAGGGAGG - Intergenic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069338560 10:67383387-67383409 CCTCAGCTGTAAGATGGGTATGG - Intronic
1069542588 10:69306530-69306552 GTTCACATGTGAAATGAGGAGGG + Intronic
1069838108 10:71321925-71321947 CCTCACAAATGAAATGGGAATGG + Intronic
1069888399 10:71638146-71638168 CCTCATCTGTGAAGTGGGGAGGG - Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1070471245 10:76781788-76781810 CCTCACTGGTAAAATGGGCATGG + Intergenic
1070653653 10:78255818-78255840 CCTTACCTGTGAAACGGGGATGG + Intergenic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1070773824 10:79098446-79098468 CCTCACCTGTAAAATGGAGGTGG + Intronic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071932499 10:90488253-90488275 CCTCTTATGTAAAGTGGGGAAGG - Intergenic
1072043107 10:91628112-91628134 TCTCAGCTTTAAAATGGGGAAGG - Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1072772178 10:98151359-98151381 CCTCATTTGTAAAATGGAGGTGG + Intronic
1072982314 10:100109493-100109515 CCTCGCTTGTAAATTGGGGTAGG + Intergenic
1073044893 10:100631146-100631168 CCTCATCTGTAAAACAGGGATGG + Intergenic
1073118039 10:101103442-101103464 CCTCATCTGTGACATGGGGATGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073471681 10:103726380-103726402 CCTCACCCGTAGTATGGGGATGG - Intronic
1073584658 10:104698204-104698226 CCACATCTGTAAAATGGGGCTGG - Intronic
1073711591 10:106049159-106049181 CCTCACATGTTAATTAGGTAGGG + Intergenic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074889927 10:117727155-117727177 CCTCATCTATAAAATGGGGCAGG + Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1074944284 10:118266149-118266171 CCTCATCTGTAAAATGGCAAAGG + Intergenic
1075444735 10:122505530-122505552 CCTCATCTGTTAAATGGGCATGG + Intronic
1076111261 10:127861446-127861468 CCTCATCTGTAAAATGGAGTGGG - Intergenic
1078107476 11:8367700-8367722 CCTCATCTGTAAAATAGGAATGG - Intergenic
1078341307 11:10499563-10499585 GCTCAATTGTAAAATGGGGCTGG + Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078422839 11:11226281-11226303 CCTCAGCTGTAAAATGGGTTTGG + Intergenic
1078459182 11:11500389-11500411 CCTCACATGGAAAGTGGTGATGG + Intronic
1078467881 11:11563591-11563613 CCTCACTTGTGACATGAGGATGG - Intronic
1078527608 11:12112058-12112080 CCCCATCTCTAAAATGGGGAGGG - Intronic
1078557573 11:12342729-12342751 CCTCCTGTGGAAAATGGGGATGG - Intronic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1078727600 11:13945572-13945594 CCTCATCTATGAAATGGGGATGG + Intergenic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079051673 11:17166163-17166185 CCTCAACTGTAAAATAGGGATGG + Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1079324058 11:19476540-19476562 CCTCACATGTAAAAAAAGGTGGG + Intronic
1079327776 11:19509158-19509180 CCTCTTCTGTAAAATGGGGTTGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1080394106 11:31874199-31874221 CCTCACCTGGAAAATGGGGCTGG - Intronic
1080685084 11:34508749-34508771 CCTCAACTGTAAAATGGTGGAGG - Intronic
1080692353 11:34568810-34568832 CCTCCCCTGTAAAATGGGCAGGG + Intergenic
1080805563 11:35650039-35650061 TCATACATGTAAAATGGGGAAGG - Intergenic
1081002343 11:37690794-37690816 CATGACATGTAAAAAGTGGAAGG - Intergenic
1081612732 11:44572756-44572778 CCTCATCTGTGAAATAGGGATGG + Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083120138 11:60504045-60504067 AATCACATGAACAATGGGGAAGG + Intronic
1083186794 11:61022328-61022350 CCTCACCTGTAAAATGAGAGTGG - Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083275884 11:61596876-61596898 CTCCACCTGTAAAATGGAGATGG - Intergenic
1083276166 11:61598219-61598241 CCTCATCTGTCAAATGGGGTGGG - Intergenic
1083476534 11:62919064-62919086 CCTCACATATGCAATGAGGAGGG + Intronic
1083502593 11:63124561-63124583 CCTAACATCTAAAATAGTGAAGG - Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1084966642 11:72748078-72748100 CCTCATGTGGAAAATGGGAATGG + Intronic
1085130255 11:74032168-74032190 CTTCACCTGTAAAATGGAGGCGG - Intronic
1085426990 11:76413493-76413515 CCTCATCTATAAGATGGGGATGG + Intronic
1085620253 11:78032502-78032524 CATCACCTGGAAAATGGGGGTGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086044983 11:82522156-82522178 CCACATATGTAAAATGTAGATGG - Intergenic
1086095433 11:83045674-83045696 CCTCAGCTGTAAAATGGGTATGG + Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086338306 11:85822104-85822126 CCTCACTTGTAAAATGGGAGTGG - Intergenic
1087056749 11:93944490-93944512 CCTCACATTTAAAATGTTGGTGG + Intergenic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1088368189 11:109060740-109060762 TCTCACCTGTAAAATGGGGTTGG + Intergenic
1088403094 11:109442405-109442427 GCTCACATGTAAAACTGGGATGG - Intergenic
1088420738 11:109643224-109643246 TCTTAGATGGAAAATGGGGAAGG + Intergenic
1089298890 11:117486041-117486063 CCTCACATGTACAAGTGGCAGGG + Intronic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089775986 11:120836294-120836316 CCTCAGCTGTAAAATGGGGTTGG + Intronic
1090758886 11:129817854-129817876 CCTCAAATGAAAAATGGGTGAGG + Intronic
1091003832 11:131933947-131933969 CCTCATTTTTAAAATTGGGATGG - Intronic
1091145938 11:133280497-133280519 CTTGAAATTTAAAATGGGGAGGG - Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091578120 12:1758440-1758462 CCTCACTGGTAAATTGAGGAAGG - Intronic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1091782648 12:3223667-3223689 CCTCACCTATAAAATGGGAAGGG + Intronic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092295377 12:7193119-7193141 CCTCATCTATAAAATGGGGGTGG - Intronic
1092411611 12:8257451-8257473 CCTCATCTGTAACTTGGGGATGG + Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1094462251 12:30708993-30709015 TCTCAAATGTAAAATGTGAATGG - Intergenic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1094806114 12:34094360-34094382 CCTCATATGTACAATAGTGAAGG - Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1095656509 12:44675735-44675757 CATCCTATGTAAAATGGGAAAGG + Intronic
1096121759 12:49093174-49093196 TCTCAGATGTAAAATGAGGGTGG + Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096802492 12:54120386-54120408 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1096815410 12:54198821-54198843 CCTCATCTATAAAACGGGGATGG - Intergenic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1098505360 12:71243148-71243170 TTTCACATGTAAAAAGAGGAGGG - Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1100299685 12:93295592-93295614 TATCACTGGTAAAATGGGGAGGG + Intergenic
1100856374 12:98761053-98761075 TCTCACACGTAAAATGAGGATGG - Intronic
1100882031 12:99029875-99029897 CCTCTGCTGTAAAATGGGAATGG + Intronic
1100883167 12:99040627-99040649 CTTAACCTGTAAAATGGGAATGG + Intronic
1101330766 12:103755922-103755944 CCTCATCTATAAAATGGAGATGG + Intronic
1101398915 12:104371692-104371714 CCTCAGCTGGAAAATGGGGGTGG + Intergenic
1101411298 12:104470718-104470740 CCTCACCTGTATAATGGGATTGG - Intronic
1101750207 12:107577269-107577291 CTTCACCTGTAAAGTGGGGTGGG - Intronic
1101827447 12:108231507-108231529 CCTCATCTGTAAAATGGGTTGGG - Intronic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1101912261 12:108869058-108869080 CCTCCTAAGTAAAATGGGAAGGG - Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102274564 12:111571072-111571094 CTTCCCCTGTAAAAAGGGGATGG - Intronic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG + Intergenic
1103013191 12:117473613-117473635 CCACTCATGTGAAACGGGGAAGG + Intronic
1103159029 12:118712169-118712191 CCTCACCTGTAAAATAGAGATGG + Intergenic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1104199012 12:126568956-126568978 CCTGATGTGGAAAATGGGGAAGG + Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1106074426 13:26445450-26445472 CCTCATTTATAAAATGGAGATGG + Intergenic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1108140481 13:47415982-47416004 CCCCACCTGTGAAAGGGGGAGGG - Intergenic
1108611731 13:52090466-52090488 CCTCAGCTGTAAAGTGGGCATGG + Intronic
1108983618 13:56553894-56553916 CCTCACCTGTAGATTGGGTAAGG + Intergenic
1110434604 13:75465098-75465120 CCTCATTTATAATATGGGGATGG - Intronic
1110585670 13:77188520-77188542 CTTCATGTGTACAATGGGGATGG + Intronic
1111323927 13:86666475-86666497 CCTCACTTCTAAAATAAGGATGG - Intergenic
1112030364 13:95451002-95451024 CCTCACCTGCAAAACGGGCATGG - Intronic
1112579952 13:100669909-100669931 CCTCAACACTAAAATGGGGATGG + Intronic
1112768425 13:102771776-102771798 CCCAACAGGTGAAATGGGGAAGG + Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113057953 13:106289798-106289820 ACACACATACAAAATGGGGAGGG + Intergenic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1115443381 14:33461871-33461893 CATCACTTGTGAAATGGGAATGG + Intronic
1115513502 14:34161492-34161514 ACTCATCTATAAAATGGGGATGG + Intronic
1116001968 14:39253416-39253438 CCTAATTTGAAAAATGGGGAGGG - Exonic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116835630 14:49767388-49767410 CCTCACCTGTAAAATAGGGTGGG - Intergenic
1117090738 14:52247604-52247626 CCTCACCTGTTAAATGGAAAGGG - Intergenic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1118055887 14:62079432-62079454 CCTCAACTGTAAAATGGAGATGG - Intronic
1118314148 14:64715514-64715536 CCTGACCTGTAAAATAGGGATGG + Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118318499 14:64739740-64739762 CCTCACATGGCAAAGGGGCAAGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1119624796 14:76163736-76163758 CCCTACATGTAAAATGTGGATGG - Intronic
1119643736 14:76333978-76334000 CCCCATCTGTAAAATGGGGCAGG + Intronic
1119726585 14:76925118-76925140 CCCCACCTGTGAAATGGGGTCGG + Intergenic
1119930994 14:78546834-78546856 CCTCAAGTGTAAAATGGATATGG - Intronic
1120674614 14:87406452-87406474 CCTCACCTGTAAAGTGAGCACGG + Intergenic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121545922 14:94763630-94763652 CCTCACCTGCAAAATGGGCTTGG - Intergenic
1121570835 14:94945400-94945422 CCTCACCTGATAAACGGGGATGG + Intergenic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121969318 14:98342038-98342060 CCTCAAATGAAAAATGGGGATGG - Intergenic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122104969 14:99446144-99446166 CCTCACTTATAAAATGGGGACGG + Intronic
1122913621 14:104845651-104845673 CATCACATGTGAACTTGGGAGGG - Intergenic
1123682744 15:22774329-22774351 TCACACCTGTAAAATGGGGATGG - Intronic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124517508 15:30379510-30379532 CCTCATCTGTAAAATTGCGATGG - Intronic
1124541142 15:30586745-30586767 CCTCATCTGTAAAATTGCGATGG + Intergenic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127631935 15:60835627-60835649 CTTCACCTGTAAAATAGAGATGG - Intronic
1127675427 15:61233550-61233572 CCTCACCTATAAAATGGGCATGG - Intergenic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1128347355 15:66862901-66862923 CTCCACATGTAAAATGAGGCAGG + Intergenic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128610480 15:69069161-69069183 CTTCATCTCTAAAATGGGGATGG - Intergenic
1128691966 15:69731455-69731477 CATCAACTGTAAATTGGGGAGGG + Intergenic
1128735696 15:70052672-70052694 TCTCACCTATAAAATGGGGATGG - Intronic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128765339 15:70247920-70247942 CCTCACCTGTAAACAGAGGAGGG - Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1128926597 15:71661920-71661942 TCTTACATGTAAAGTGGGGATGG - Intronic
1129356170 15:74993594-74993616 CCACATATGTAAAATAAGGATGG - Intronic
1129429230 15:75486394-75486416 CCTCACATGGCAGAAGGGGAAGG - Intronic
1129692878 15:77723754-77723776 CTTCACCTGTGACATGGGGATGG + Intronic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1130867145 15:87942736-87942758 TCTCACCTGTAAAATGGGTATGG + Intronic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131054939 15:89369471-89369493 CCTCTCATGTAAAAGGGTGAGGG - Intergenic
1131235418 15:90692700-90692722 CCTCATAGGTCAAATGGGAAAGG - Intergenic
1131469672 15:92685002-92685024 CCTCCCCTGTAAAATAAGGATGG + Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132424472 15:101703068-101703090 TCTTACAGGTAAAATGGGGCTGG - Intronic
1132895431 16:2226959-2226981 CCTCATCTGTAAAATGGGCTGGG - Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133815502 16:9194485-9194507 CCTCACCTGTAAAATGGTTGTGG - Intergenic
1133826978 16:9286869-9286891 CCTCAGCTGTAAAATGGAAATGG - Intergenic
1133850707 16:9500676-9500698 TCTCACCTGTAAAATGGAGAGGG + Intergenic
1133862598 16:9610199-9610221 CCTCATCTGTTAAATGGAGATGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133921751 16:10159622-10159644 CCTCATCTGTAAAATGGGATTGG - Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134234895 16:12457737-12457759 CCTCACATACAAGATGGGGCTGG - Intronic
1134248543 16:12558076-12558098 CATCCCATGCAAAGTGGGGACGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134785035 16:16934525-16934547 CCTCAAGTGTAAAATGGGGATGG + Intergenic
1134838586 16:17382854-17382876 CCTCACCTGGGTAATGGGGATGG - Intronic
1134874683 16:17687346-17687368 CATCACCTGTAAACTGGGTATGG - Intergenic
1135160156 16:20087199-20087221 CCTCATCTGTAACATGGAGAAGG - Intergenic
1135169100 16:20167219-20167241 CCCCATCTGTAAAATGGGGTAGG + Intergenic
1135421008 16:22305527-22305549 CCTCACTTGCAAAGTGGTGATGG + Intronic
1135458732 16:22622625-22622647 CCTCATCTGTAAAATGGCAAAGG - Intergenic
1135856996 16:26020925-26020947 CCATATATGTAAAATGGGGATGG + Intronic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136067612 16:27769453-27769475 CCTCATCTGTTAAATGGGCACGG - Intronic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1136928256 16:34395343-34395365 TCTCACCTGTGAAGTGGGGATGG - Intergenic
1136976318 16:35016461-35016483 TCTCACCTGTGAAGTGGGGATGG + Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137598691 16:49741866-49741888 CCTCACCTAGAAAATGAGGATGG + Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137823072 16:51464062-51464084 TTTCACTTGTAAAATGGGGAGGG + Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138340525 16:56286131-56286153 CCACACATGTGAGATGGAGATGG + Intronic
1138405795 16:56792986-56793008 TCTTACCTGTAAAATGGGGCAGG + Intronic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138576379 16:57909897-57909919 CCTCAGCTGTAAAATGGGAATGG + Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1139166587 16:64573176-64573198 CCTCAGATTTGAAATGGGGATGG - Intergenic
1139416134 16:66812279-66812301 CTTCATGTGTAAAATGGGGCCGG + Intronic
1139824348 16:69745336-69745358 CCCCATCTGTAAAATGGAGACGG - Intronic
1140038516 16:71389854-71389876 CCCCCCATGTAAAGTGGGGACGG + Exonic
1140067397 16:71623378-71623400 CCTCAGATTTTAAGTGGGGAGGG + Intergenic
1140259886 16:73368845-73368867 CCTTACCAGTAAAATGGGGCTGG - Intergenic
1140838805 16:78819978-78820000 CAACATCTGTAAAATGGGGATGG + Intronic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141746927 16:85932062-85932084 CCTCACCTGGCAAATGGGGTGGG + Intergenic
1141875466 16:86821082-86821104 CCTCAAATGTAAACTAAGGATGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1142001851 16:87668805-87668827 CCCCACAGTGAAAATGGGGAGGG + Intronic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1142783222 17:2198569-2198591 CAAGACATGAAAAATGGGGAAGG + Intronic
1143087565 17:4427549-4427571 TCTCACCTACAAAATGGGGATGG - Intergenic
1143337027 17:6179038-6179060 CCTCACAGATAAGATGGGCAGGG + Intergenic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1143971704 17:10800690-10800712 CCAAATATGTAAAATGGAGATGG - Intergenic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144995355 17:19264516-19264538 CCTCATTTGTAAAATGGAAATGG - Intronic
1145035642 17:19538693-19538715 CCTCACATGTAAAAGAAGGGGGG + Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146134528 17:30307282-30307304 CCTCATCTATAAAATGGGAATGG - Intergenic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146472275 17:33134191-33134213 TCTTATATGTAAAATGGGGATGG - Intronic
1146582503 17:34051428-34051450 CCTCACCTGTAAAATTGGATTGG + Intronic
1146921024 17:36711756-36711778 TTTCACCTGTGAAATGGGGATGG + Intergenic
1146935827 17:36812168-36812190 CCTCATCTGTGAAATGGTGATGG - Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147039796 17:37709800-37709822 CCTCATCTATAAAATGGGGGCGG - Intronic
1147128736 17:38392936-38392958 CTTTATATGTGAAATGGGGATGG + Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148383059 17:47214053-47214075 TATCACTTGTAAAATGGGGGAGG - Intronic
1148588060 17:48794942-48794964 CCTCATCTGTAAGATGGAGATGG + Intronic
1148804767 17:50258655-50258677 CCTCACCTGTAAAATGGGATGGG - Intergenic
1148849233 17:50546856-50546878 TCTCATTTGTAAAATGGGCAGGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1149315457 17:55434276-55434298 TCTCACCTGTAAAATGGGGGAGG + Intergenic
1149576197 17:57715377-57715399 CCTCACCTGTGCAATGGGGAGGG - Intergenic
1150625245 17:66837067-66837089 CCTCACCTGTAAGATGGGTCTGG + Intronic
1150630080 17:66874164-66874186 GCTCACCTGTAAAATGGGTGTGG + Intronic
1150802551 17:68292908-68292930 CCAGATCTGTAAAATGGGGATGG + Intronic
1151340417 17:73467393-73467415 CCTCATCTGTAACATGGAGATGG + Intronic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1151796881 17:76352792-76352814 CCTCATCTGTGAAATGGGCATGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152368052 17:79868825-79868847 CCTCCCATGTAAATCTGGGACGG + Intergenic
1152625464 17:81386258-81386280 GCTCATCTGTAAAATGGGCATGG + Intergenic
1153133241 18:1882074-1882096 CATCACAGGTAAAACGAGGAAGG - Intergenic
1153235664 18:2984704-2984726 CCTCACATTTAAAGTGGATATGG - Intronic
1153256767 18:3179508-3179530 CCTCAGATGTGAAATGGAGAGGG + Intronic
1153347196 18:4039688-4039710 CTTCAAATATAAAATGGTGATGG + Intronic
1153415527 18:4841746-4841768 CCTTACCAGTAAAATGAGGATGG + Intergenic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154318557 18:13325717-13325739 CCTCATCTGTAATGTGGGGATGG + Intronic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1155210648 18:23597821-23597843 CCTCAACTGTAAGATGGGGATGG + Intergenic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156029852 18:32700088-32700110 CCTTAGATGTAAAATGTGGGAGG - Intronic
1156348587 18:36283136-36283158 CCTCATTTCTAAAATGGAGATGG - Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157198834 18:45642003-45642025 CCTCATCTGTAAAATGGGCCAGG - Intronic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1157562213 18:48656365-48656387 CCCCATCAGTAAAATGGGGATGG + Intronic
1157583939 18:48789324-48789346 CCTCACTGGTAAGATGAGGATGG + Intronic
1157796766 18:50582043-50582065 TCTCATATGTAAAGTGGAGAGGG + Intronic
1158219819 18:55139109-55139131 TCTCAACTGTAAAATGGGCATGG + Intergenic
1158451384 18:57568970-57568992 CCTCAGCTAGAAAATGGGGATGG - Intronic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1160309646 18:77777614-77777636 CACCCCATGAAAAATGGGGAAGG + Intergenic
1160557995 18:79738437-79738459 CCTCACCTGTGAAATGAGGTAGG + Intronic
1160848537 19:1178075-1178097 TCCCACCTATAAAATGGGGAGGG + Intronic
1161084392 19:2327928-2327950 CCTCATTTGTCAAATGGGGCTGG - Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1161631843 19:5360925-5360947 CCCCATCTGTAAAATGGGGCTGG - Intergenic
1161772813 19:6240489-6240511 CCTCACCTGTGAAGTGGGAAAGG + Intronic
1162048096 19:8014783-8014805 CCTCATCTCTAAAATGGGGGTGG + Intronic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163404001 19:17111215-17111237 CCTCACATGTCAGGTGGGGGTGG - Intronic
1163481415 19:17558830-17558852 CCTCATCTGTAACATGGGGGTGG - Intronic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1165152466 19:33769121-33769143 CCTCACAGGTAAAATGGAACAGG + Intronic
1166068503 19:40374318-40374340 CCTCACATGTGAAATGGATGTGG + Intronic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166108454 19:40609128-40609150 TCTCATTGGTAAAATGGGGATGG + Intronic
1166195383 19:41202433-41202455 CCTCACCTAGGAAATGGGGATGG + Intronic
1166545244 19:43630585-43630607 TCTCACCTATAAAATGGGAATGG - Intronic
1167006891 19:46782159-46782181 CCTCATCTATAAAATGGGAACGG - Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167563060 19:50238069-50238091 GCAGAGATGTAAAATGGGGAAGG - Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
925139948 2:1543221-1543243 CTTCACATGTGAAATGAGGACGG - Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925803943 2:7630017-7630039 TCTCACATGTAAAATAGAAATGG + Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926396441 2:12447380-12447402 CCTCACATGGCAAAAGGGAAGGG - Intergenic
926710447 2:15875359-15875381 TCCCTCATGAAAAATGGGGATGG - Intergenic
926725992 2:15998412-15998434 CCTCAACTGTAAAATGGAGATGG - Intergenic
926882311 2:17559579-17559601 CATCATATGTAAAATGAGTAGGG + Intronic
926886203 2:17601210-17601232 CCTTATTTGTAAAATGGGGGAGG - Intronic
926920650 2:17936837-17936859 CCTCATCTATAAAATGGGAATGG - Intronic
926928406 2:18011770-18011792 CCTCTTCTGTGAAATGGGGATGG + Intronic
927088664 2:19694095-19694117 CCTCATCTATAAAATGGGCAGGG + Intergenic
927204150 2:20596463-20596485 CCTCACATGTGAAAGTGGCAAGG - Intronic
927709463 2:25315627-25315649 CGTCACCTGTAAACTGGGCACGG - Intronic
927890266 2:26743741-26743763 CCTCACCTGTAAGTTGGGCATGG - Intergenic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
928253972 2:29706118-29706140 CCTCATCTGTAAAATGGAGTGGG + Intronic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928540188 2:32277515-32277537 CCTCACCTGTAAGATGAAGAGGG - Intergenic
928649379 2:33388469-33388491 CCTCACTGGTAAAATGGAGATGG + Intronic
928999352 2:37330372-37330394 CCTTACATGTAAAATGAGGGGGG + Intergenic
929284194 2:40116988-40117010 CCTAATCTGTTAAATGGGGATGG + Intronic
929666842 2:43839969-43839991 CTTCTCAGGTAAAATGAGGAAGG - Intronic
929670524 2:43873674-43873696 TCTCCTATGCAAAATGGGGATGG - Intronic
929870942 2:45758867-45758889 CCTCACCTGTAAAGTGCAGAGGG + Intronic
929954104 2:46442484-46442506 GCTCATGTGTAAACTGGGGATGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931460027 2:62442558-62442580 CCTCACTTGTAGGATGGAGAAGG + Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931989099 2:67771639-67771661 CCTCATCTGTCAAATGGAGATGG - Intergenic
932200060 2:69818330-69818352 CCTCACACATAAAATGGAGATGG - Intronic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933851171 2:86367850-86367872 CCTCACCTGTAAAACAGGGATGG + Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
934942163 2:98510556-98510578 CCTCACATGACAAAAGGTGAAGG + Intronic
935170938 2:100611145-100611167 CCCCTCATGGAAAATGGGGATGG + Intergenic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
935581078 2:104756330-104756352 CCTCACAAGTAAAATGCAGACGG - Intergenic
935641704 2:105297075-105297097 GCTCACAGGTAAAATGAGGATGG - Intronic
936373815 2:111924293-111924315 GCTCACAGGGAAAGTGGGGATGG - Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
936583728 2:113731893-113731915 TTTCACATGTAAAATGGGAATGG - Intronic
936779079 2:116010227-116010249 GCTAACATGTAAAATGGGTAAGG - Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937342201 2:121098482-121098504 CCCCATCTGTAAAATGGAGATGG + Intergenic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
938770613 2:134498106-134498128 CCTCTTAGGTAAAATGGAGATGG - Intronic
939507390 2:143063713-143063735 CTTCACATATAAAATGAAGATGG - Intergenic
939955412 2:148523810-148523832 CCTCCTATGGAAAATGGGGTGGG - Intergenic
940447515 2:153793680-153793702 CATAACATGTAATATGGGAAGGG - Intergenic
940493812 2:154399481-154399503 CCTCACATGGACAAAGGGGCAGG + Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
940969467 2:159879762-159879784 CCTCACGTGTAAAATGATGATGG + Intronic
941034322 2:160551128-160551150 CCTCACCAGCAACATGGGGATGG + Intergenic
941049853 2:160720678-160720700 CCCCACCTGTAAAATGGAGATGG + Intergenic
941279563 2:163533324-163533346 CCTCACCTTTAAAATGGTGGTGG - Intergenic
941497011 2:166218246-166218268 ACTTACATGTAAAATGGGGTGGG + Intronic
941635089 2:167927536-167927558 CTTCATTTTTAAAATGGGGATGG + Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
942368891 2:175259336-175259358 CCTTACCTGTAAAATGGGAATGG - Intergenic
943166940 2:184340894-184340916 CCTCACATCCAAAATTTGGATGG + Intergenic
943313856 2:186361070-186361092 CCTCACATGTCAGAAGGGGCAGG - Intergenic
944509601 2:200451624-200451646 GCTCTCATGTGAAAAGGGGAGGG - Intronic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944621236 2:201517737-201517759 CCTCACTTGTAAAATGGAAATGG - Intronic
944988996 2:205212947-205212969 CCCCATCTGTAAAATGGCGATGG - Intronic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946317497 2:218927040-218927062 CCACACATATAAAACAGGGATGG + Intergenic
946326610 2:218987744-218987766 CCTCATTTGTAAAGTGGGTATGG + Intergenic
947429449 2:230013242-230013264 CCTCACATGGAAAATGAGATGGG - Intergenic
947944513 2:234090135-234090157 CCTTACATGGTAAAAGGGGAAGG - Intergenic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948109787 2:235445280-235445302 GCTCACAAGAAAAATGGGGGTGG - Intergenic
948404669 2:237708234-237708256 CCTCATATTTAAACTGGGGATGG + Intronic
1168973931 20:1949972-1949994 GATCACATGTGAGATGGGGAAGG - Intergenic
1168978548 20:1986176-1986198 CCTCATCTGTAAAGTGGGCATGG - Intronic
1169268079 20:4179746-4179768 CCTCTTCTGTAAAATGGGCATGG + Intronic
1169488302 20:6051901-6051923 CCTCATATGTAAAAAGGAGATGG + Intronic
1169729596 20:8772480-8772502 CCTCAAATGTAAGCTGGTGATGG + Intronic
1169906576 20:10610547-10610569 CCTCAAGTCTGAAATGGGGAAGG + Intronic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1170683440 20:18547267-18547289 CCTCACCTGTAAACTAGGGATGG + Intronic
1171489027 20:25503677-25503699 GCTCACGTGTAAGATGGGGGTGG - Intronic
1171854221 20:30330191-30330213 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172294950 20:33802931-33802953 CCTCAACTGTAAAATGGAGGTGG + Intergenic
1172298332 20:33829998-33830020 CCTCATTTGTAAAATGGGAGTGG - Intronic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1172933366 20:38601475-38601497 CCTCCTCTGTGAAATGGGGATGG - Intergenic
1173092164 20:39983391-39983413 CCTCTCATGTAAAGGGTGGAGGG + Intergenic
1173153176 20:40585094-40585116 CCCCATCTGTAAAATAGGGATGG + Intergenic
1173153770 20:40590212-40590234 CCTTATTTGAAAAATGGGGAGGG - Intergenic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173547065 20:43905965-43905987 CCTGACCTGTAAACTGGGGATGG + Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173785983 20:45792932-45792954 ACTCACGTACAAAATGGGGAAGG + Intronic
1173795130 20:45854596-45854618 CTTCAGCTGTAAAATGGAGAAGG - Intronic
1173852795 20:46229294-46229316 CCTCAGCTGTAAAATTGGGGGGG - Intronic
1173852985 20:46230487-46230509 CCTCAGCTGTGAAATGGGGATGG - Intronic
1173912404 20:46680022-46680044 CCCCATCTGTAAAATGGGTATGG + Intronic
1173929564 20:46807484-46807506 TCTCAACTGTAAAATGGGGGTGG - Intergenic
1173958621 20:47053979-47054001 CCCCATTTGTAAAATGGGGATGG + Intronic
1174065682 20:47863405-47863427 CCTCACATGTGTAGTGAGGAAGG - Intergenic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1174341914 20:49902574-49902596 CCCCATATGTAAGATGGAGATGG + Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174684531 20:52441023-52441045 CCTAATCTGTAAAGTGGGGACGG - Intergenic
1175216400 20:57393594-57393616 CCTCACCCGTAAAATGGGAGTGG + Intronic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1175855754 20:62120070-62120092 CCTTACTTGGAAAATGGGGTGGG + Intergenic
1176795000 21:13365325-13365347 CCTCACCTGTAGAATAGGAATGG - Intergenic
1177401660 21:20613554-20613576 CCTCACATGTCAAGAGAGGAAGG + Intergenic
1177695411 21:24565172-24565194 CCACCCATGTGAAATTGGGATGG + Intergenic
1177715180 21:24831237-24831259 CATCATATGTAAAATAGGGGTGG + Intergenic
1177922337 21:27167926-27167948 CCTCACCTGTAAAATAGGAATGG + Intergenic
1178248696 21:30979789-30979811 CCTTATCTGTAAAATGGGCATGG + Intergenic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178883205 21:36464776-36464798 CCCCATGTGTAAAAAGGGGATGG - Intronic
1179029244 21:37705368-37705390 CCTCATTTGTTAAATGGGAATGG + Intronic
1179144189 21:38752822-38752844 CCTCCTATCTAAAGTGGGGATGG + Intergenic
1179934629 21:44594278-44594300 AATCAAATGTAAAGTGGGGAAGG + Intronic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181849740 22:25741629-25741651 CCCCACTTGTAAAGTGGGGCTGG + Intergenic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1181997758 22:26896240-26896262 TCTCATGTGTAAAATGGGAATGG - Intergenic
1182019898 22:27072906-27072928 CCTCACCTGTAAAATAGATATGG - Intergenic
1182047309 22:27285413-27285435 CCTCATCTATAAAATGGGAAGGG - Intergenic
1182052093 22:27321140-27321162 CCTCATCTGTAAAATGGAAATGG + Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182117013 22:27762321-27762343 CCTCATCTATGAAATGGGGATGG + Intronic
1182151281 22:28028872-28028894 CGTCATCTGTGAAATGGGGATGG - Intronic
1182168164 22:28197523-28197545 CTTCATCTCTAAAATGGGGAAGG + Intronic
1182243021 22:28932267-28932289 CCTCACCTGTAAAATAAGGCCGG + Intronic
1182287574 22:29257419-29257441 CTTCACCTGTAAAATGGCCACGG - Intronic
1182438552 22:30347364-30347386 CCTCACCAGTATAATGGGGGTGG - Intronic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1183034021 22:35127125-35127147 CCTCACCTGTAAAAAGGACAGGG - Intergenic
1183035577 22:35138666-35138688 GCTCACCTGTGAAATGGGGGTGG + Intergenic
1183059672 22:35328441-35328463 CCTGACCTGGAAAATGGGGGTGG - Intronic
1183100494 22:35580753-35580775 CCTCACCTGGAAAATGGGTTTGG + Intergenic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183308256 22:37095510-37095532 ACTCAAAAGGAAAATGGGGAGGG + Intronic
1183345688 22:37306414-37306436 CCTCTGCTGTAAACTGGGGACGG - Intronic
1183346497 22:37311187-37311209 CCCCATCTGTAAAATGGGCATGG - Intronic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183444671 22:37845442-37845464 CCTCACCTATAAAATAGGGATGG - Intronic
1183565715 22:38613564-38613586 CCTGACATATATAACGGGGAAGG + Intronic
1183630291 22:39028431-39028453 CCTCCTCTGTAAAATAGGGATGG + Intronic
1183933717 22:41250054-41250076 CCTCAGGTATAAAATGGGCATGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184128584 22:42503818-42503840 CCGCACGTGTAAAATGAGGTTGG + Intergenic
1184137378 22:42557133-42557155 CCGCACGTGTAAAATGAGGTTGG + Intronic
1184360788 22:44017176-44017198 TCTCACATCTCAAATGGGGAAGG - Intronic
1184606255 22:45576414-45576436 CCTCACCTGTAAGGTGAGGAAGG - Intronic
1184697079 22:46145776-46145798 CCTCATCTCTAAAATGGGGCAGG - Intergenic
1184747736 22:46465799-46465821 CCTCACCTGTGAACTGGGGGTGG - Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
949484507 3:4524873-4524895 TCTCACCTGTAAAATGGGAGAGG + Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949866451 3:8551451-8551473 TCTCACCTGTAAAATGGGTTTGG - Intronic
949934132 3:9103460-9103482 CCTCATTTGTGAAATGGTGATGG - Intronic
950099665 3:10349060-10349082 CCTCATTTGTAAAATGGCTATGG - Intronic
950128697 3:10527328-10527350 CCTACCCTGTAAAATGGGGGTGG - Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950175661 3:10872401-10872423 CATTACTTGGAAAATGGGGATGG - Intronic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950542086 3:13618770-13618792 CCTCTCCTGTGAAATGGGGTGGG + Intronic
950650636 3:14404506-14404528 CCTTACCTGTAAAATGGGTGGGG + Intronic
950654971 3:14430919-14430941 CCTCATCTGTAAAATGGGCTTGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
951202526 3:19890965-19890987 CCTCATATGTCAAATGGAAATGG + Intronic
951373898 3:21889321-21889343 CCTCAGATGCAAGATGGGGGAGG + Intronic
951410217 3:22354192-22354214 ACTCAGTTGGAAAATGGGGATGG - Intronic
951507188 3:23460418-23460440 CCTCATATGTAAAATGGAAATGG + Intronic
951589442 3:24247434-24247456 CCCCAACTGTAAAATGTGGATGG - Intronic
951685109 3:25335117-25335139 CCTCAGCTATAATATGGGGATGG + Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952654865 3:35773328-35773350 CATCATCTGTAAAATAGGGAAGG - Intronic
952685672 3:36145380-36145402 CCTCACATGGAGAAAGGGCAAGG + Intergenic
952976348 3:38699461-38699483 TCTCACAGGAAAAATGGTGAGGG + Intronic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953073236 3:39544650-39544672 CCTCAACTCTAAAATGGGAATGG - Intergenic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
954584404 3:51720965-51720987 CCTGACATGGGAAAGGGGGAGGG + Intergenic
954619839 3:51989243-51989265 CCTCATCTGTGAAATGGAGATGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
955071129 3:55573261-55573283 CCTCATCAGTAAAATGGGTATGG + Intronic
955530729 3:59870284-59870306 CCTCACCTGTGACATGGGAATGG - Intronic
955708531 3:61754264-61754286 GCTCAGCTGTAAAATGGAGATGG + Intronic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
955961114 3:64342154-64342176 CCTCAAATGATAAATGGGAATGG + Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
957194228 3:77047314-77047336 CCTTACCTGTAAAATGGGCATGG + Intronic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959924948 3:111910551-111910573 CCTCAAATGCAAACTGGGGTTGG - Intronic
960574498 3:119216861-119216883 CCTCATCTGTAAAATGGCAATGG + Intronic
960996401 3:123343373-123343395 CCTCACCTGTAACATGGGGTGGG - Intronic
961535496 3:127568137-127568159 CCTCATCTGTAAAATGGGATAGG + Intergenic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
962531614 3:136286488-136286510 CCTGCCATTTAAAATGGCGAAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963417703 3:145018998-145019020 CCTCATATGTAATATAGGCATGG - Intergenic
963643768 3:147888805-147888827 CCTCACCTGTTAAATGAAGATGG - Intergenic
963841843 3:150115858-150115880 CCTCATATATAAAATGGGATAGG - Intergenic
964116082 3:153137689-153137711 CTTCACATGGCAAATGGGGAAGG - Intergenic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
964903499 3:161690047-161690069 GCTTACATGGAAAATGGTGATGG - Intergenic
965073985 3:163953490-163953512 GCTCTCAGGCAAAATGGGGAGGG - Intergenic
965507714 3:169534755-169534777 CCTCCTCTGTAAAATAGGGATGG - Intronic
966500126 3:180630039-180630061 CCTCACTTGGAAAATGAAGAGGG - Intronic
967091322 3:186137273-186137295 CCCTACATGTAAAATGGGGCTGG - Intronic
967342485 3:188415167-188415189 CTTCAGATGTAAAATACGGAGGG - Intronic
967534889 3:190590644-190590666 TTTCACTTGTAAAATGGGAAGGG + Intronic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969319342 4:6402422-6402444 TCTCACCTGCAAAATGGGCATGG + Intronic
969350160 4:6593656-6593678 CCTCCGCTGTAAAATGGGGATGG + Intronic
969520618 4:7675825-7675847 CCCCATCTCTAAAATGGGGATGG - Intronic
970206317 4:13659039-13659061 CATCAGCTGTAAAATGAGGAGGG - Intergenic
970237711 4:13975402-13975424 CCTCACATGGCGAAAGGGGAAGG + Intergenic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
970991307 4:22216338-22216360 CCTCAGCTATAAAATGAGGATGG + Intergenic
971474477 4:27059148-27059170 CCTCACGTGTGAAATGGGGATGG + Intergenic
971493840 4:27242821-27242843 CCCAAGCTGTAAAATGGGGAGGG + Intergenic
972336409 4:38110661-38110683 CTTCACATATAAAATGAGAATGG - Intronic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
974373408 4:61045757-61045779 CCTCACATGTCAAAGACGGATGG - Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976829904 4:89303713-89303735 CATAAAATGTAAAATGGTGACGG - Intronic
976995465 4:91426957-91426979 CCTCACCTAGAAAATGGGGATGG - Intronic
977141927 4:93384126-93384148 CCTCACATGGCCAAAGGGGAAGG + Intronic
977334566 4:95680141-95680163 CCTCACATGTAAATTTAGCAGGG + Intergenic
978326732 4:107566155-107566177 AGTCACATGTCAAATGAGGATGG - Intergenic
978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG + Intronic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
981316314 4:143343137-143343159 CCTTACCTGTAAAATGGGGGAGG + Intronic
984653295 4:182291580-182291602 CCTCAGCTGTACCATGGGGAGGG - Intronic
985039811 4:185878857-185878879 CCACACACGGAAAGTGGGGAGGG - Intronic
985557828 5:566022-566044 CCTCACCTGTAAAATAGTGCAGG - Intergenic
985849658 5:2379261-2379283 CCTCACCTGTGAAGTGGGGCAGG + Intergenic
986010814 5:3713438-3713460 CCTCACATCTAAAATGTGGGTGG - Intergenic
986102419 5:4626275-4626297 TCTCACATCCTAAATGGGGAAGG + Intergenic
986321496 5:6635523-6635545 CCCCACCTGTAGAATGGGCATGG + Intronic
988392105 5:30647665-30647687 AATCATATGTAAAAAGGGGAGGG + Intergenic
989062275 5:37421080-37421102 CCTCACCTGTCGAAAGGGGATGG - Intronic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
990465451 5:56067244-56067266 CCTCACATGGAGAAAGGGTAAGG - Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990544312 5:56807215-56807237 CTTCACCTGGAAAATGGCGATGG + Intergenic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991442516 5:66665775-66665797 CCTCACTGGTAAAATGTGGTGGG + Intronic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992017761 5:72593399-72593421 CCTCACCTGTAAAATGCCTATGG - Intergenic
992598048 5:78366096-78366118 CCTCACATGGCAGAAGGGGATGG + Intronic
992796298 5:80257200-80257222 CCTCACCGCTAAAATGGGTACGG - Intergenic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
993436751 5:87905218-87905240 CCTCACATCTCCACTGGGGAAGG - Intergenic
993693017 5:91026040-91026062 TCTCATTTTTAAAATGGGGATGG - Intronic
993969765 5:94404873-94404895 CCTCATTTATAAAATGGTGAGGG + Intronic
994205638 5:97032578-97032600 CCATACAGGTAAAATGGGAAGGG - Exonic
994294828 5:98078387-98078409 CCTTATTTGTAAAATGGAGATGG - Intergenic
994470438 5:100197982-100198004 CCTCACATCAAAACTGGGAATGG + Intergenic
995037562 5:107552415-107552437 CCTCACCTATTAAATGAGGATGG - Intronic
995280647 5:110331758-110331780 CCTCACATGTGGAAGGGGAAGGG - Intronic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
996155139 5:120090166-120090188 TCTCACCTGTAAAATGTGGTAGG + Intergenic
996347043 5:122498833-122498855 TCCCACTTGTAAAATGGGGATGG - Intergenic
996767690 5:127050673-127050695 CCTCATATATAAAATGGGAGTGG + Intronic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
996864161 5:128100320-128100342 CCTTATATGAAAAATGGGAAAGG + Intronic
997019954 5:129988212-129988234 ACTCACATGTAAAATGGCTCTGG - Intronic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997800504 5:136856199-136856221 CACCACATGAAGAATGGGGAGGG + Intergenic
998130132 5:139647754-139647776 CCTCACCTGAGAAATGGGAACGG + Intronic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998480224 5:142457025-142457047 CTCCACTTGTAAAATGAGGATGG - Intergenic
998498446 5:142611363-142611385 CCTCACCTGTGGAATGGGAATGG - Intronic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
998928008 5:147148542-147148564 TCTCAAGTATAAAATGGGGATGG + Intergenic
998986293 5:147761379-147761401 CCTCATGTGTAAAATGGAAAAGG - Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999645265 5:153711554-153711576 CCTCATGTGTAACATGGGGTGGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
999996231 5:157095035-157095057 CCTTCACTGTAAAATGGGGATGG + Intronic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000281529 5:159786561-159786583 TCCCACCTGTAAAATGGGAATGG + Intergenic
1000421643 5:161044817-161044839 TCTCACTTATAAAATGAGGATGG - Intergenic
1000778238 5:165445555-165445577 TCTCACATGGAAAATGAAGATGG - Intergenic
1001086665 5:168704981-168705003 CCTCAGCTGTAAAATGGAGGAGG - Intronic
1001109336 5:168882948-168882970 CATCTTCTGTAAAATGGGGATGG - Intronic
1001131614 5:169069148-169069170 CCTCAACTGTAAATTGGGGGTGG - Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001591426 5:172867920-172867942 ACTCATCAGTAAAATGGGGAGGG - Intronic
1001699117 5:173694054-173694076 CCTCCTCTCTAAAATGGGGATGG - Intergenic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002102922 5:176866240-176866262 CCTCACATCAAAGATGGGGTAGG + Intronic
1002295484 5:178228584-178228606 CCCCACCTGTAAAATGAAGATGG + Intronic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1003849734 6:10209441-10209463 TCTCACCTGTAAAATGGGGCTGG - Intronic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1005021650 6:21424181-21424203 CATCCCATGGAAAATGGGCAAGG - Intergenic
1006453064 6:34116277-34116299 CCTCTCCTGTAAAATGGGGCCGG + Intronic
1006590814 6:35155558-35155580 TCTTATATGTAAAATGGTGAAGG - Intergenic
1006793208 6:36716901-36716923 GCTCATTTGTAAAATGGGGTGGG - Intronic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1007107959 6:39296272-39296294 CCTCACCTGTAAAAGGGGGCTGG - Intergenic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007234551 6:40381079-40381101 CCTCAAATGTAAAATGGTTCTGG - Intergenic
1007283611 6:40731027-40731049 CCTCACCTGTATAATGGAGATGG - Intergenic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1007946693 6:45833442-45833464 CTTCACATATAAAATGAGAATGG + Intergenic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1009381513 6:63036288-63036310 CCTCACATGTGCACTGAGGAAGG - Intergenic
1010188911 6:73174739-73174761 CCTCACTGGCAAACTGGGGATGG + Intronic
1010393995 6:75369649-75369671 CCACACTTCTAAAACGGGGATGG + Intronic
1010715649 6:79226347-79226369 TCTCATATGTAAAATGAGAACGG + Intronic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013139054 6:107312521-107312543 CCCCATCTGTTAAATGGGGATGG + Intronic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013298133 6:108778401-108778423 CCTGTAATGGAAAATGGGGATGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1014388527 6:120831646-120831668 CCTCATATTTGAAATAGGGATGG - Intergenic
1014641772 6:123920499-123920521 TCTCACATGGAAAATATGGAAGG - Intronic
1015161831 6:130160809-130160831 TTTCAAATGTAAAATGTGGAAGG + Intronic
1015187617 6:130436122-130436144 CCTCCCATTTGAGATGGGGAGGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1016294341 6:142558658-142558680 CCTCACATGTAAAAATGGTCTGG - Intergenic
1016510592 6:144838651-144838673 CTTTATTTGTAAAATGGGGAGGG - Intronic
1016904639 6:149136764-149136786 CCTCACATGGCAGAAGGGGAAGG + Intergenic
1018021783 6:159767935-159767957 CCTTACCTGTAAACTGGGAATGG - Intronic
1018838571 6:167503031-167503053 CCTCACCTACAAAATGAGGATGG + Intergenic
1019561405 7:1660510-1660532 TGTCACCTGTAAAAGGGGGAAGG + Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022010192 7:26302148-26302170 CCTGAGATGGAAAATGGGAAGGG - Intronic
1022040764 7:26579351-26579373 CCTCATCTGTAAAATGGAGCTGG + Intergenic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024218340 7:47266806-47266828 CATGATCTGTAAAATGGGGATGG + Intergenic
1027586232 7:80062201-80062223 TCCCACATGAAACATGGGGATGG - Intergenic
1028614932 7:92755474-92755496 CCTCACATGAAACATGGCGAGGG + Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029734974 7:102460600-102460622 CCTCCTTTGTAAAATGGAGAAGG - Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1030707271 7:112706675-112706697 CCTCACATGTTAAATAAGAATGG - Intergenic
1031492605 7:122407499-122407521 TTTCATATGTGAAATGGGGAGGG - Intronic
1031788449 7:126065974-126065996 CCTCCCATGACAGATGGGGATGG + Intergenic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033858048 7:145588988-145589010 AATCACATGTAATCTGGGGATGG - Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035441082 7:158900667-158900689 ATTCACATGTATAATGGGGATGG - Intronic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037157343 8:15719755-15719777 CCTGGCATGTGAAATGGGGATGG - Intronic
1037287241 8:17314415-17314437 CTTCATTTTTAAAATGGGGAAGG + Intronic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1038003843 8:23413223-23413245 TCTCACCTGTAAAATAGGGAGGG + Intronic
1038684565 8:29704526-29704548 CCTCACATGGCAAAAGGGCAAGG + Intergenic
1039914794 8:41852014-41852036 CCTCAGTTATAAAATGGGCATGG - Intronic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1041863213 8:62537779-62537801 CATCACATGTAAAATGGAGCTGG + Intronic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1043651033 8:82592386-82592408 CCTCACATGTGGAAAGGGCAAGG + Intergenic
1044014700 8:87036926-87036948 CTTCACAAGTAAAATTGGAAGGG - Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044641832 8:94390639-94390661 CCTCACCAAAAAAATGGGGATGG + Intronic
1044707446 8:95022677-95022699 TAACACATTTAAAATGGGGAAGG + Intronic
1044774775 8:95676930-95676952 CCTTACAAGCCAAATGGGGAAGG - Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044844314 8:96365402-96365424 CCTCATCTATAAAATAGGGATGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045041620 8:98229987-98230009 CCTCACTTGTCAAATGTAGATGG - Intronic
1045067650 8:98465185-98465207 CCTCACCTGTCAAACGGGGTTGG - Intronic
1045147073 8:99357959-99357981 CTTCATTGGTAAAATGGGGATGG + Intronic
1045176724 8:99732987-99733009 TCTCACATTTAAAAGGGGGAGGG + Intronic
1045256361 8:100526979-100527001 CTTCACACGTATAATGTGGAAGG + Intronic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045547969 8:103144947-103144969 CCTCACTTGTAAAAGGAGGGTGG - Intronic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1046375449 8:113373658-113373680 ACTAACATGAAAAATGGGAAAGG + Intronic
1046902861 8:119541506-119541528 GCTCACTTATAAAATAGGGATGG - Intergenic
1047009178 8:120652642-120652664 CATCCCATGTAAAATTGAGATGG + Intronic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047218867 8:122902432-122902454 CCTCAGCTGTACATTGGGGATGG + Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047539258 8:125748393-125748415 CCTCACATGGTAAAGGGGCAAGG + Intergenic
1047706037 8:127500569-127500591 CCTCACCTCTAAAATGGAGATGG - Intergenic
1047765926 8:127989888-127989910 CCTCATTAGTAAAATAGGGATGG + Intergenic
1047774642 8:128059755-128059777 CCCCATGTGTAAAATGGGGATGG - Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1047873030 8:129106091-129106113 CCTGGCCTGTAAAATGGGGATGG + Intergenic
1048070386 8:131014732-131014754 TCTCATATGTTAAATGGGAATGG + Intronic
1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG + Intronic
1048509665 8:135050774-135050796 CCTTAGCTGTAAAATGGGGCTGG + Intergenic
1048809468 8:138272954-138272976 CCTCATCTGTGAACTGGGGATGG + Intronic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1048998744 8:139810705-139810727 CCTGACATGAATTATGGGGAGGG + Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1050351218 9:4741967-4741989 CCTCTCCTGTAAAATGAGGTAGG - Intronic
1050459662 9:5866880-5866902 CCTCATCTGTAAAATGGGACTGG + Intergenic
1050739392 9:8802748-8802770 CCTCATCTTTAAAATGGAGATGG + Intronic
1051018448 9:12510509-12510531 CCTCACATGTAAAACAAGCAAGG + Intergenic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1051188612 9:14487047-14487069 CCAGACATGTAAAATGTTGATGG - Intergenic
1051730648 9:20139342-20139364 CCGCACCCATAAAATGGGGATGG + Intergenic
1052012200 9:23423657-23423679 CCTCACCTGTAAATTGGAAATGG - Intergenic
1052896559 9:33752378-33752400 CCTCAAATGTAAAATGGGTGAGG + Intronic
1053020814 9:34692659-34692681 CCTTATTTGTAAAATGGGAATGG + Intergenic
1053350269 9:37409390-37409412 CCTTATCTGTAAGATGGGGATGG + Intergenic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053446905 9:38159594-38159616 CCTCATTTGTTAAATGGGGATGG - Intergenic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1053546328 9:39026808-39026830 TCTCACATGTATAATTGGGAAGG - Intergenic
1053792030 9:41693472-41693494 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1053810643 9:41848470-41848492 TCTCACATGTATAATTGGGAAGG - Intergenic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054153126 9:61621293-61621315 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054180435 9:61905492-61905514 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054472920 9:65552497-65552519 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054619950 9:67338969-67338991 TCTCACATGTATAATTGGGAAGG + Intergenic
1054657156 9:67675650-67675672 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054784720 9:69199889-69199911 CCCTATTTGTAAAATGGGGATGG + Intronic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1055106450 9:72518310-72518332 CCTCATACATAAAATGAGGATGG + Intergenic
1055139395 9:72858566-72858588 CCTCCCCTGTAAAATATGGAAGG + Intergenic
1055407186 9:75987398-75987420 CCCCACAAGTCCAATGGGGAAGG - Intronic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055678429 9:78690087-78690109 CCAGACATGGAAAATGGGAAAGG - Intergenic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056282407 9:85054389-85054411 CCTCCTTTGTAAAATGGGGTTGG + Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1057180734 9:93028716-93028738 CCTCACCTGTAAAATGGGATGGG - Intronic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057695569 9:97320600-97320622 CCTCCTCTGTAAAATAGGGATGG + Intronic
1057744547 9:97741020-97741042 CCTCACTGGTAAAATGAGAAGGG + Intergenic
1057824918 9:98365018-98365040 TCTCATTTGTAAAATGGGCAGGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058276714 9:103051018-103051040 GCTTACATGGAAATTGGGGATGG + Intergenic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058674535 9:107389184-107389206 CCTCAACTGTAAAATGGAGATGG + Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1058805445 9:108586799-108586821 CCTCATGTGTGAAATGGGGATGG - Intergenic
1059246756 9:112855783-112855805 CCTCACAATTAACATGGAGAAGG - Intronic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059788643 9:117615628-117615650 CCTAATCTGTAAAATGGGAATGG - Intergenic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060105346 9:120869644-120869666 CCTCAACTGTAAAGTGGAGATGG - Intronic
1060141256 9:121212337-121212359 CCTCATCTGTAAAATAGGTATGG + Intronic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1060694725 9:125698695-125698717 CGGCATTTGTAAAATGGGGACGG + Intronic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1060926939 9:127461665-127461687 CCTCGTGTGTAAACTGGGGATGG - Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062010516 9:134264386-134264408 CCTCATCTCTGAAATGGGGATGG + Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186083695 X:5962779-5962801 CCTCACATGGAAAAAGGGTGAGG - Intronic
1186240519 X:7560725-7560747 CCTGGCCTGTAAAATGGAGAAGG - Intergenic
1186373113 X:8967070-8967092 CCTGACATGTATAATGGGTGGGG + Intergenic
1186444151 X:9611826-9611848 CCTCACATATAAAATGGGGATGG - Intronic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1187668290 X:21640577-21640599 CCTCCCTTAGAAAATGGGGAGGG - Intronic
1188024199 X:25191649-25191671 CCCCTCATGTAAAAAGGGGTGGG - Intergenic
1189025565 X:37390142-37390164 CCTCACATGGCAAAAGGGGATGG + Intronic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189352171 X:40283896-40283918 CCTCATCTGTAAGGTGGGGATGG + Intergenic
1189907066 X:45772089-45772111 CCCCACATGAAAAATCTGGAAGG + Intergenic
1190309570 X:49107270-49107292 CCTCATATGTAAAATGGACATGG + Intergenic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1190916345 X:54814057-54814079 CCTCAACTGTAAAACGGGGATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1191211860 X:57892732-57892754 CCTCAAATGTGAACTGAGGATGG - Intergenic
1192094897 X:68200172-68200194 CCTCACTGGTAAAATGGGGGGGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192549595 X:72043457-72043479 CCTTGTGTGTAAAATGGGGATGG - Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1195916014 X:109936045-109936067 CCTCATCTGTAATATAGGGATGG + Intergenic
1196013794 X:110916066-110916088 CCTCACCTATAAAATCAGGATGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1197721763 X:129750191-129750213 GCACATTTGTAAAATGGGGATGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1201782999 Y:17743863-17743885 TCTCACCTCTAAAATAGGGATGG - Intergenic
1201818554 Y:18162124-18162146 TCTCACCTCTAAAATAGGGATGG + Intergenic