ID: 1161617837

View in Genome Browser
Species Human (GRCh38)
Location 19:5282023-5282045
Sequence TTCTGGGGACGCCCAGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161617837_1161617847 26 Left 1161617837 19:5282023-5282045 CCGCAGCCTGGGCGTCCCCAGAA 0: 1
1: 0
2: 1
3: 25
4: 316
Right 1161617847 19:5282072-5282094 GGCTCTCAGCACAGAGGTCAAGG 0: 1
1: 0
2: 0
3: 30
4: 266
1161617837_1161617846 20 Left 1161617837 19:5282023-5282045 CCGCAGCCTGGGCGTCCCCAGAA 0: 1
1: 0
2: 1
3: 25
4: 316
Right 1161617846 19:5282066-5282088 TTATGTGGCTCTCAGCACAGAGG 0: 1
1: 0
2: 3
3: 21
4: 215
1161617837_1161617844 5 Left 1161617837 19:5282023-5282045 CCGCAGCCTGGGCGTCCCCAGAA 0: 1
1: 0
2: 1
3: 25
4: 316
Right 1161617844 19:5282051-5282073 GGCTGAGATACCTGCTTATGTGG 0: 1
1: 0
2: 0
3: 6
4: 106
1161617837_1161617848 27 Left 1161617837 19:5282023-5282045 CCGCAGCCTGGGCGTCCCCAGAA 0: 1
1: 0
2: 1
3: 25
4: 316
Right 1161617848 19:5282073-5282095 GCTCTCAGCACAGAGGTCAAGGG 0: 1
1: 0
2: 0
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161617837 Original CRISPR TTCTGGGGACGCCCAGGCTG CGG (reversed) Intronic
900109530 1:999697-999719 TTCTGAGGGCGTCCAGGATGAGG + Exonic
900347328 1:2215965-2215987 TGCTGGTGATGCCCAGGCCGCGG + Intergenic
900409087 1:2504793-2504815 CTCCCGGGAGGCCCAGGCTGTGG - Exonic
900558349 1:3291242-3291264 TCCTGGGAACGCCCTGACTGGGG - Intronic
900590287 1:3456459-3456481 TTCTAGTGACTCCCTGGCTGAGG + Intronic
901404961 1:9039474-9039496 TTTTGGCGGCGCCGAGGCTGGGG + Intronic
902551943 1:17224438-17224460 TTCCGGGCACCCCAAGGCTGCGG + Intronic
902876517 1:19343855-19343877 CCCTGAGAACGCCCAGGCTGAGG + Intronic
903355377 1:22743347-22743369 TTCTTGTGAGACCCAGGCTGAGG + Intronic
903655796 1:24948149-24948171 GTCTGGGGACCCCCAGGAAGAGG + Intronic
903843937 1:26265536-26265558 TGATGGGGAAGCCCAGGGTGAGG + Intronic
903991414 1:27272875-27272897 GGCTGGGGTTGCCCAGGCTGGGG - Intronic
905629105 1:39509017-39509039 CTGTGGGGACGCCCGTGCTGTGG - Intronic
907831055 1:58064600-58064622 TGCAGGGGACTCCAAGGCTGAGG + Intronic
908117528 1:60954442-60954464 TTCTGGGGAGGCACAAGCAGTGG - Intronic
909863850 1:80640403-80640425 TTCTGGGAAACCTCAGGCTGTGG - Intergenic
910294539 1:85631074-85631096 TTCTCGGGAGGCCGAGGCAGGGG + Intergenic
911232821 1:95378675-95378697 TTGTGCTGTCGCCCAGGCTGCGG + Intergenic
912242785 1:107928113-107928135 TTCTCTGGACCACCAGGCTGAGG - Intronic
913323872 1:117609581-117609603 TGCTGAGGACGCCAAGGCAGTGG + Intronic
915563715 1:156702339-156702361 TACTTGGGACGCTGAGGCTGGGG + Intronic
920791277 1:209095267-209095289 TTCTATGTAAGCCCAGGCTGAGG - Intergenic
921914645 1:220593819-220593841 TCCTGGGTAGGCCCAGGCAGGGG + Intronic
922729410 1:227942072-227942094 TGCTGGGGTGGCCCGGGCTGGGG - Intronic
923085060 1:230696862-230696884 TGATGGGGGCGCCCAGGGTGTGG + Intergenic
923519704 1:234726026-234726048 CTCTGGGGACCCCAAGCCTGTGG - Intergenic
923665173 1:235992975-235992997 GACTGGGGACGCTGAGGCTGGGG + Intronic
924502530 1:244651120-244651142 TTTTGGGGAGGAGCAGGCTGGGG - Intergenic
1064410430 10:15099385-15099407 TTTTGGGGAGGCCGAGGCTACGG + Intronic
1067851417 10:49756995-49757017 GTCAGGGGTGGCCCAGGCTGGGG + Intronic
1070326533 10:75393197-75393219 TTTTGGGGACTCCCAGCATGGGG + Intergenic
1071554526 10:86592219-86592241 TTCTGGGGACGCAGAGACTGTGG + Intergenic
1072220947 10:93327106-93327128 TTCTGGGGACCCTCACTCTGGGG + Intronic
1072308710 10:94133478-94133500 TTCTGGCAACCCCCAGGCAGTGG - Intronic
1072755298 10:98016747-98016769 ATCTGGGGACCACAAGGCTGGGG - Intronic
1073384789 10:103116682-103116704 TACTGGGGAGGCTGAGGCTGAGG - Intronic
1073487714 10:103830799-103830821 TTCTGAGGACACACAGGCTTAGG + Intronic
1074771522 10:116737947-116737969 TCCTGGGGATGCCCAGGCCTGGG + Intronic
1075374320 10:121965769-121965791 ATCTGGGGAGGCCAAGGCAGAGG + Intronic
1075465091 10:122645119-122645141 TTCTGGGGTCTTCCTGGCTGTGG + Intergenic
1075776291 10:124991073-124991095 TCCTCGGAACGCCCAGGCTCGGG + Intronic
1076795020 10:132794185-132794207 TTGTGGGGAGGCACTGGCTGTGG - Intergenic
1076810812 10:132885545-132885567 ACCTGGGGAGGCCCAGGCAGAGG + Intronic
1077374562 11:2199474-2199496 TCTTGGGAAGGCCCAGGCTGAGG - Intergenic
1077908047 11:6548858-6548880 TCCTGGTGATGCCCAGGCTGTGG - Exonic
1078239956 11:9522333-9522355 TTCTTGGGAGGCTGAGGCTGAGG - Intronic
1084225207 11:67711230-67711252 TACTGGGGAGTCCCAGGCCGCGG - Intergenic
1084287305 11:68140620-68140642 TCCTGGGGTAACCCAGGCTGTGG - Intergenic
1084618416 11:70251868-70251890 CTCTGGGAACGCACAGACTGGGG - Intergenic
1084741281 11:71140968-71140990 TCCTGGGGACACCCAGCCTTGGG - Intronic
1085296114 11:75432723-75432745 CTCTGGGGATCCCCAGTCTGGGG + Intergenic
1085809584 11:79668024-79668046 TCCAGGGGACACCCAGGCTGTGG + Intergenic
1087923530 11:103894047-103894069 TTCTGGTCACAACCAGGCTGAGG + Intergenic
1089155752 11:116401095-116401117 CTCTGGGGCCACACAGGCTGGGG + Intergenic
1089354989 11:117843770-117843792 CTCTGGGGAAGCAGAGGCTGGGG - Intronic
1091587317 12:1823565-1823587 TTCTGGGGGAGCCAAGGCTGGGG - Intronic
1092341373 12:7679265-7679287 GGCTGTGCACGCCCAGGCTGGGG - Intergenic
1092393518 12:8103627-8103649 TACTGGGGACGCCAAGGCAGAGG - Intergenic
1095708263 12:45261062-45261084 ATTTGGGGAGGCCAAGGCTGGGG - Intronic
1096106137 12:48997974-48997996 TTGGGGGGATCCCCAGGCTGTGG - Exonic
1096108270 12:49011887-49011909 TTGTGCTGTCGCCCAGGCTGGGG + Intronic
1096742591 12:53704860-53704882 GTCTGGGCATGTCCAGGCTGTGG + Intergenic
1098561819 12:71881806-71881828 TACTGGGGAAGCCGAGGCAGGGG + Intronic
1101654057 12:106704554-106704576 CCCTGGGCAGGCCCAGGCTGAGG + Intronic
1101988851 12:109468230-109468252 TCCTGGGGAAGGCCAGGGTGTGG - Intronic
1102192793 12:111001741-111001763 TTCTGGGGTCACCCAGGCCTGGG - Intergenic
1105888601 13:24664691-24664713 TACTGGGGAGGCTGAGGCTGGGG + Intergenic
1108822646 13:54372659-54372681 CTCTGGAGTCACCCAGGCTGGGG + Intergenic
1109004014 13:56846044-56846066 CTCTTGTGTCGCCCAGGCTGGGG + Intergenic
1114050045 14:18914747-18914769 CTCTGGGGAGGACAAGGCTGTGG - Intergenic
1114112513 14:19487184-19487206 CTCTGGGGAGGACAAGGCTGTGG + Intergenic
1117273109 14:54165169-54165191 TTCTGTGGACCCCCAGCCTATGG - Intergenic
1119530942 14:75361054-75361076 TACTGGGGAGGCTGAGGCTGGGG - Intergenic
1121126864 14:91413636-91413658 TTCTGGGGAGGCCCAGGGCTAGG - Intronic
1121405475 14:93716942-93716964 TGCTGAGGACGCCTGGGCTGAGG + Intergenic
1121661221 14:95636604-95636626 TTCTGGAAAGACCCAGGCTGAGG - Intergenic
1121884245 14:97528502-97528524 TTCTGGGGGCAACTAGGCTGAGG + Intergenic
1121895741 14:97645550-97645572 TTCTAGGGACTCACAGGTTGTGG - Intergenic
1122066958 14:99180516-99180538 TTCTGGGAACACCAAGGCAGAGG - Intronic
1122114996 14:99523179-99523201 GGCAGGGGAGGCCCAGGCTGGGG + Intronic
1122118635 14:99540363-99540385 ATCTGGGCACTCCCAGGCGGGGG + Intronic
1122919031 14:104872079-104872101 TCCTGTGGTGGCCCAGGCTGTGG + Intronic
1123020424 14:105395431-105395453 TTCTGGGGCCACCTGGGCTGTGG - Exonic
1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG + Intronic
1202872266 14_GL000225v1_random:175885-175907 TACTTGGGACGCTGAGGCTGAGG - Intergenic
1123500800 15:20878779-20878801 GCCAGGGGAGGCCCAGGCTGCGG + Intergenic
1123558050 15:21452472-21452494 GCCAGGGGAGGCCCAGGCTGCGG + Intergenic
1123594278 15:21889753-21889775 GCCAGGGGAGGCCCAGGCTGCGG + Intergenic
1125722677 15:41852751-41852773 TTCAGGTGACGCCCAGCTTGGGG + Intronic
1129381717 15:75172053-75172075 TACTGGGGAGGCTAAGGCTGGGG - Intergenic
1129457827 15:75685136-75685158 CCCTGGGGACTCCCAGTCTGGGG - Intronic
1130019788 15:80218961-80218983 TTGTGCTGTCGCCCAGGCTGGGG + Intergenic
1131830658 15:96352665-96352687 CTCTGGGGACTCCAAGCCTGAGG - Intergenic
1132297194 15:100748315-100748337 CTCTGTGGACACCCAAGCTGTGG + Intergenic
1132317689 15:100901793-100901815 CTGTGGGGATGCCCTGGCTGGGG + Intronic
1202966400 15_KI270727v1_random:179644-179666 GCCAGGGGAGGCCCAGGCTGCGG + Intergenic
1132783551 16:1641919-1641941 CACTGGGAACCCCCAGGCTGTGG - Intronic
1132883311 16:2171745-2171767 TCCTAGGGACGCTCAGGCTGAGG + Intronic
1133021264 16:2967924-2967946 CCCCGGGGACCCCCAGGCTGAGG + Exonic
1133090514 16:3400783-3400805 GTCTGGGGACGCCCGGCCTGAGG + Intronic
1133360923 16:5173254-5173276 TTCTGGGGCCTTTCAGGCTGTGG - Intergenic
1134061613 16:11202761-11202783 TCCTGGCGATCCCCAGGCTGGGG + Intergenic
1135240461 16:20802509-20802531 TTCTTGGGAGGCTGAGGCTGAGG - Intronic
1135588212 16:23687480-23687502 TCCCGGGGACGCTCAGGCAGGGG - Exonic
1136497184 16:30651597-30651619 CCCTGGGGAATCCCAGGCTGCGG - Exonic
1136590602 16:31215665-31215687 TTCTGGTGAGGCCCCGCCTGGGG - Intronic
1137237060 16:46625173-46625195 TTCTGGGGGCACCCATGCTGAGG + Intergenic
1137255628 16:46773036-46773058 TACTGGGGAGGCTGAGGCTGAGG - Intronic
1137708675 16:50551626-50551648 TTCAGGGGGAGCCCAGGGTGTGG + Intronic
1137722924 16:50638410-50638432 GTCTGGGGAGGCCGAGGCAGGGG - Exonic
1138496603 16:57412772-57412794 CTGTAGGGACGCCCATGCTGTGG + Intronic
1138706837 16:58923666-58923688 TTCTGGGGACCCCTAAACTGCGG + Intergenic
1141115349 16:81303989-81304011 TTCAGGAAACTCCCAGGCTGAGG + Intergenic
1141607887 16:85165628-85165650 TGCTGGGGATGGTCAGGCTGTGG + Intergenic
1141691716 16:85600395-85600417 TGATGGGGAAGGCCAGGCTGAGG + Intergenic
1141700343 16:85639398-85639420 GTCTTGGGACTCCTAGGCTGAGG - Intronic
1141750460 16:85954819-85954841 TTCAGGGGCAGCCCAGGCAGGGG - Intergenic
1141808648 16:86358922-86358944 TTCTGGGGCCACCCTGGCTCTGG + Intergenic
1141965971 16:87443625-87443647 TACTCGGGAGGCCAAGGCTGGGG + Intronic
1142130551 16:88429867-88429889 AGCTGGGGACGCCCAGGCCGAGG + Exonic
1142567849 17:852301-852323 TGCTGGAGACGCCCCGACTGAGG - Intronic
1143993941 17:10990682-10990704 TCCTGGGGACCCCCAGGAAGGGG - Intergenic
1144937407 17:18911232-18911254 TACTGGGGATCTCCAGGCTGGGG - Exonic
1145038179 17:19555833-19555855 TGCTGGGGATGGCCAGGCGGAGG - Exonic
1145242301 17:21247135-21247157 TTCTGAGGACTCCCAGGGTCAGG - Intronic
1145749692 17:27346480-27346502 TTCTGGGGCTGCTCCGGCTGTGG - Intergenic
1145813141 17:27776924-27776946 TCCTGGAGACGCTCAGGCAGTGG + Intronic
1146024070 17:29304297-29304319 TACTGGGGAGGCTGAGGCTGGGG + Intergenic
1146061122 17:29607903-29607925 TGCTGGGGAGGCCCCGGCTGTGG - Intronic
1146062660 17:29615322-29615344 TGATGGGTACCCCCAGGCTGGGG - Exonic
1147428653 17:40357947-40357969 TTCAGGGAACCCCCAGTCTGAGG + Intergenic
1147597058 17:41724233-41724255 TTCTGGGACTGCCCAGGCTATGG - Exonic
1147668872 17:42165368-42165390 TTCATGGGACTCTCAGGCTGGGG + Intronic
1148003910 17:44409302-44409324 TTCTTGGGAGGCTGAGGCTGGGG - Intronic
1148728762 17:49817263-49817285 TTCTGGTGAGGCCCAGAATGTGG + Intronic
1148810696 17:50289069-50289091 TACTGGGGAGGCTGAGGCTGAGG - Intergenic
1148912237 17:50949262-50949284 TCCTGGGGATGCCTAGGCTGGGG - Intergenic
1149238015 17:54616146-54616168 TTGTTGGGATGCCCTGGCTGTGG + Intergenic
1149669493 17:58393373-58393395 TGCTCTGGATGCCCAGGCTGGGG - Intronic
1151348733 17:73519115-73519137 CACTGGAGACCCCCAGGCTGTGG - Intronic
1152622400 17:81372023-81372045 TCCTGGGGAGGCACAGGGTGAGG + Intergenic
1152626382 17:81389598-81389620 TGCCAGGGACCCCCAGGCTGAGG - Intergenic
1152677957 17:81651293-81651315 CTCTGGGGACACACTGGCTGTGG + Intronic
1154129842 18:11727274-11727296 GTGTGGGGACTCCCAGGCTTGGG - Intronic
1156335467 18:36167787-36167809 TACTTGGGAGGCCAAGGCTGAGG - Intronic
1157535952 18:48457448-48457470 TTCAGCTGACCCCCAGGCTGTGG + Intergenic
1157681545 18:49611477-49611499 TTTTGGGGACACCCAGGCAATGG - Intergenic
1157717374 18:49897266-49897288 TTCTGGGGTCTCCGAGGGTGTGG - Intronic
1157718898 18:49908266-49908288 TTCTGGAGACACACAGGGTGAGG - Intronic
1157815326 18:50725692-50725714 CTCTGGAGAAACCCAGGCTGAGG + Intronic
1157908049 18:51587131-51587153 TTTTTGGGTCGCCCAGGCTGGGG - Intergenic
1158303918 18:56083711-56083733 TTCTGTGGGCCCCCAGGCTGTGG - Intergenic
1160058376 18:75507619-75507641 TTCTAAGGAGGCCCAGGATGAGG + Intergenic
1161011679 19:1962354-1962376 TTCTGGGCACAGCCATGCTGGGG - Intronic
1161081503 19:2312812-2312834 TTCTGGGGACGGCCGTGGTGGGG - Intronic
1161139516 19:2639385-2639407 TTCTGTGGGCTGCCAGGCTGGGG - Intronic
1161509257 19:4661647-4661669 TTCTGTGGAAGCCCTGGCTGGGG + Intronic
1161578764 19:5069172-5069194 TGCTGGGGTCGCCTTGGCTGGGG + Intronic
1161617837 19:5282023-5282045 TTCTGGGGACGCCCAGGCTGCGG - Intronic
1161759070 19:6157445-6157467 TACTGGGGAGGCTGAGGCTGAGG + Intronic
1161823182 19:6543935-6543957 TTCTGGGGATCCCCATTCTGAGG + Intergenic
1162332416 19:10038475-10038497 TGCTGGGGTCTCCCTGGCTGGGG - Intergenic
1162346274 19:10119753-10119775 GCCTGGGTACGCCGAGGCTGCGG - Intronic
1162818611 19:13210046-13210068 TTCTGGTGAGGCCCAAGCTAGGG + Intronic
1163319998 19:16568987-16569009 TGCTGGGGAAGTCCAGGCAGTGG - Intronic
1163597353 19:18227780-18227802 GTCTGGGGACACCAAGACTGAGG - Intronic
1163640217 19:18457860-18457882 CTGTGGGGATGCCCAGGTTGTGG + Intronic
1163799125 19:19354476-19354498 CTCTGGGGAGGGCCAGGCTGGGG - Intronic
1164169447 19:22712071-22712093 TTGAGGTGTCGCCCAGGCTGGGG + Intergenic
1164186554 19:22874624-22874646 TACTTGGGACGCCAAGGCAGGGG - Intergenic
1164463705 19:28470052-28470074 GGCTGGGGATCCCCAGGCTGGGG - Intergenic
1164603926 19:29582363-29582385 TTCTGGGAGAGCCCAAGCTGAGG + Intergenic
1165903504 19:39179569-39179591 TTCTGGGGAGTGGCAGGCTGGGG - Intronic
1166193775 19:41193450-41193472 CTCTGGGGACGTCCTGGCTAGGG + Intronic
1166709540 19:44927801-44927823 TTCTGGAGCCCCCTAGGCTGGGG - Intergenic
1166731127 19:45059618-45059640 CTCTGGGGATTCCTAGGCTGGGG + Intronic
1167237090 19:48321643-48321665 TCCTGGGGAGGTCGAGGCTGAGG + Intronic
1167715922 19:51142924-51142946 TCCTGGGGAAGCTCAGGCTCTGG - Intronic
1167768821 19:51501163-51501185 TCCTGGGGAAGCTCAGGCTCTGG + Intronic
1168269911 19:55244184-55244206 CTCTGGGCTCACCCAGGCTGGGG - Intronic
1168325300 19:55535966-55535988 GCCTGGGGTAGCCCAGGCTGGGG - Intronic
925927748 2:8682216-8682238 TCCGGGAGATGCCCAGGCTGTGG - Exonic
929400001 2:41568346-41568368 GTCTGGGGAAGCCATGGCTGGGG + Intergenic
931436747 2:62254202-62254224 TTCTGGGAATGCCCAGGGTTTGG + Intergenic
935864356 2:107369306-107369328 TACTGGGGACTACCAGGGTGGGG + Intergenic
937386924 2:121443087-121443109 TACTGGGGCTGCACAGGCTGTGG - Intronic
938069280 2:128300004-128300026 GTCTTGTGAAGCCCAGGCTGGGG + Intronic
938468377 2:131537153-131537175 CTCTGGGGAGGACAAGGCTGTGG - Intergenic
938798701 2:134740204-134740226 CTCTGTGGAAGCCCAGGGTGAGG - Intergenic
944345695 2:198662809-198662831 TTCTGGGCATGCCAAGGCTGTGG + Intergenic
945516179 2:210765801-210765823 TTCTGGGGACGAGGAGGCAGGGG - Intergenic
945820867 2:214663937-214663959 TTCTTGGGAGGCCGAGGCAGCGG + Intergenic
947583716 2:231338332-231338354 TTCTTGGGAGGCTGAGGCTGAGG - Intronic
947878270 2:233482231-233482253 TTGTGGGGAGGCTGAGGCTGGGG + Intronic
948062360 2:235051350-235051372 ATCTGGGGGACCCCAGGCTGGGG - Intronic
948279713 2:236737797-236737819 TGCTGGGCACCCCCAGGCTGGGG + Intergenic
1169203101 20:3724355-3724377 TACTGGGGAGGCTGAGGCTGAGG + Intergenic
1169356260 20:4908816-4908838 TACTTGGGAGGCTCAGGCTGAGG + Intronic
1169489084 20:6056204-6056226 TTCTGGAGTGGCCCTGGCTGAGG + Intergenic
1169556141 20:6752418-6752440 TTCTCGGGAGGCTCAGGCTGGGG - Intergenic
1171382121 20:24742066-24742088 CTCTGGGCAAGTCCAGGCTGGGG - Intergenic
1172012169 20:31851831-31851853 TTCAGGGGGCGCCCAGGCCCTGG + Intronic
1172277319 20:33686626-33686648 AGCAGGGGACGCCCGGGCTGGGG - Intergenic
1173606914 20:44337975-44337997 TACTGGGGAATCTCAGGCTGAGG + Intronic
1175520727 20:59601149-59601171 ATCTGTGGACGCCGAGGATGGGG - Intronic
1176148321 20:63575218-63575240 TCGTGGGGAGGGCCAGGCTGGGG + Intergenic
1176293880 21:5060312-5060334 GTCTGGGGACTCCCGTGCTGCGG + Intergenic
1177649357 21:23940578-23940600 TTCTGGGGATGCTAAGACTGTGG + Intergenic
1178512370 21:33216244-33216266 CTCTTGGGAGGCCCTGGCTGAGG - Intergenic
1178921707 21:36743186-36743208 TCCTGGGGTGGCCCAGCCTGGGG + Intronic
1179863379 21:44203336-44203358 GTCTGGGGACTCCCGTGCTGCGG - Intergenic
1179885289 21:44311666-44311688 TCCTGGGGGAGCCCTGGCTGAGG + Intronic
1180285837 22:10743598-10743620 TACTTGGGACGCTGAGGCTGAGG + Intergenic
1180468525 22:15637122-15637144 CTCTGGGGAGGACAAGGCTGTGG - Intergenic
1181465381 22:23108006-23108028 TTCTGTGGATGCCTAGGGTGTGG - Intronic
1181570664 22:23766368-23766390 CCCTTGGGACACCCAGGCTGGGG - Intronic
1181863785 22:25839786-25839808 AGCTGGGGAAGCCCAGGCTTTGG + Intronic
1182299931 22:29331655-29331677 TGTTGGGGAGGCCCAGGTTGGGG - Intronic
1182501804 22:30753439-30753461 CCCTGGTGACTCCCAGGCTGAGG - Intronic
1182548395 22:31088602-31088624 CACTGGTGAGGCCCAGGCTGGGG + Exonic
1183197429 22:36363085-36363107 TTTTGGGGACTCTCAGTCTGTGG - Intronic
1183479076 22:38052965-38052987 TGCTGGTGGTGCCCAGGCTGAGG - Intergenic
1183564259 22:38601842-38601864 ATCTGGGGAGGAACAGGCTGGGG + Intronic
1183668696 22:39259555-39259577 GTCTGGGGTGGGCCAGGCTGTGG - Intergenic
1183876256 22:40784662-40784684 TACTGGGGAGGCCGAGGCAGGGG + Intronic
1184148851 22:42627180-42627202 TTCTGGGGATGACCGGGATGGGG - Intronic
1184455467 22:44607400-44607422 CTCGGGGGATGCCAAGGCTGAGG + Intergenic
1184865794 22:47201331-47201353 TTGTCGGGACACCCCGGCTGTGG - Intergenic
1185151106 22:49164416-49164438 CCCTGGGGACGTGCAGGCTGAGG + Intergenic
949365087 3:3271988-3272010 TTGTGGGGAAGCGCTGGCTGAGG - Intergenic
949907133 3:8867132-8867154 TTCAGGGGAAGGCCACGCTGGGG - Intronic
950418374 3:12882215-12882237 TTTTGGAGCCGCCCAGGCTGTGG + Intergenic
950424989 3:12920358-12920380 ATCTGGGGAGGGCCTGGCTGGGG + Intronic
952552813 3:34498307-34498329 TACTGGGGAGGCCGAGGCAGGGG - Intergenic
952821936 3:37493402-37493424 TCCTGGGCACCCTCAGGCTGGGG - Intronic
952981922 3:38743017-38743039 TTCTGGGCAGGGCAAGGCTGGGG - Intronic
953025200 3:39141255-39141277 CTCTGGGGAGCCCCAGTCTGGGG - Intergenic
953041193 3:39256202-39256224 TTTTGGCCACTCCCAGGCTGAGG - Intergenic
960782620 3:121336463-121336485 TCTTGCTGACGCCCAGGCTGGGG - Intronic
961740927 3:129032798-129032820 TGCTGGGGAAGCACAGGATGTGG - Intronic
961750178 3:129089870-129089892 TTCTGGGGGCACCCATGCTGAGG + Exonic
963108853 3:141668677-141668699 TACTGGGGAGGCCGAGGCAGGGG - Intergenic
966746516 3:183282208-183282230 TTGTGCTGTCGCCCAGGCTGTGG + Intronic
968478662 4:824642-824664 CTCTGGGGAAGGCCAGGCAGGGG - Intronic
968871783 4:3246140-3246162 CTCTGGGGAAGTCCAGGCTCCGG + Intronic
969087754 4:4669217-4669239 TTCTGGGGTCGGCTAGGCTTAGG + Intergenic
969624949 4:8297658-8297680 TGCAGGGGACTCCCAGGCAGTGG + Intronic
969837031 4:9850506-9850528 CTCTGGGCACAACCAGGCTGGGG - Intronic
971092458 4:23361120-23361142 TTGTGGGGACGACCTGCCTGTGG + Intergenic
971833753 4:31734174-31734196 TACTCGGGAGGCCGAGGCTGAGG - Intergenic
973173556 4:47175299-47175321 ATCTGGGGAGGCCAAGGCAGAGG - Intronic
973889668 4:55356569-55356591 TACTCGGGAGGCTCAGGCTGAGG - Intronic
975783411 4:77863061-77863083 TTCTGGAGACGTCCACCCTGAGG + Intronic
980180288 4:129393050-129393072 TTATCGGGACACCCTGGCTGTGG + Intergenic
985546552 5:512810-512832 TCCTGGCGGAGCCCAGGCTGCGG + Intronic
985748206 5:1659785-1659807 TTCTTGGGGCCCCCAGCCTGTGG - Intergenic
986106746 5:4667073-4667095 TCCTGGGGCCTCCCAGCCTGTGG - Intergenic
987891190 5:23880795-23880817 TACTGGGGAGGCTGAGGCTGGGG - Intergenic
988214468 5:28253146-28253168 TTCTGGGGAGGCTGAGGCAGGGG + Intergenic
992162512 5:74016702-74016724 TTCTGGGGACTCCCTGTGTGAGG - Intergenic
992495972 5:77294304-77294326 TTCTGGGGATCCCAGGGCTGGGG + Intronic
994292334 5:98042757-98042779 TACTGGGGAGGCTGAGGCTGGGG - Intergenic
994432106 5:99679519-99679541 TTCTGGGCTTGCCCAGACTGTGG + Intergenic
995718574 5:115105214-115105236 TTCTGGGAACTCCCAGTCTGTGG + Intergenic
998442888 5:142176926-142176948 TGCTGTTGTCGCCCAGGCTGGGG - Intergenic
999764662 5:154730502-154730524 TGCCGTGGTCGCCCAGGCTGGGG + Intronic
999798367 5:155009248-155009270 TTCTGGGGAGGGCCAGGGTAGGG - Intergenic
1000220484 5:159209394-159209416 TTCTGGGGAGGCGGAGGCAGCGG + Intronic
1002093778 5:176819060-176819082 TTCTGGGGCCGCACAGGTTGGGG + Intronic
1002181039 5:177431311-177431333 GCCTTGGGACCCCCAGGCTGGGG + Intronic
1002484459 5:179524673-179524695 TTCAGGGGACGCAAAGGCTCTGG - Intergenic
1002500119 5:179642815-179642837 TTCAGGGGACGCAAAGGCTCTGG + Intronic
1002774117 6:314297-314319 CTCTGGGCAGCCCCAGGCTGGGG + Intronic
1003883411 6:10498825-10498847 TACTGGGGAGGCCAAGGCAGGGG - Intronic
1005357086 6:24995221-24995243 CTCTGTGCACTCCCAGGCTGAGG - Intronic
1005759757 6:28957791-28957813 TTCTGGGCTGGCCAAGGCTGGGG + Intergenic
1006580920 6:35077508-35077530 CTCTGGGGACGTCCAGGAAGTGG + Intronic
1006825389 6:36930890-36930912 TCCTGGAAACGTCCAGGCTGGGG + Intergenic
1007268112 6:40612401-40612423 CTCTGGGATCTCCCAGGCTGGGG + Intergenic
1007283636 6:40731158-40731180 TTCAGGAGAGCCCCAGGCTGGGG + Intergenic
1007927658 6:45663283-45663305 GCCTGGGGGCGCCGAGGCTGCGG - Intronic
1008010228 6:46459005-46459027 TACTTGGAAGGCCCAGGCTGAGG - Intronic
1008055261 6:46939112-46939134 AACTTGGGAGGCCCAGGCTGGGG - Intronic
1008567250 6:52781509-52781531 TGCTGGGGACACAAAGGCTGTGG - Intergenic
1008777703 6:55061597-55061619 TTGTGTGGAGGCACAGGCTGTGG + Intergenic
1010392918 6:75357353-75357375 TTCTGGGGCCGCCCAGGCAGAGG + Intronic
1011005362 6:82638304-82638326 ATCTGTGGACGCCGAGGATGGGG + Intergenic
1013347789 6:109278876-109278898 TGCTTGTGTCGCCCAGGCTGGGG + Intergenic
1014460307 6:121686826-121686848 TTCTGGGCAGGCCAAGGCCGGGG - Intergenic
1014638563 6:123879956-123879978 CTTGGGGGAAGCCCAGGCTGGGG + Intronic
1015954990 6:138589822-138589844 TGCTGGGGATGCAGAGGCTGGGG - Intronic
1017743394 6:157426602-157426624 CACTGGGGAAGCCCTGGCTGTGG + Intronic
1018430328 6:163716803-163716825 TGCTGGGGCTGCCCAGGCTTTGG + Intergenic
1019595819 7:1857860-1857882 GCCTGGGGACCTCCAGGCTGGGG + Intronic
1019765201 7:2844515-2844537 CTCATTGGACGCCCAGGCTGAGG + Intergenic
1022488181 7:30796291-30796313 TTCTGGGGATGGCATGGCTGTGG - Intronic
1024867934 7:53925395-53925417 TTGTGCTGTCGCCCAGGCTGGGG + Intergenic
1026910278 7:74087619-74087641 TTGTTGTGTCGCCCAGGCTGGGG + Intronic
1029441081 7:100586891-100586913 GTCTCGGGACCCCCGGGCTGGGG + Intronic
1029515730 7:101021882-101021904 TGCTGGGAAGGACCAGGCTGAGG - Intronic
1031011060 7:116525760-116525782 CTCAGGGCACTCCCAGGCTGCGG - Intronic
1032002158 7:128272310-128272332 TTCGGGGGCCGCCGAGGCTGGGG - Intergenic
1032683679 7:134209924-134209946 TTCTGGGGCAGCCCTGGCTCCGG - Intronic
1033643705 7:143285601-143285623 TCCTGGGCACGCCCTGCCTGGGG - Intronic
1034387807 7:150755038-150755060 TTCTGTGGAAGACCAGGGTGGGG + Intergenic
1034960381 7:155360979-155361001 TTCTGGGAACTGCCTGGCTGTGG - Exonic
1035221089 7:157406969-157406991 GCCTGGGGAGGGCCAGGCTGCGG - Intronic
1035293644 7:157855262-157855284 CTCTGCGGACGCCCAGGGAGCGG + Intronic
1035606213 8:931302-931324 GTCTGGGGTCTCCCACGCTGAGG + Intergenic
1037643600 8:20770802-20770824 TTCTGGGGTCTCCCACACTGGGG + Intergenic
1042388650 8:68206782-68206804 TCCTGGGGTCTCCCAGGCTGGGG - Intronic
1043960158 8:86408669-86408691 ATTTTGGGAGGCCCAGGCTGGGG + Intronic
1044862197 8:96534224-96534246 TTCTGGGCTAGCCGAGGCTGGGG - Intronic
1047651785 8:126930997-126931019 TTTTAGAGATGCCCAGGCTGGGG - Intergenic
1047949016 8:129912689-129912711 TTATTAGGATGCCCAGGCTGGGG + Intronic
1048379811 8:133855509-133855531 TTCTGGGTAGGCTCAGGCAGCGG - Intergenic
1052698949 9:31914866-31914888 TACTGGGGAGGCCAAGGCAGGGG - Intergenic
1052907244 9:33846184-33846206 TTCTTGGGAGGCTCAGGCAGGGG + Intronic
1053072131 9:35107783-35107805 ATCTGGGGAGGCCCAGTCTCTGG + Exonic
1053135380 9:35647280-35647302 TCCTGGGGAGGCCCAGGGTGGGG + Intergenic
1056143251 9:83705357-83705379 TACTGGGGAGGCTGAGGCTGAGG - Intronic
1057554693 9:96078388-96078410 TGCTGGGGAAGCCCAGGCCAGGG + Intergenic
1059104837 9:111502059-111502081 TCCTGGGGATGACCAGCCTGTGG + Intergenic
1059335255 9:113565003-113565025 TCCTGAGGGCTCCCAGGCTGGGG - Intronic
1059421021 9:114192509-114192531 TTCTGGGGACCTTCAGCCTGGGG + Intronic
1060551079 9:124485751-124485773 GTCTGGGGCAGCCCAGGCTAGGG - Intronic
1061678139 9:132229732-132229754 TCCTGGGCAAGCCAAGGCTGTGG - Intronic
1061809541 9:133154323-133154345 TGCTGGGGTCAGCCAGGCTGGGG + Intronic
1061883356 9:133578876-133578898 CTCAGGGGAGGCCCAGGCTTGGG - Exonic
1062415229 9:136445596-136445618 TGCTGGGGAGGCCTGGGCTGCGG + Intronic
1062488238 9:136791620-136791642 CTCTGGGCACACCCTGGCTGTGG - Intronic
1062572705 9:137192944-137192966 TTCTGGGGACCCAGAGGCTTTGG - Intronic
1062686400 9:137815647-137815669 GGCTGGAGAAGCCCAGGCTGGGG + Intronic
1203732186 Un_GL000216v2:100654-100676 TACTTGGGACGCTGAGGCTGAGG + Intergenic
1185736763 X:2501243-2501265 TCCTGGGGGCGTCCTGGCTGGGG - Intronic
1185736855 X:2501499-2501521 TCCTGGGGGCGTCCTGGCTGGGG - Intronic
1187908874 X:24092353-24092375 TACTCGGGAGGCCCAGGCAGGGG - Intergenic
1190916391 X:54814331-54814353 TTCTGGGCTTGGCCAGGCTGAGG + Intronic
1198629913 X:138624753-138624775 TCCTGGGGAGGTCAAGGCTGTGG + Intergenic
1198813280 X:140558490-140558512 TACTGGGGAGGCTGAGGCTGAGG + Intergenic
1198965937 X:142228860-142228882 TTAGGAGGAAGCCCAGGCTGCGG - Intergenic
1200118292 X:153778759-153778781 TGCTGGCGGGGCCCAGGCTGGGG + Intronic
1202628752 Y:56886905-56886927 TACTTGGGACGCTGAGGCTGAGG - Intergenic