ID: 1161618374

View in Genome Browser
Species Human (GRCh38)
Location 19:5285278-5285300
Sequence CCATGAGGACATAGGGGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161618374_1161618386 14 Left 1161618374 19:5285278-5285300 CCTCATCCCCTATGTCCTCATGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 1161618386 19:5285315-5285337 TTCTCCAGGTCCTTCATGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 168
1161618374_1161618383 10 Left 1161618374 19:5285278-5285300 CCTCATCCCCTATGTCCTCATGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 1161618383 19:5285311-5285333 TGCCTTCTCCAGGTCCTTCATGG 0: 1
1: 0
2: 4
3: 33
4: 327
1161618374_1161618381 0 Left 1161618374 19:5285278-5285300 CCTCATCCCCTATGTCCTCATGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 1161618381 19:5285301-5285323 GCCTGAGTGATGCCTTCTCCAGG 0: 1
1: 0
2: 2
3: 16
4: 194
1161618374_1161618387 15 Left 1161618374 19:5285278-5285300 CCTCATCCCCTATGTCCTCATGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 1161618387 19:5285316-5285338 TCTCCAGGTCCTTCATGGTGGGG 0: 1
1: 0
2: 2
3: 23
4: 206
1161618374_1161618385 13 Left 1161618374 19:5285278-5285300 CCTCATCCCCTATGTCCTCATGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 1161618385 19:5285314-5285336 CTTCTCCAGGTCCTTCATGGTGG 0: 1
1: 0
2: 3
3: 26
4: 240
1161618374_1161618390 25 Left 1161618374 19:5285278-5285300 CCTCATCCCCTATGTCCTCATGG 0: 1
1: 0
2: 1
3: 15
4: 217
Right 1161618390 19:5285326-5285348 CTTCATGGTGGGGTGAGTCTTGG 0: 1
1: 0
2: 2
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161618374 Original CRISPR CCATGAGGACATAGGGGATG AGG (reversed) Intronic
901385032 1:8902435-8902457 CCATGCGGAGATAGGCGGTGTGG + Intergenic
903021909 1:20400667-20400689 CCATGATGACATCTGGGAAGTGG - Intergenic
904345336 1:29864595-29864617 CCAAGAAGAAATAGGGGAGGAGG - Intergenic
904796226 1:33058374-33058396 CCATGAGGATATGAGGGTTGAGG - Intronic
905845720 1:41229765-41229787 CCATGAGGACATGAGGGCAGGGG - Intronic
907280967 1:53346834-53346856 GCCTGAGGCCCTAGGGGATGGGG + Intergenic
907923131 1:58931557-58931579 ACTTGGGGACACAGGGGATGTGG - Intergenic
910852127 1:91658803-91658825 AAATGAGGACAGAGGGGTTGAGG - Intergenic
911059697 1:93737330-93737352 CGATGAGGACATAGTGGATTCGG + Intronic
912546059 1:110452709-110452731 CCAGCAGGACATGGAGGATGTGG - Intronic
912934139 1:113988051-113988073 CCCTGAGGCCACAGGGGAGGAGG + Intergenic
914509304 1:148317492-148317514 CCCTCAGGACAAAAGGGATGGGG - Intergenic
915037497 1:152941258-152941280 GCATGAGGCCATACAGGATGAGG + Intergenic
915123688 1:153648743-153648765 CCATGAGGAGATGGGGGAAGGGG + Intergenic
915274601 1:154779489-154779511 CCATGGGGAGAGTGGGGATGGGG - Intronic
915524826 1:156469092-156469114 CCAGGAGGACTGTGGGGATGAGG + Intronic
917413830 1:174787558-174787580 TCATGAGGACATTGGGCATGAGG + Intronic
919339827 1:196290899-196290921 AAATGAGGACATGGGGGAGGTGG - Intronic
922943096 1:229485761-229485783 CAAAGAGGACAGAAGGGATGAGG + Intronic
924410976 1:243805296-243805318 AGATGAGAACATAGGTGATGGGG - Intronic
924424259 1:243936198-243936220 CCATGAGCACATAAGGTATGTGG - Intergenic
1062778747 10:180928-180950 GCATGAGAAACTAGGGGATGGGG - Intronic
1062861661 10:815171-815193 GCACAAGGACATAGGGGAAGAGG + Intronic
1066059533 10:31709466-31709488 CCATGTGGAGGTAGGGAATGGGG + Intergenic
1067081766 10:43216316-43216338 CCACCAGGACATCGGGAATGAGG + Intronic
1069849909 10:71397739-71397761 CCATTTGGACAGTGGGGATGGGG + Intronic
1070781678 10:79141119-79141141 CCATGACGACACAGGGGACGAGG + Intronic
1072451577 10:95543193-95543215 CCATGAGGGCATGTGGGTTGGGG - Intronic
1074782425 10:116811621-116811643 CAAAGAGGAGACAGGGGATGGGG - Intergenic
1075744474 10:124717102-124717124 CAAGCAGGACTTAGGGGATGGGG + Intronic
1077729175 11:4710216-4710238 CGATCAGAACATAGGAGATGAGG - Intronic
1077754848 11:5015782-5015804 GGATGAGGACATAGGAGAGGAGG - Intergenic
1079062342 11:17260296-17260318 TCATGATGTCATAGGGGGTGTGG - Intronic
1082631731 11:55550267-55550289 ACATGAGGACATAGAAGTTGAGG - Intergenic
1084693810 11:70742162-70742184 CCATGAGGCCACAGGGGATGTGG - Intronic
1085342373 11:75741468-75741490 CCATGAGGACATGGCCAATGTGG - Intergenic
1089173163 11:116529430-116529452 CAGTGAAGACATTGGGGATGTGG + Intergenic
1089636602 11:119817801-119817823 TCTTAAGGACATAGGAGATGAGG + Intergenic
1090979135 11:131701730-131701752 CCATGGGGTCCTAGGGCATGAGG + Intronic
1090990299 11:131811257-131811279 CTATGAGGACACAAAGGATGAGG - Intronic
1096130586 12:49155874-49155896 CCCTGAGGTCTTGGGGGATGGGG - Intergenic
1097146177 12:56940922-56940944 GCATGAGACCATCGGGGATGGGG - Intergenic
1097151894 12:56985399-56985421 GCATGAGACCATCGGGGATGGGG - Intergenic
1101448817 12:104757551-104757573 CCACGAGGTCATAGTGGATGTGG - Exonic
1102212164 12:111135330-111135352 CCATGAGGATATCGGGGAAAGGG + Intronic
1103037753 12:117670400-117670422 CAATGAGAAGATAAGGGATGTGG + Intronic
1107315163 13:39123176-39123198 CCAGGAGCACATAAGGGAAGAGG + Intergenic
1107914256 13:45133201-45133223 AAATGAGGACATAGCAGATGGGG + Intronic
1108696203 13:52904612-52904634 CCTTGAGGCCACAGGAGATGTGG - Intergenic
1109613723 13:64802178-64802200 CCAGGACGACATAGGGAAGGAGG + Intergenic
1111916317 13:94364458-94364480 CCATGGGGACATATGGCATTGGG - Intronic
1113852734 13:113427153-113427175 CCATGAACACAAAGGGGAGGAGG + Intronic
1115430369 14:33310398-33310420 CTGTGAGGAAAGAGGGGATGGGG + Intronic
1118964510 14:70567402-70567424 CCCTTAGGACAAAGGGAATGTGG + Intergenic
1121981280 14:98456717-98456739 CCCAGAGGACTTAGAGGATGGGG - Intergenic
1122287086 14:100658525-100658547 CCAGGAGGGCAAAGGGGAGGTGG + Intergenic
1123043662 14:105500835-105500857 CTATGGGGACAGAGGGGATGGGG - Intergenic
1125680513 15:41527521-41527543 CCAGGAGGACAAGGAGGATGAGG - Exonic
1127336085 15:57985937-57985959 CCATAAGGACATACTGGATTTGG - Intronic
1128072657 15:64807298-64807320 CCAGCAGGACTCAGGGGATGGGG + Intergenic
1131937359 15:97521529-97521551 CCAGGAGGGCTTAGGGGATAGGG + Intergenic
1132345455 15:101105557-101105579 CCATCAGGTCCAAGGGGATGAGG - Intergenic
1136289100 16:29260836-29260858 CGATGGGGACGTAGAGGATGCGG + Intergenic
1137425758 16:48379221-48379243 GCATTAGGACATGGGGGCTGGGG + Intronic
1137484057 16:48877052-48877074 ACATGAGGAAAAAGGGGCTGGGG + Intergenic
1137884383 16:52086834-52086856 GCATAAGGACATAAGGGAGGTGG + Intergenic
1140590425 16:76345549-76345571 ACTGGAGGACATTGGGGATGCGG + Intronic
1141625216 16:85258051-85258073 CCATGGGGGCACTGGGGATGGGG - Intergenic
1142094829 16:88233763-88233785 CGATGGGGACGTAGAGGATGCGG + Intergenic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1144872240 17:18378397-18378419 GCATGAGGACTGAGGGGGTGGGG + Intronic
1145915309 17:28570605-28570627 CCATCAGGGTATAGGGGAAGAGG - Intronic
1146526710 17:33572920-33572942 CCCTGAGGACAGAGGAGATGAGG - Intronic
1148612204 17:48971944-48971966 CAGAGAGGACACAGGGGATGGGG + Intergenic
1150693934 17:67388092-67388114 ACAGGAGGACATAGAGGATCAGG - Intronic
1151749030 17:76026625-76026647 GCATGAGGACTGAGGGGACGGGG - Intronic
1152590084 17:81207320-81207342 CCGCGAGGACAGAGGGGCTGAGG + Intronic
1153252412 18:3135860-3135882 TGAGGAGGAAATAGGGGATGAGG + Intronic
1154142646 18:11838392-11838414 CCAGGTGGACTTGGGGGATGAGG + Intronic
1156182916 18:34626798-34626820 ACATGTGGACATAGATGATGAGG + Intronic
1156892785 18:42208988-42209010 CCATTAGGTCATAAGGGGTGAGG + Intergenic
1157200241 18:45653579-45653601 CCATGAGGCCATAGGGTCTGGGG - Intronic
1158675992 18:59518706-59518728 GTGTGAGGACAGAGGGGATGTGG - Intronic
1158944856 18:62439158-62439180 CCATGAGGCAGTAGGGGGTGGGG + Intergenic
1159923446 18:74246892-74246914 GGATGGGGAGATAGGGGATGGGG - Intergenic
1161389473 19:4013753-4013775 CCATGAGGACCTGGGGACTGTGG - Intronic
1161618374 19:5285278-5285300 CCATGAGGACATAGGGGATGAGG - Intronic
1162087468 19:8257246-8257268 CCAGGAAGACAGAGGGGGTGGGG - Intronic
1166633104 19:44425297-44425319 CCATGATTACATAGGTGGTGTGG + Intronic
1167243431 19:48359244-48359266 ATATGAGGGCAGAGGGGATGGGG - Intronic
1167801542 19:51746082-51746104 CCATGAAGACATAGAGCATGGGG + Exonic
1167836053 19:52070944-52070966 CCAGGAGGACAAAGGGCAAGAGG + Intronic
925230868 2:2232844-2232866 CCATGAGGACGCAGGGCCTGAGG - Intronic
926001851 2:9339703-9339725 CCATGAAGACATAGGGCCAGAGG - Intronic
926679909 2:15655058-15655080 TCATGAGGACACAGGGGCTCCGG - Intergenic
927149269 2:20186366-20186388 CCCTGAGGCCAGGGGGGATGGGG - Intergenic
927195359 2:20542825-20542847 CCAAGAAGATATAGGGGATCTGG + Intergenic
927851838 2:26504339-26504361 CGATGAGGAGATGGGAGATGTGG + Intronic
928447252 2:31344376-31344398 CCATGAGGAAACAGGGGAACAGG + Intronic
929392569 2:41487940-41487962 CCAGCAGGACAAATGGGATGTGG + Intergenic
929928908 2:46237087-46237109 TCATGAGGACAGAGGGGACCTGG - Intergenic
930989306 2:57631563-57631585 CCATGAGGACAGTGGGGTGGGGG + Intergenic
932469674 2:71945598-71945620 CCATGAGGACAGAGAGCAGGAGG + Intergenic
932907969 2:75774429-75774451 CCATGAGGGTATAGGTGGTGTGG + Intergenic
933561429 2:83890786-83890808 CCAAGGGGACATAGGGTAAGGGG + Intergenic
936047386 2:109197963-109197985 CCAGGAGGTCAGAGGGGTTGAGG + Intronic
937243594 2:120478007-120478029 CCAGCAGGCCACAGGGGATGAGG - Intergenic
938563393 2:132494981-132495003 CCCTGAGGGGATAGGGGAAGTGG + Intronic
941160176 2:162026570-162026592 CCAAGAAGACATCGTGGATGAGG - Intronic
943424469 2:187713522-187713544 ACATGAAGACATATGGGAGGTGG + Intergenic
945000542 2:205345614-205345636 TCATGAGGAGATAGGGAAAGGGG - Intronic
945185180 2:207133137-207133159 AGATGAGGGCATAGGAGATGAGG - Intronic
945558906 2:211313902-211313924 CCATGTGAACAAAGGAGATGAGG - Intergenic
947569522 2:231221385-231221407 ACATGAGGTCATTGGGAATGGGG - Intronic
1169298766 20:4423763-4423785 GCATGAGGACAGATGGGATAGGG + Intergenic
1170818740 20:19738412-19738434 AGATGAGGTCATAGGGGATTGGG + Intergenic
1171227006 20:23450255-23450277 CCATGAAGGCATAGGTGATAAGG + Intergenic
1172627239 20:36354219-36354241 CAATCAGGACATTGGGAATGCGG - Intronic
1173394796 20:42669312-42669334 CCATGAGGATCTAGGGAAGGAGG - Intronic
1173534763 20:43800989-43801011 CCATTAAGATATAGGCGATGGGG + Intergenic
1173825853 20:46047285-46047307 CCATGAGGACTACGGGGATATGG - Intronic
1174231912 20:49052547-49052569 CCAGGAGGAGGTAGGAGATGAGG + Intronic
1174324828 20:49770899-49770921 CCATGAGGACAGAGTGTAAGTGG - Intergenic
1175721566 20:61290611-61290633 GCATGGGCACAAAGGGGATGTGG + Intronic
1176248745 20:64109995-64110017 CCCTGAGGGCAGTGGGGATGGGG + Intergenic
1177318192 21:19488560-19488582 CTATGAGAACATGTGGGATGTGG - Intergenic
1178765081 21:35442886-35442908 CCATGAGGAAAAATAGGATGAGG - Intronic
1181003158 22:19997468-19997490 CCATGAGGAGACATGAGATGGGG + Intronic
1181296734 22:21846231-21846253 CCAAGAGTACATAAGGGATCAGG - Intronic
1181425529 22:22835206-22835228 CCCTGAGGAGAAAGGGGAGGTGG - Intronic
1181429773 22:22872076-22872098 CCCTGAGGAGAAAGGGGAGGTGG - Intronic
1181626610 22:24126390-24126412 CCACGAGGATATTGGGGAAGAGG + Intronic
1182270715 22:29151524-29151546 CCATGAGGAGTCGGGGGATGGGG + Intronic
1182799547 22:33020389-33020411 GCCTCAGGACATAGGAGATGGGG + Intronic
1182994390 22:34799427-34799449 CCATGAGGCCATAGACCATGAGG + Intergenic
1183112260 22:35659014-35659036 CCAAGAGGACAGGGAGGATGAGG + Exonic
950886963 3:16370888-16370910 CCAAGAAGGCACAGGGGATGAGG + Intronic
951416103 3:22423299-22423321 CTATAAGGAGACAGGGGATGAGG + Intergenic
952664712 3:35890326-35890348 CTATGAGGATATAGGGGCAGGGG - Intergenic
953272405 3:41458285-41458307 CCATGAGATCCTAGAGGATGGGG + Intronic
953711075 3:45271730-45271752 CCAAGATGGCATATGGGATGGGG - Intergenic
956431905 3:69195355-69195377 TCTTGAGAACCTAGGGGATGAGG + Exonic
956953156 3:74305726-74305748 CCATGAGGACATCTAGGATGCGG + Intronic
957072143 3:75575687-75575709 CCCTGAGAACAAGGGGGATGTGG + Intergenic
959795389 3:110421830-110421852 CCCTTAGGGCTTAGGGGATGGGG - Intergenic
961511848 3:127408258-127408280 CCATGAGGACAGTGTGGAGGGGG + Intergenic
961748456 3:129081263-129081285 CCACAAGGACAAAGGGAATGAGG + Intergenic
963958022 3:151276830-151276852 GCATGAAGACACAGGGGAAGTGG - Intronic
964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG + Intronic
968502056 4:955431-955453 CCTTGCTGACATAGGGGAGGAGG - Exonic
969172710 4:5376834-5376856 GCATGGGGCCAGAGGGGATGTGG - Intronic
969306869 4:6330869-6330891 CCAGGAGGACACGGGGGCTGGGG - Intronic
969333907 4:6495503-6495525 CCAGGAGGACATAGAGTGTGGGG - Intronic
969462188 4:7334651-7334673 CGCTGAGGACACAGGGGAGGTGG + Intronic
969606589 4:8205146-8205168 CCCTGTGGACAGAGGGGGTGTGG - Exonic
971422778 4:26489281-26489303 CCTTGAGCAGATTGGGGATGAGG + Exonic
971611896 4:28736461-28736483 CCATCTGGACATATGGAATGAGG + Intergenic
973218416 4:47697770-47697792 CCATGAGGAGAAAGGGGAGCTGG + Intronic
982051589 4:151507731-151507753 CCATAAGGAGGTGGGGGATGAGG - Intronic
985306331 4:188545262-188545284 CCTTAAGGAAATAGGGGATTTGG + Intergenic
986287731 5:6372366-6372388 CAATGAGGACAGAGGGGCTGAGG + Exonic
987765387 5:22221696-22221718 TCAATAGGACATGGGGGATGGGG - Intronic
988941721 5:36153804-36153826 GCTTGAGGAACTAGGGGATGGGG - Intronic
989111728 5:37913304-37913326 CCATGGGAACAAAGGGGAAGGGG + Intergenic
990053063 5:51531864-51531886 CCATAATGACCTTGGGGATGTGG + Intergenic
994450052 5:99929956-99929978 CCACAAGGAAAGAGGGGATGGGG - Intergenic
996214588 5:120851377-120851399 CCATGAGGACATGGGGACTCAGG - Intergenic
996251845 5:121344925-121344947 TCATGAGGAAATGGGGTATGGGG - Intergenic
996284687 5:121775213-121775235 ACCTCAGGACAAAGGGGATGGGG - Intergenic
997998592 5:138606305-138606327 CCCTGAGGACAGAGAGGTTGGGG - Intergenic
998669010 5:144332682-144332704 CCATAAGGAGTTAGGGGTTGAGG + Intronic
999198719 5:149801055-149801077 GAATGAAGACCTAGGGGATGAGG + Intronic
1002046421 5:176543897-176543919 CGATGGGGACACAGGGGTTGCGG - Intronic
1003157852 6:3611468-3611490 CCCTGAGGACCTGGTGGATGAGG - Intergenic
1005772360 6:29086585-29086607 CTATGAAGCCATAGGAGATGAGG + Exonic
1007346971 6:41238230-41238252 GCAAGTGGACATAGGGAATGAGG - Exonic
1007913817 6:45541773-45541795 CCAAGAGGACATGGGGCATGGGG + Intronic
1008265301 6:49417958-49417980 CCCTCAGGAGATAGGGGAAGAGG - Intergenic
1010487712 6:76435306-76435328 GCAAGAGGAAAAAGGGGATGTGG - Intergenic
1011543631 6:88460995-88461017 CCATGAGGATAAAGAGAATGTGG + Intergenic
1012389934 6:98727027-98727049 ACATGGGGACACTGGGGATGGGG - Intergenic
1013263128 6:108466605-108466627 ACATGAGGACATAGTGAAGGCGG + Intronic
1013463484 6:110398112-110398134 CCATGAGGAAATAGGGTTAGGGG + Intronic
1013463530 6:110398451-110398473 CCAAGAGCAGAGAGGGGATGAGG - Intronic
1013537280 6:111074911-111074933 CCATGGGGAGAAATGGGATGTGG - Intergenic
1014940629 6:127434274-127434296 CCATAAGGAAATGGGAGATGAGG + Intergenic
1016989574 6:149919986-149920008 CCATGAGGGCAAAGAGGAGGAGG + Intronic
1019232027 6:170574912-170574934 TCTTAAAGACATAGGGGATGAGG + Intergenic
1020148405 7:5662969-5662991 CATTGAGGGCATAGGGGGTGTGG - Intronic
1021608123 7:22429989-22430011 CCTTGAGGGCAGAGGGCATGAGG + Intronic
1022343074 7:29486605-29486627 CCATCAGGACGTAGGGGAAATGG + Intronic
1024570965 7:50722507-50722529 CCAGGAGAACATAGTTGATGGGG + Intronic
1024967390 7:55036099-55036121 GCATGAGGAGAAATGGGATGAGG + Intronic
1031038203 7:116811247-116811269 CTATGGGAACAGAGGGGATGCGG - Intronic
1031139599 7:117927340-117927362 GCATGATGGCATTGGGGATGAGG + Intergenic
1033500458 7:141943848-141943870 GCATGAGAACCTAGGGGATGGGG + Intronic
1034309144 7:150071654-150071676 CCTCGAGGACAGAGGGGAGGTGG + Intergenic
1034396214 7:150826718-150826740 CCATGAGGAAAATGGGGATATGG + Intronic
1034452205 7:151143077-151143099 CCCTGGGGACAGTGGGGATGCGG - Intronic
1034479284 7:151307446-151307468 CCATGAGGACAAAGGGAGTGAGG - Intergenic
1034797711 7:154028982-154029004 CCTCGAGGACAGAGGGGAGGTGG - Intronic
1039035369 8:33353619-33353641 CTGTGAGGACATGGGGAATGTGG + Intergenic
1040012369 8:42672827-42672849 CCATGAGGACATTGTGAAGGCGG - Intergenic
1040547331 8:48408949-48408971 CCATCTGGACACAGGGGCTGTGG - Intergenic
1041362480 8:57067507-57067529 GCATGAGGACATGAGGAATGGGG + Intergenic
1043978266 8:86608244-86608266 CCATGCAGACATAGGAGCTGAGG + Intronic
1044358913 8:91258526-91258548 CCATGAGGACAATGGGCATCAGG - Intronic
1047827716 8:128595617-128595639 CCAGGAGGACCTGGGGGATCTGG - Intergenic
1047958885 8:129996481-129996503 CCAGGAGGACAGAGGGGCCGTGG + Intronic
1047978681 8:130157636-130157658 CCAGGAGGTCATAGGAGATAAGG - Intronic
1048317476 8:133373002-133373024 GCATGTGGACATAGGAGAAGGGG - Intergenic
1048898805 8:139018479-139018501 CCATGGGGACACCGGTGATGTGG + Intergenic
1048899089 8:139020941-139020963 CAATGAGGAAAGAGGGGAAGTGG + Intergenic
1049632396 8:143665697-143665719 GGATGAGGACAAGGGGGATGGGG + Intergenic
1052771894 9:32697668-32697690 CAATGAGGTCCTTGGGGATGTGG - Intergenic
1053475849 9:38381695-38381717 CCGTGAGGACAGAGTGGAGGTGG - Intergenic
1054751820 9:68915204-68915226 GGATAAGGACATGGGGGATGAGG - Intronic
1057516386 9:95725394-95725416 CCTTCAGGACATAGTGGCTGTGG + Intergenic
1059361187 9:113743117-113743139 TCATGTGGACACATGGGATGGGG - Intergenic
1060822336 9:126668824-126668846 CCAGGAGGGCCTGGGGGATGTGG - Intronic
1061255606 9:129453221-129453243 GGATGAGGAGATGGGGGATGGGG + Intergenic
1061997358 9:134193309-134193331 CCATCAGCACAAAGGGGCTGGGG + Intergenic
1188820421 X:34768084-34768106 CCATCAGGGCAGAGGGAATGAGG + Intergenic
1189165493 X:38856856-38856878 CAAAGAGGAGAAAGGGGATGAGG - Intergenic
1190644041 X:52508270-52508292 CCCTGAGGACATACGGAATTAGG - Intergenic
1190692035 X:52920264-52920286 CCCTGAAGACATAGGGGTTCTGG + Intergenic
1191884182 X:65872746-65872768 CCACAGGGACATAGGGGATAGGG - Intergenic
1192430666 X:71109390-71109412 CCTTGAGGAGAAAGAGGATGAGG + Exonic
1193407844 X:81124237-81124259 ACATGAGGAAATGGGGGATTGGG - Intronic
1195681466 X:107550075-107550097 CCTTCAGGACATTAGGGATGAGG - Exonic
1196109786 X:111933542-111933564 CCATGAAGAAAGAGGGGCTGTGG + Intronic
1199787054 X:151115145-151115167 TCAAGAGGACACAGGGTATGGGG + Intergenic
1199795141 X:151188074-151188096 CCATGGGGAAGAAGGGGATGGGG - Intergenic
1202190298 Y:22235598-22235620 CCAAGATGGCATAGGTGATGAGG + Intergenic