ID: 1161619195

View in Genome Browser
Species Human (GRCh38)
Location 19:5289533-5289555
Sequence CAGGTCGTGCAGGACCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 2, 2: 2, 3: 38, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161619195 Original CRISPR CAGGTCGTGCAGGACCTGGT GGG (reversed) Intronic
900121592 1:1050652-1050674 CAGGTCGCTCAGGCCCTGGGTGG + Intronic
900476582 1:2879077-2879099 TGGGTCCTGCTGGACCTGGTGGG + Intergenic
901309372 1:8257418-8257440 TAGGTCCTGCAGGCCCTTGTAGG + Intergenic
901514179 1:9734102-9734124 CAGGTCGTGCACGATCTCCTCGG + Exonic
902045243 1:13519116-13519138 CAGGCCATGCAGGATCTGGTGGG - Intergenic
902825205 1:18968497-18968519 CACGTGTTGCAGGACCTGGTGGG + Intergenic
903443009 1:23402380-23402402 CAGGACGTGCAGGGGCTGGGAGG - Intronic
904945782 1:34197786-34197808 CAGGACGTGCAGGAGGAGGTCGG - Exonic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905926568 1:41754191-41754213 AGGGTCGTGCAGGACCTTGCAGG + Intronic
906479543 1:46191104-46191126 CAGGCCCTGCAGGAGGTGGTGGG + Intronic
908647065 1:66289610-66289632 CAGGTCTCGCAGGATCTTGTAGG + Intronic
912414388 1:109498229-109498251 CAGGTGGTGCGGGGGCTGGTGGG + Intronic
912506591 1:110161002-110161024 CAGGACTTGCAACACCTGGTGGG + Intronic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
1066058440 10:31702094-31702116 CTGGTTGTGAGGGACCTGGTGGG + Intergenic
1067307002 10:45073246-45073268 CAGGTCCTGCAAGCCCTGGAGGG - Intergenic
1067307007 10:45073251-45073273 CAGGGCTTGCAGGACCTGGCGGG + Intergenic
1069859149 10:71459685-71459707 CAGGTGGTGCAAGCGCTGGTGGG + Intronic
1070369825 10:75771603-75771625 CAGGTTGGTCAGGGCCTGGTGGG + Intronic
1070590961 10:77800635-77800657 CAGGGCTGCCAGGACCTGGTGGG + Intronic
1072159758 10:92755058-92755080 CAGAAAGTGCAGGGCCTGGTAGG - Intergenic
1073147357 10:101289606-101289628 CAGGTGGTGCAGGCCCTTGAGGG - Intergenic
1073510125 10:104037705-104037727 CAGGTCCTGGGGGACCAGGTGGG + Exonic
1077235479 11:1480161-1480183 CAGAAGGTGCAGGAGCTGGTGGG - Intronic
1077416254 11:2425670-2425692 CAGGTGTGGCAGGGCCTGGTGGG - Intergenic
1077506440 11:2931882-2931904 CAGGTGGGGCAGGAGCTGGGAGG + Intergenic
1078768046 11:14318622-14318644 CAGGTAGTGCTGCACCTGGCTGG - Intronic
1080401095 11:31936166-31936188 CAGGAGATGCAGGGCCTGGTAGG + Intronic
1080974832 11:37326441-37326463 CAGGTCATGCCAGTCCTGGTAGG - Intergenic
1081805865 11:45890181-45890203 CAGGATGTGCAGGAACTTGTAGG + Intronic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1083229636 11:61308142-61308164 CAGAACGTGCAGAGCCTGGTAGG - Intronic
1083855192 11:65389773-65389795 CAGGTCGTGCTGGGACTGGGTGG + Intronic
1084344878 11:68540094-68540116 CAGGCCATGCAAGGCCTGGTAGG + Intronic
1084378378 11:68794257-68794279 CAGGGGGTCCAGGACCAGGTGGG + Intronic
1084958234 11:72702854-72702876 CAGGCTGTGCAGTGCCTGGTGGG - Intronic
1086930817 11:92691046-92691068 CCGGCAGTGCAGGACCTGGGTGG - Intronic
1089353257 11:117833416-117833438 CATGTCCTGAAGGACCTGGATGG - Intronic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1095282177 12:40366092-40366114 CAGCTCATGCAGCACCTTGTAGG - Intronic
1095943681 12:47741500-47741522 CAGGAAGTGCATGAGCTGGTAGG - Exonic
1096387429 12:51204134-51204156 CAGGTGGAGCAGTACCAGGTGGG + Intronic
1096551044 12:52371828-52371850 CAGGCAGTGCAGGGCCTTGTTGG - Intergenic
1096966905 12:55635752-55635774 GAGATCCTGCAGGACGTGGTGGG - Intergenic
1097414380 12:59296217-59296239 CAGGTGGTGCAGGGCCTTGTAGG + Intergenic
1097896526 12:64829104-64829126 CAGATCGTGGAGAACCTGGTGGG + Intronic
1098252521 12:68584961-68584983 CAGGTAATGCAGGAACTGGCAGG + Intergenic
1101625848 12:106440448-106440470 CAGATTGTGCAGGAACTGGAAGG - Intronic
1102552264 12:113700063-113700085 CATGTCATGAGGGACCTGGTGGG + Intergenic
1103813545 12:123634818-123634840 CAGGTCATGCAGGGCCTTATTGG + Intronic
1104732223 12:131113801-131113823 CAGGTCATGCGTGACCTGGAGGG - Intronic
1107821029 13:44285843-44285865 CAGTTCATGCAGGACCTGAGGGG - Intergenic
1110064765 13:71089386-71089408 CAGATCATGTAGAACCTGGTGGG + Intergenic
1113841295 13:113363193-113363215 CAGGTCGAGCAGGGCCCTGTGGG + Intronic
1115559306 14:34568806-34568828 CAGGGCTTGGAGGACCCGGTGGG + Intronic
1117611160 14:57484728-57484750 CAGGTCATGCAGGGCCTGACAGG + Intronic
1121778322 14:96605696-96605718 AAGGCCGTGCAGGACGTGCTTGG - Intergenic
1122634103 14:103122321-103122343 CAGGTCTTCCAGGACCAGGGGGG - Intergenic
1122806453 14:104262514-104262536 CAGGCCCTGGGGGACCTGGTGGG + Intergenic
1125306356 15:38320392-38320414 CAGCTCATGCAGGGCCTAGTAGG + Intronic
1125530083 15:40407334-40407356 CAGCTCCTGCAGGGCCTAGTAGG + Intronic
1128082695 15:64865776-64865798 CATTTCCTGCAGGACCTGGGTGG - Exonic
1128546828 15:68574020-68574042 CAGGTCTTGGAGGACCCTGTTGG + Intergenic
1129196401 15:73969786-73969808 CAGCTCATGTAGGGCCTGGTAGG - Intergenic
1129449113 15:75640076-75640098 CAGCTCGTGCAGGTTGTGGTCGG + Exonic
1130216804 15:81979377-81979399 CGTGTTGTGGAGGACCTGGTGGG + Intergenic
1130898942 15:88192627-88192649 CAGCTTGTGCAGGACCTTGAGGG - Intronic
1132692872 16:1189358-1189380 CAGGCTGTGCTGGACCTGGCAGG + Intronic
1133915601 16:10106797-10106819 CAGGTAGAGCAGGACATGGAGGG + Intronic
1134306582 16:13038382-13038404 TAGATTGTGCAGGACCTTGTGGG - Intronic
1134511879 16:14855035-14855057 CAGATTGTGCAGGGCTTGGTGGG + Intronic
1134699522 16:16253534-16253556 CAGATTGTGCAGGGCTTGGTGGG + Intronic
1134819910 16:17238627-17238649 CTGGTCATGCAGGACCTTGTAGG - Intronic
1134825741 16:17282684-17282706 CAGGTCTTGCAGCCCCTGGGAGG - Intronic
1134972307 16:18541137-18541159 CAGATTGTGCAGGGCTTGGTGGG - Intronic
1135387654 16:22058019-22058041 CAGGTAATACAGGACCTGGTAGG + Intronic
1136056730 16:27695311-27695333 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1136596421 16:31253254-31253276 CAGGTCATGCAGGTCCTTGTAGG + Intergenic
1137498961 16:48995947-48995969 CAGGTGGTGCAGCACCTGTCTGG + Intergenic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138646024 16:58425504-58425526 CATGTCATGGAGGGCCTGGTGGG + Intergenic
1139914296 16:70418714-70418736 CTGGTTGTGGAGGACCAGGTTGG + Intronic
1141428833 16:83960561-83960583 CAGGTAGTCCAGGTCCTGGAGGG - Exonic
1142589678 17:997221-997243 CTGCTCCTGCAGTACCTGGTGGG + Exonic
1143046905 17:4088673-4088695 CAGCTCGCCCATGACCTGGTAGG - Exonic
1143713035 17:8746594-8746616 CAGGTGGTCCAGGGCCAGGTTGG + Intergenic
1143785033 17:9249553-9249575 CAGGTGGGGCAGGAGGTGGTCGG - Intergenic
1144825933 17:18105755-18105777 CAGGTCTTCCAGGCCCTGGTGGG - Intronic
1145273060 17:21414827-21414849 CAGGTCCTGCATGTCCTGGGGGG + Intronic
1145883755 17:28369174-28369196 AGGGCCCTGCAGGACCTGGTGGG - Intronic
1146373797 17:32281189-32281211 CAGGGCAGGCAGGCCCTGGTGGG + Intronic
1146912152 17:36655692-36655714 AAGGTGGTGGAGGGCCTGGTGGG + Intergenic
1146962900 17:36999962-36999984 CAGGTCCTGTGGGACCTTGTAGG + Intronic
1148746595 17:49921757-49921779 CAGGTGGCACAGGACCTCGTAGG + Intergenic
1150209877 17:63436088-63436110 CAGCCCGTGCAGGACCTTGGTGG + Exonic
1151620482 17:75241979-75242001 CATGTGGTGCAGGCCATGGTTGG - Intronic
1151620864 17:75244047-75244069 CATGTGGTGCAGGCCATGGTTGG + Intronic
1151947809 17:77329098-77329120 CAGGTCGTGCCGGGCCTTGGAGG + Intronic
1152739904 17:82014308-82014330 CAGGTGGGGTAGGGCCTGGTGGG - Intronic
1153018161 18:602945-602967 AAGGTCTTGCAGGACCTTGTAGG + Intronic
1153321088 18:3774918-3774940 CAGGGAGTGCAGGAGGTGGTGGG - Intronic
1158543437 18:58376787-58376809 CAGGCCACGCAGGACCTTGTGGG - Intronic
1160165075 18:76503957-76503979 CAGCGTGTGCAGGACCTGGACGG + Intergenic
1160676335 19:393339-393361 CAGGTCATTCAGGGCCTGGTGGG + Intergenic
1160770750 19:829672-829694 CAGGTCGTTCAGGTTCTGCTGGG - Exonic
1160940496 19:1618473-1618495 CAGGTCATGCGGGGCCTTGTGGG - Intronic
1161112929 19:2479640-2479662 CAGGTGGGGAAGGACCAGGTGGG + Intergenic
1161238829 19:3210753-3210775 CAGGTTGTGCAGGGCCTGGTGGG + Intergenic
1161262468 19:3345465-3345487 CAGGTTGTGCAGGGCCTCGTAGG - Intergenic
1161273109 19:3401173-3401195 CAGTTTGTGCAAGGCCTGGTGGG + Intronic
1161277459 19:3426640-3426662 CAGGTTGTGCAGGGCCTTGTGGG - Intronic
1161286468 19:3471056-3471078 CAGGTCATTCAGGGCCTTGTGGG + Intergenic
1161300028 19:3538044-3538066 CAGGGCGTGCAGGGCCTTGTGGG + Intronic
1161301596 19:3545370-3545392 CAGGTCGTGCAGGGCCTGGTGGG - Intronic
1161331974 19:3692791-3692813 CAGGGTGTGCAGGGCCTTGTGGG - Intronic
1161332906 19:3696768-3696790 CAGGCTGTGCAGGGCCTGATGGG + Intronic
1161422001 19:4181113-4181135 GAGGTAGTGCAGGGCCTGGTGGG - Intronic
1161490374 19:4557913-4557935 CAGGTCGTGCAGGGCCTGTTGGG - Intronic
1161492126 19:4567837-4567859 CAGGTTGTACAGGGCCTTGTGGG - Intergenic
1161515454 19:4693779-4693801 CAGATGGTGCAGGGCCTGCTGGG - Intronic
1161534724 19:4811963-4811985 CAGGTTAAGCAGGGCCTGGTGGG - Intergenic
1161541026 19:4851676-4851698 GAGGTTGTGCAGGACCTTGTGGG + Intronic
1161596663 19:5154208-5154230 CAGGGTGTGCAGGCCCTTGTGGG + Intergenic
1161619195 19:5289533-5289555 CAGGTCGTGCAGGACCTGGTGGG - Intronic
1161621412 19:5299225-5299247 CAGGTCATGCAGGGCCTTGTGGG - Intronic
1161623189 19:5310006-5310028 CAGGTTGTGCAGGCCCTTGTGGG - Intronic
1161625418 19:5323697-5323719 CAGGTTGTGCAAGGCCTGGTGGG + Intronic
1161634238 19:5377234-5377256 CAGGTCATGCAGGGCCTTGTGGG + Intergenic
1161644489 19:5444680-5444702 TAGGTCATGCAGGGCCTTGTGGG - Intergenic
1161650382 19:5480608-5480630 CAGGTCGTGCAGGGCCTGGTAGG + Intergenic
1161741104 19:6021713-6021735 CGGGTCCTGCAGGGCCTTGTGGG + Intronic
1162148624 19:8629428-8629450 CAGGTCATGAAGGGCCTTGTGGG + Intergenic
1162156400 19:8680986-8681008 CAGGTTGTGGAGGACTTTGTGGG + Intergenic
1162449835 19:10748079-10748101 CAGGTCGTGCAGGGCTTGGGGGG + Intronic
1162456542 19:10788421-10788443 CAGGTTGTGCAGGGCCTTGTGGG + Intronic
1162512990 19:11131046-11131068 CAGGTTGTGCAGAGCCTTGTGGG + Intronic
1162518852 19:11167022-11167044 GTGGTTGTGCAGGGCCTGGTGGG + Intronic
1162579847 19:11522431-11522453 CTGATGGCGCAGGACCTGGTGGG - Intronic
1162823299 19:13236355-13236377 CAGGGCGGGCAGGAGCGGGTGGG - Intronic
1162935229 19:13978661-13978683 CAGGGCTTGCGGGGCCTGGTGGG + Intronic
1163036465 19:14571971-14571993 CAGGTAGCGCCGGACCAGGTGGG + Exonic
1165407376 19:35639072-35639094 CAGGTTGGGCAGGACTTTGTGGG + Intergenic
1166119136 19:40674509-40674531 CAGCTCGGGGAGGCCCTGGTAGG - Intronic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
1166909444 19:46141509-46141531 CAGGTAGTGAAGGGCCTTGTGGG - Intergenic
1167661413 19:50798064-50798086 CAGGAAGTGCGGGACATGGTAGG - Exonic
1168245791 19:55112630-55112652 AGGGCCGGGCAGGACCTGGTCGG - Intronic
1168486249 19:56764834-56764856 CCGATCGTGGAGGACCTGGAGGG - Intergenic
925455561 2:4013758-4013780 CAGGTCGTGTAGGACTCTGTAGG + Intergenic
925955407 2:8959100-8959122 CAGGGCCTGGAGGATCTGGTGGG + Intronic
926363612 2:12113175-12113197 CAGATCGTGCTGGGCCTTGTGGG + Intergenic
926636982 2:15191443-15191465 CAGGTTTTGAAGGATCTGGTGGG - Intronic
929788042 2:45006059-45006081 CGGGTCTTTCAGTACCTGGTGGG + Exonic
930686545 2:54314070-54314092 CAGATTGTGCATGGCCTGGTAGG - Intergenic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
935062769 2:99622713-99622735 CAGGTCATTCAGAACCTGCTGGG - Intronic
935799439 2:106678885-106678907 CAAATCGTGAAGGACCTGGAGGG - Intergenic
936271859 2:111055144-111055166 CTGGTCCTGCAGGACCAGGCAGG + Intronic
937095249 2:119231089-119231111 CAGGTGGTGAGGGAGCTGGTGGG - Intronic
937940791 2:127284321-127284343 CAGGTCTTGTAGGACCTTGTAGG - Intronic
941351504 2:164442835-164442857 AAGCTCTTGCAGGACCTTGTAGG + Intergenic
942299237 2:174546591-174546613 CAATTTGTGCAGGACCTGGAGGG - Intergenic
942664689 2:178304744-178304766 CAGTCCCTGCAGGACCTTGTAGG - Intronic
942901503 2:181125488-181125510 CAGGTGATGCAGTGCCTGGTAGG - Intergenic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
947671648 2:231940761-231940783 CGGGTCATGCAGGACCAGGATGG - Intergenic
947784755 2:232806955-232806977 CAGGCATTGCAGGACCTCGTAGG - Intronic
948604720 2:239127672-239127694 CAGCTCTTGGAGGCCCTGGTGGG + Intronic
948622355 2:239244382-239244404 CAGGAGGTGCAGGTCTTGGTGGG - Intronic
1169783468 20:9333544-9333566 CAGATCGTTCAGGACCTTTTCGG + Intronic
1170293289 20:14795135-14795157 CAGACCGTGAAGGACCTTGTAGG + Intronic
1172150355 20:32786253-32786275 CAGGCAGAGCAGGACCTGCTGGG + Intronic
1172173969 20:32961251-32961273 CAGGTCCTTCTGGACATGGTGGG - Intergenic
1172807105 20:37619913-37619935 CAGAACATGCAGGACCTCGTAGG + Intergenic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1174115299 20:48222837-48222859 CAGATCCTGCAGGCCCTTGTGGG + Intergenic
1174562158 20:51439137-51439159 CAGGTTGTGCAGGGCCTTGAGGG - Intronic
1175024665 20:55889156-55889178 CAGATTGTGCAGGGCCTTGTGGG + Intergenic
1175268962 20:57720383-57720405 CAGGGCATTCAGGAGCTGGTGGG - Intergenic
1175722504 20:61295781-61295803 CAGGCCGGGCAGCAGCTGGTGGG - Intronic
1175733465 20:61370010-61370032 CTGGTGTTCCAGGACCTGGTGGG + Intronic
1177866569 21:26519538-26519560 CAGGTCGTGGAGTAACTTGTAGG + Intronic
1178767884 21:35471494-35471516 CATGTGGAGCAGGACCTGGAAGG + Intronic
1180982563 22:19885678-19885700 CAGGAAGTGCTGGGCCTGGTGGG - Intronic
1181319265 22:21991929-21991951 GGGTTCGTGGAGGACCTGGTAGG - Intergenic
1181458778 22:23074098-23074120 CAGGTCCTGCAGGACTCAGTGGG + Intronic
1181855389 22:25777727-25777749 CAGGTCCTGGAACACCTGGTGGG + Exonic
952495621 3:33913564-33913586 CAGATCCTCCAGGGCCTGGTGGG - Intergenic
953611269 3:44449475-44449497 CAGGAGGAGCAGGACCTGGCAGG + Intronic
953670314 3:44956887-44956909 CAGATTGTGCAGGGCCTGGTAGG - Intronic
954659356 3:52218721-52218743 CAGGTCCTGCAGGAAGTGGTTGG - Intergenic
955833831 3:63031931-63031953 CAGATGCTGAAGGACCTGGTAGG + Intergenic
956202999 3:66727256-66727278 GAAGTCATGCAGGACGTGGTAGG - Intergenic
956741864 3:72281652-72281674 CAGATGGGGCAGGACCTGGTGGG - Intergenic
957814905 3:85284759-85284781 CAGGTTTTGTAGGACCTTGTAGG + Intronic
957849449 3:85787799-85787821 CAGATCATGCAGGACTTGTTAGG - Intronic
964682576 3:159358523-159358545 CAGGTGCTGCAGGGGCTGGTGGG + Intronic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
966261619 3:177985153-177985175 CAGGTCATGCAGGGTGTGGTTGG + Intergenic
967811385 3:193763999-193764021 CAAGTCATGTAGGACCTGGTGGG - Intergenic
967866413 3:194193680-194193702 CAGGTCATGAAGGACCTAGACGG + Intergenic
968594404 4:1474781-1474803 GAGGTGGTGCAGGAGCTGTTGGG + Intergenic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
978905825 4:114004525-114004547 CAGATCTTGCAGGACCTAATAGG - Intergenic
985336891 4:188905564-188905586 CAGCTCCTGCAGGACCCAGTTGG - Intergenic
985493445 5:192131-192153 CAGCACGTGCAGGAGCTGGCTGG - Exonic
992208779 5:74456839-74456861 CATGTCGGGGGGGACCTGGTGGG - Intergenic
996550671 5:124726758-124726780 CAGGTCATGCAGGGCCTTGTAGG - Intronic
997705037 5:135942506-135942528 CAGACCTTGCAGGACCTTGTGGG - Intronic
997745695 5:136298396-136298418 CAGGTCATGCAGCACTTTGTAGG + Intronic
997958890 5:138303413-138303435 CAGATCGTGTAGGGCCTTGTAGG - Intronic
999407173 5:151316871-151316893 CAGCTCGTCCAGGGCCTGGTAGG + Exonic
1003494020 6:6648338-6648360 CAGGACCTGCAGGAAATGGTAGG - Intronic
1006302922 6:33203635-33203657 CAGGTGGTGCAGGTCCTGGCTGG + Exonic
1006377080 6:33677586-33677608 CAGGTCCAGCATGACCTTGTGGG - Exonic
1006630599 6:35427376-35427398 GGGGTCCTGCAGGTCCTGGTGGG + Exonic
1009537513 6:64908216-64908238 CAGCAAGTGCAGGACCTGGCTGG + Intronic
1011801365 6:91019740-91019762 CAGGTCCTGCAGGACTTTGTGGG - Intergenic
1013548437 6:111183121-111183143 CAGATTGTGAAGGACCTTGTAGG - Intronic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1016990152 6:149922929-149922951 CAGCTGGTGCAGGACCGGGCTGG - Exonic
1018955545 6:168407940-168407962 CAGGGCGTGCAGGGCCTCGAAGG - Intergenic
1019705107 7:2493871-2493893 CAGGTCGTGCAGGCCAGCGTGGG - Intergenic
1019856741 7:3616367-3616389 CAGGTTGTGCAGGGCCTTGCAGG - Intronic
1021248518 7:18294623-18294645 CAGATCGTGCTGGGCCTAGTAGG + Intronic
1021874190 7:25033098-25033120 CAGGTCATGCAGGGCCTGATGGG + Intergenic
1025256791 7:57389247-57389269 GAGGTCGTGCAGACCCTGGGTGG - Intergenic
1026375526 7:69746721-69746743 CAGGTCATATAGGACCTTGTAGG + Intronic
1026902562 7:74045166-74045188 CAGGCCTTGCAGGCCCTGCTGGG - Intronic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1033108225 7:138550347-138550369 AAAGTCTTACAGGACCTGGTGGG + Intronic
1034322868 7:150201227-150201249 CAGGTGGGGCAGCACCTGGGTGG - Intergenic
1034770317 7:153767896-153767918 CAGGTGGGGCAGCACCTGGGTGG + Intergenic
1036181589 8:6590431-6590453 CAGGCCCTGCAGGCCCTGGGTGG + Intronic
1036598534 8:10238051-10238073 CAGATAGTGTAGGACCTTGTGGG - Intronic
1037408083 8:18565137-18565159 CAGGTCGTTCAGGTCCAGGCTGG - Intronic
1037462960 8:19131548-19131570 CAGGTCAGGCAGGGCCTTGTTGG + Intergenic
1038163845 8:25065767-25065789 CAGGCCTTGCACAACCTGGTAGG + Intergenic
1041364044 8:57082948-57082970 CTGCTCCTGCAGGACCTGGGAGG + Intergenic
1045100085 8:98835478-98835500 CATGTGTTGCAGGACCTGGCTGG - Intronic
1045663092 8:104458270-104458292 CAGGTCATGCAGGACCTTATGGG - Intronic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1047512727 8:125528076-125528098 CAGGTCATGCTGGACATGGCAGG - Intergenic
1049247177 8:141569097-141569119 CATGTCGTCTAGGTCCTGGTTGG + Intergenic
1049620146 8:143594481-143594503 CAGGCCGTGCAGCACCTTGGTGG - Intronic
1051027949 9:12636621-12636643 CAGGACATGCAAGATCTGGTAGG - Intergenic
1054870177 9:70042215-70042237 CAGGTCCTATAGGGCCTGGTTGG + Intergenic
1055392530 9:75838390-75838412 CAGATCATGGAGAACCTGGTGGG - Intergenic
1056289274 9:85126387-85126409 CAGGTCATGCAGGATCTTCTGGG + Intergenic
1057119637 9:92559475-92559497 CTGCTCCTGCAGGACCTGGGAGG - Intronic
1057152598 9:92808535-92808557 CTGGAGGTGCATGACCTGGTCGG - Intergenic
1059604029 9:115813461-115813483 CAGGTCATGAAGGACCATGTGGG - Intergenic
1059866794 9:118523285-118523307 CAGGTCAAGTAGGACCTGGTAGG - Intergenic
1060059816 9:120449075-120449097 TAGGTCCTGCAGGACTTTGTAGG - Intronic
1060134155 9:121135632-121135654 CAGGTTGTGCATATCCTGGTTGG - Intronic
1061375793 9:130223691-130223713 CAGGTACTGCAGGTCCTGTTGGG + Intronic
1186722695 X:12322577-12322599 CAGGTCATTCAGGGCCTTGTAGG + Intronic
1187202257 X:17146181-17146203 CAGATCGTACAGGGCCTTGTGGG - Intronic
1187248494 X:17575270-17575292 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1187366025 X:18666506-18666528 CAGTTCCTGCAGGGCCTCGTGGG + Intronic
1187392310 X:18894199-18894221 CTGTTCTTGCAGGACCAGGTGGG - Exonic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1192069200 X:67918766-67918788 CTGTTCCTGCAGGACCTGGGAGG - Intergenic
1192555211 X:72083863-72083885 CAGATCGTGCAGGGCCTTCTAGG - Intergenic
1197495528 X:127174359-127174381 CAGCCAGTGCAGGATCTGGTGGG + Intergenic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1199319321 X:146419809-146419831 CAGCTCATTCAGGGCCTGGTAGG + Intergenic
1199808763 X:151328409-151328431 CAGGTGGTGCAGGTCTTGGAAGG - Intergenic