ID: 1161620310

View in Genome Browser
Species Human (GRCh38)
Location 19:5293775-5293797
Sequence TCCCCTGGACCCCCAGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161620310_1161620326 30 Left 1161620310 19:5293775-5293797 CCTCCCGCTGGGGGTCCAGGGGA 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1161620326 19:5293828-5293850 CCACCCTCGCCACAAGCCTGAGG 0: 1
1: 0
2: 2
3: 30
4: 206
1161620310_1161620319 -2 Left 1161620310 19:5293775-5293797 CCTCCCGCTGGGGGTCCAGGGGA 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1161620319 19:5293796-5293818 GAATGAATGGGGGGACACCGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1161620310_1161620320 4 Left 1161620310 19:5293775-5293797 CCTCCCGCTGGGGGTCCAGGGGA 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1161620320 19:5293802-5293824 ATGGGGGGACACCGTGGCAGAGG 0: 1
1: 0
2: 3
3: 8
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161620310 Original CRISPR TCCCCTGGACCCCCAGCGGG AGG (reversed) Intronic
900581822 1:3413263-3413285 GCCCCTGGAGCCACAGCGGCAGG + Intronic
900585564 1:3430801-3430823 TCCCATGGACCCCCAAAGGCTGG - Intronic
901098461 1:6701529-6701551 GCCCCGGAACCCCCGGCGGGAGG + Intronic
901771373 1:11531968-11531990 TACCGTGGACCCCCAGTTGGTGG - Intronic
902777348 1:18683137-18683159 TCCCCTGCACCCCCAGAGTAGGG + Intronic
903034319 1:20484845-20484867 TCCCAGGGACCCCCAGGGGACGG - Intronic
903724555 1:25431076-25431098 GCACCCGGCCCCCCAGCGGGAGG + Exonic
905012875 1:34759098-34759120 TCCCCAGGACCCACAGAGGATGG + Intronic
905371215 1:37483545-37483567 GCTCCTGGACCCCCAGCAGCTGG + Exonic
907091560 1:51729940-51729962 TCCCCTGGAGGCACAGAGGGCGG + Intronic
907438135 1:54462495-54462517 TCCCCTGCCCCCCCAGCTTGTGG + Intergenic
912505061 1:110150652-110150674 TCCCCTGAGCCCCGAGCGCGCGG + Exonic
913163916 1:116168273-116168295 TCCCCAGGTGCCCCAGCGAGGGG - Intergenic
915489442 1:156243054-156243076 TCCCCTGGAGCCCAGGAGGGAGG + Exonic
917172263 1:172190160-172190182 TTCCCTGCACCCCCACCGGCAGG + Intronic
917531831 1:175842718-175842740 TCCCCTGGACCTCCAGCAAGGGG + Intergenic
918480726 1:184974273-184974295 TCCCCAGGCCCCCGGGCGGGCGG + Intronic
920180974 1:204131512-204131534 TCTCCTGTCCCCCCAGCAGGGGG + Exonic
922937256 1:229432238-229432260 GCCCCTGCACCCCGGGCGGGAGG - Intronic
1063106931 10:3000158-3000180 TCCCCTGGTCCCACATCAGGAGG - Intergenic
1066429125 10:35336192-35336214 TCCCCGGGGCCCGCAGCGGGCGG - Intronic
1067070007 10:43124362-43124384 CTCCCTGGGCCCCCAGCTGGTGG + Intronic
1070147533 10:73785804-73785826 TCCCCTCAACCCCCGGCCGGCGG + Exonic
1070248630 10:74754152-74754174 TCCCCTGGCCTCCCAGCCTGGGG - Intergenic
1070734166 10:78852135-78852157 TGCCCTGGACCAACAGCAGGAGG + Intergenic
1072885839 10:99272910-99272932 TCCCCTGGATACCCAGTAGGGGG - Intergenic
1073516184 10:104077579-104077601 TCCCCTGGTCCCCCACCCTGTGG + Intronic
1073704466 10:105967456-105967478 TCCCCTAGAGCCCCACAGGGAGG + Intergenic
1076405596 10:130210517-130210539 TCCCCTGGGCCTCCAGAAGGAGG - Intergenic
1077191313 11:1256957-1256979 TCCCCTGAAGCCCCACAGGGAGG + Intronic
1077777157 11:5284599-5284621 TCCCCTATACCCCCAGCTAGGGG - Intronic
1079970623 11:27031561-27031583 GCCTCTGGAATCCCAGCGGGAGG + Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1085541605 11:77275645-77275667 TCCCCTGGACCCCACTCAGGCGG + Intronic
1088812297 11:113399955-113399977 TCCTCTGGACCGCCAGGTGGAGG - Exonic
1089339486 11:117747823-117747845 TCCCCTGGACCCTCAGGGCAAGG - Intronic
1089848855 11:121479984-121480006 TCCCCAGGACTCCCAGAGAGGGG + Intronic
1092105816 12:5921149-5921171 TCACCTGGGCCCCCAGCATGAGG + Exonic
1092649030 12:10613115-10613137 TCCACTGGACCACCCGCTGGTGG + Intronic
1094477287 12:30850951-30850973 TCCCCTGGGCCCTCTGTGGGCGG + Intergenic
1096689305 12:53309640-53309662 TGGCCTGGGCCCCCAGTGGGGGG - Exonic
1100864692 12:98844392-98844414 TCCCCTGGAACCCCACCAGAAGG + Intronic
1101727125 12:107397103-107397125 CCCCTTGGAACCCCAGTGGGAGG + Intronic
1104845405 12:131844420-131844442 TGGCCTGTGCCCCCAGCGGGAGG + Intronic
1104903526 12:132201743-132201765 TCCTTGGGACCCCCCGCGGGGGG + Intronic
1104967006 12:132512827-132512849 TCCTCTGCACCCCCAGCTGTTGG - Intronic
1112776191 13:102846260-102846282 GCCCCTGGACCCCCATGAGGCGG - Exonic
1114066014 14:19060333-19060355 TCACCTGGACCCTCAGCAGAAGG + Intergenic
1114096254 14:19339692-19339714 TCACCTGGACCCTCAGCAGAAGG - Intergenic
1118540019 14:66813530-66813552 GCCTCTGGAACCCCAGCAGGAGG + Intronic
1121493565 14:94377271-94377293 TCCCCTGGGCCCCTAGCTGAAGG - Exonic
1122770623 14:104096076-104096098 TCGCCTAGACCCACAGTGGGCGG - Intronic
1122776355 14:104118567-104118589 TCCCCTGGCCACCCAGGTGGGGG + Intergenic
1130892992 15:88149301-88149323 TACCCTGCACCCCCAGCATGAGG - Intronic
1131787768 15:95931592-95931614 TCCCCTGGACCCCCACGGCCGGG - Intergenic
1132214351 15:100051600-100051622 TCATCTGGACCCACAGCGGCTGG - Exonic
1132675161 16:1118389-1118411 TCCCCTGGGACCCCAGGAGGTGG - Intergenic
1134677443 16:16100389-16100411 TCCCAGGGACCCCCATCTGGAGG - Intronic
1136403374 16:30030308-30030330 TTCTCTGGACCCTCAGCGGTGGG - Intronic
1136999487 16:35216625-35216647 TCCTCTGGACCTCCAGGGGTGGG - Intergenic
1137003463 16:35251381-35251403 TCCTCTGGACCTCCAGGGGTGGG + Intergenic
1137726415 16:50659649-50659671 GCCCCTGGACCCACATCTGGGGG - Intergenic
1138505446 16:57476064-57476086 TTCCCTGGAGCCCCAGCCTGGGG + Intronic
1138552168 16:57753974-57753996 TTCCCTGCACCCCCAGAGGACGG + Exonic
1141326509 16:83065010-83065032 TCCCCTGCACCCCCAGCCCCAGG + Intronic
1142228938 16:88890380-88890402 TCCTCTGGACCCCCGAGGGGAGG + Intronic
1142496555 17:309422-309444 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496575 17:309477-309499 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496600 17:309537-309559 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496622 17:309596-309618 TATCCTGGACCCCCAGCAGGAGG - Intronic
1142496662 17:309709-309731 TATCCTGGACCCCCAGCAGGAGG - Intronic
1143272952 17:5689146-5689168 TCCACTGGGCACCCAGCAGGGGG - Intergenic
1143747073 17:9002908-9002930 TCCACTGGAGCCCGAGCGGCGGG + Intergenic
1147428537 17:40357492-40357514 ACCCCTGCACCCCCAGCTGGGGG + Intronic
1149601790 17:57898201-57898223 TTCCCTGCATCCCCAGCAGGAGG - Intronic
1149639598 17:58194046-58194068 TCGGCTGGACCCCCAGCAGGAGG + Exonic
1150834298 17:68550756-68550778 TCCACTGGACTCCCTGAGGGTGG + Intronic
1151842599 17:76628637-76628659 TCCCCTGCAGCCCCCGCGAGAGG + Intronic
1152025328 17:77805169-77805191 TGCCCTGCACCCCCAGCACGAGG + Intergenic
1152984464 18:309057-309079 TCCCCTGAACCCCAAGCCTGAGG - Intergenic
1155382896 18:25244160-25244182 TCCCCTGGACCTGCATCTGGTGG - Intronic
1156896983 18:42257079-42257101 GCCTCTGGAACCCCAGCAGGAGG - Intergenic
1157615805 18:48987128-48987150 GCTCCTGGACCCCCAGTGAGAGG + Intergenic
1158536330 18:58311449-58311471 CCCCCTGGGCTCCCAGCTGGGGG + Intronic
1159505222 18:69327744-69327766 TCCTCTGGAATCCCAGCAGGAGG + Intergenic
1161304074 19:3557378-3557400 GGCCCGGGACCCCCAGCGGCCGG - Exonic
1161321031 19:3641650-3641672 TCCTCTGGGCCCGCAGCAGGTGG + Intronic
1161620310 19:5293775-5293797 TCCCCTGGACCCCCAGCGGGAGG - Intronic
1162362954 19:10230702-10230724 TCCTCCGGTCCCCCGGCGGGGGG - Intronic
1163375565 19:16928124-16928146 ACCCATGGAGCCCCAGCCGGTGG + Exonic
1165696759 19:37906830-37906852 TGCGCTAGACCCCCAGCGGAGGG - Intergenic
1166336584 19:42111918-42111940 TTCTCTGGACCCCCAGTGGTTGG + Intronic
1166356447 19:42230275-42230297 TCCCCTGGCCCTCCAGGGTGGGG + Exonic
1167661047 19:50796401-50796423 GCCCCTGGCCCCCCAAGGGGAGG + Intergenic
1168296085 19:55377911-55377933 GCGCCTGCACCCCCAGGGGGAGG + Intronic
1168333184 19:55581073-55581095 TCCCCCGGGCTCCCAGAGGGCGG + Intergenic
1168527337 19:57099642-57099664 TCCCCTCGATCCCCAGGCGGTGG + Intergenic
1168687176 19:58356008-58356030 GCCCCTGCACTCCCAGCAGGAGG + Exonic
925023293 2:588305-588327 TCACCTGGACCCTCAGCAGAAGG + Intergenic
926202459 2:10811993-10812015 TCTCCTGAACCCCCAGGAGGCGG - Intronic
932496975 2:72150516-72150538 TGCCCTGGAACCCCACCTGGTGG + Intergenic
932917139 2:75871871-75871893 TCCCCTGAGAGCCCAGCGGGAGG + Intergenic
933727754 2:85436181-85436203 TGCCCTGGTCCTCCAGCGTGGGG - Intronic
935220838 2:101011166-101011188 TCCCCTGGAGAGCCAGTGGGTGG + Intronic
938381105 2:130837088-130837110 TCCCCTGGGCACCCGGTGGGTGG + Intronic
947340898 2:229138194-229138216 TCTCCTGGACCCTCAGAAGGGGG + Intronic
948632328 2:239310104-239310126 ACCCCAGGACCCCCTGCTGGGGG + Intronic
948865158 2:240771460-240771482 TCCCCTGCACCCCCTGCGCCAGG + Intronic
948944279 2:241211554-241211576 TCCCCTGGCCACCCACCAGGAGG - Intronic
1169346151 20:4829458-4829480 TCCCCTGGACACACAGGAGGGGG + Intergenic
1172009479 20:31838026-31838048 GCCTCTGGAACCCCAGTGGGAGG + Intergenic
1172444323 20:34985139-34985161 TCCCCTGCACCGCCCGCAGGGGG - Intronic
1174128470 20:48325812-48325834 GACCCTGGACCTCCAGCAGGAGG + Intergenic
1176051305 20:63120941-63120963 TCCCCTTGCCCACCAGAGGGTGG + Intergenic
1179012053 21:37563792-37563814 CCCCCTGGAACCCTAGCGGTGGG - Intergenic
1179565871 21:42248415-42248437 TGCCCTGCACCCCCCACGGGTGG - Intronic
1179625397 21:42646299-42646321 TCCCATGGTCCCCCACAGGGTGG - Intergenic
1180192536 21:46172952-46172974 GCCTCTGGAACCCCAGCTGGGGG + Intronic
1180484494 22:15782925-15782947 TCACCTGGACCCTCAGCAGAAGG + Intergenic
1183833990 22:40436931-40436953 TCCTCTCCACCCCCAGCGGGGGG + Intronic
1184037390 22:41925313-41925335 CCCTCTGGACCCCCAGCCAGGGG - Exonic
1184982749 22:48105794-48105816 TGCCCTGGACCCCCAGCGCTGGG - Intergenic
1185275410 22:49948426-49948448 TCCCGTGGTCCCCTAGAGGGTGG + Intergenic
1185364596 22:50431657-50431679 TTCCCTGGGCCTCCAGCTGGAGG - Intronic
951907786 3:27721546-27721568 TACCCTGGAGCCGCAGCGGCGGG - Exonic
954795046 3:53157071-53157093 TCCCCTGGACTCCGTGCGAGGGG + Intronic
959241921 3:103808046-103808068 GCCTCTGGAACCCCAGCAGGAGG + Intergenic
961662383 3:128476408-128476430 TCCCCTGTGCCCCCAGTGGGTGG - Intergenic
961740998 3:129033091-129033113 TCCCCTTGTCCCTCAGGGGGAGG + Intronic
968589145 4:1449088-1449110 TCCCCAGGAGCCCCAGCCAGGGG + Intergenic
968832742 4:2941578-2941600 TCACCTGGAGCTCCTGCGGGTGG + Exonic
969333647 4:6494328-6494350 TCCCCTGGACACCCCGGGGAGGG - Intronic
969632145 4:8345098-8345120 TCCCTGGGACCCCCAGCTGCTGG - Intergenic
970018416 4:11539036-11539058 GACCCAGGACCCCCAGCTGGAGG + Intergenic
972830656 4:42810223-42810245 CCCTCTGGAACCCCAGCAGGAGG - Intergenic
974582013 4:63815087-63815109 GCCTCTGGAACCCCAGCAGGAGG - Intergenic
981940640 4:150278412-150278434 TCCCCTGCAACTCCAGCTGGAGG + Intronic
983147313 4:164233004-164233026 TCCCCTGGACACCCATCTGCAGG + Intronic
985537580 5:473602-473624 GTCCCGGGACCCCCGGCGGGGGG - Intronic
985672634 5:1214197-1214219 TCACATGGACCCCGAGCAGGAGG - Intronic
985733725 5:1565585-1565607 CCCCCTGGACACACAGCAGGGGG + Intergenic
990241617 5:53821937-53821959 TTCACTGGACCCCCAGTGGTGGG - Intergenic
992701195 5:79343338-79343360 TCCCCTGGACCAGCACCGGCAGG + Intergenic
996330026 5:122318113-122318135 TCCCCTGCACCCACAGGAGGAGG - Intronic
997299107 5:132789407-132789429 TCCCCTGGATCCCTGGCAGGGGG - Intronic
997528436 5:134568025-134568047 TCCACTGGAGATCCAGCGGGTGG - Intronic
999173643 5:149616510-149616532 CCCCCTGGTCCTCCAGAGGGTGG + Intronic
1001300865 5:170532746-170532768 TGCCCTGGACACTCAGCTGGAGG + Intronic
1002169631 5:177367774-177367796 CCCCCAGGACCCTCAACGGGTGG - Exonic
1002884484 6:1281483-1281505 CCTCCTGGACCCCCAGCAGCAGG - Intergenic
1006081768 6:31572101-31572123 TCGCCTGAACCCCCAGCCTGTGG + Exonic
1006994540 6:38246088-38246110 TCCTGTGGACCCCCAGTGGGAGG - Intronic
1007777974 6:44234316-44234338 TCCCCTGTGGCCCCAGCAGGGGG - Intergenic
1017544712 6:155438506-155438528 TCCCGTGGTCCCTCAGCTGGTGG - Intronic
1017720943 6:157242689-157242711 TCCCCTGGGCCCCCTGCGAGAGG - Intergenic
1017771792 6:157649938-157649960 TCCCGTGCACCCCCAGCGCCTGG - Intronic
1017771804 6:157649978-157650000 TCCCGTGCACCCCCAGCGCCTGG - Intronic
1017771816 6:157650018-157650040 TCCCGTGCACCCCCAGCGCCTGG - Intronic
1018802457 6:167235152-167235174 TGCCTTGGACCCACAGCGGAAGG + Intergenic
1018972075 6:168536721-168536743 TCCACAGTACCCCCAGGGGGTGG - Intronic
1019436679 7:1025812-1025834 TCCCCTGGGCCTCCAGAGGCAGG + Intronic
1019552127 7:1608332-1608354 CCCCCTGGATCCCCCGTGGGAGG - Intergenic
1019552143 7:1608372-1608394 ACCCCTGGATCCCCCGTGGGAGG - Intergenic
1019751401 7:2732680-2732702 TCCCCTGCACACCCCGTGGGTGG - Intronic
1020103168 7:5407000-5407022 CCCCCAGGTCCCACAGCGGGAGG - Intronic
1020275427 7:6621921-6621943 TCCCCTGGAGCCCGAGGAGGAGG + Exonic
1026947628 7:74326486-74326508 TCTCCTGGATCCCCAGCATGAGG - Intronic
1031076809 7:117221039-117221061 CCCCCAGCACCCCCAGCAGGTGG + Intronic
1032086818 7:128888815-128888837 ACCCCGGGAGCCCCAGCAGGGGG + Intronic
1036648999 8:10630170-10630192 TCCACTGCACTCCCAGCTGGGGG - Intronic
1037319637 8:17630866-17630888 TCTCCTGGACCCTCAGCTGGAGG + Intronic
1037494762 8:19428043-19428065 TCCTCTGGATCCCCTGCAGGTGG + Intronic
1039024632 8:33244381-33244403 TTCCCAGGACTCCCAGAGGGTGG - Intergenic
1039468665 8:37800560-37800582 TCCCCTGTTCCCCCAGCGCAGGG - Intronic
1039638739 8:39194972-39194994 GCCCCTGGAATCCCAGCAGGAGG - Intronic
1042776568 8:72438869-72438891 TCCCCTGGACCCCTGGAGGTTGG + Intergenic
1042876776 8:73447798-73447820 TCCCCTAGCCACCCAGAGGGGGG - Intronic
1045317753 8:101058044-101058066 TCCTGTGGACCCCCTGGGGGAGG + Intergenic
1047300032 8:123606129-123606151 TCCCCTGCAACACCTGCGGGAGG + Intergenic
1049228644 8:141470641-141470663 TCCCCTGGGCCCCCAGGAGATGG - Intergenic
1049571130 8:143370786-143370808 GCCCCTGCAGCCCCTGCGGGAGG - Intronic
1049577556 8:143396775-143396797 CTCCCTGGAGCCCCAGCAGGCGG - Intergenic
1052495007 9:29213876-29213898 CCCCCTCGACACCCAGCGAGAGG + Intergenic
1053165750 9:35842490-35842512 TCCCTTGGAACCCCTGCGGAGGG + Exonic
1053377654 9:37621556-37621578 TCCCCTGGGCCCCCAACTGCAGG - Intronic
1057645963 9:96875662-96875684 TCCCCGGGACCTCTAGCGTGAGG + Intergenic
1060264105 9:122100334-122100356 TCCCCTGGGCCCCCAGCACAGGG + Intergenic
1060269690 9:122131857-122131879 TCTCCAGGAAGCCCAGCGGGTGG - Intergenic
1061311480 9:129766090-129766112 TCTCCTGGGTCTCCAGCGGGCGG - Intergenic
1061596247 9:131631332-131631354 TCCCCTCGACCCCCAGCCCCTGG + Intronic
1061600867 9:131669203-131669225 TCCTCTGGAGGCCCAGAGGGTGG - Intronic
1061752140 9:132786466-132786488 TCCCCTGGACCCCCAGAGAGGGG + Intronic
1061762429 9:132859829-132859851 GCCCCTGGAACCCCAGCCCGAGG - Intronic
1062039200 9:134396399-134396421 TCCCCTGGCCTCCCAGGGGAGGG - Intronic
1062276285 9:135733058-135733080 TCCCCTGGACACCCTCCAGGAGG + Intronic
1062286267 9:135773880-135773902 TCCCCAGCACCCCCGGCTGGTGG - Intronic
1062401298 9:136373820-136373842 TCCCCAGGACCCCCAGCCCCCGG - Intergenic
1062535873 9:137020871-137020893 ACCCCCGGACCCCCAGCCAGTGG - Exonic
1203759286 EBV:3682-3704 TCCCCTGGACCTGCCGCTGGCGG + Intergenic
1185615465 X:1419172-1419194 TCCCCCCGACCCCCAGGGAGAGG - Intronic
1189262752 X:39689585-39689607 TCCCCTCCACCCCCACCGAGGGG - Intergenic
1189298789 X:39937452-39937474 CTCCCTGAGCCCCCAGCGGGGGG + Intergenic
1191609928 X:63101678-63101700 GCCCCTGGAATCCCAGCAGGGGG + Intergenic