ID: 1161620913

View in Genome Browser
Species Human (GRCh38)
Location 19:5296680-5296702
Sequence TTGCTGGAGCAGAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1007
Summary {0: 1, 1: 11, 2: 46, 3: 183, 4: 766}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161620900_1161620913 30 Left 1161620900 19:5296627-5296649 CCCCGGGGCAGCACTGCACCTGG 0: 1
1: 0
2: 3
3: 31
4: 269
Right 1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG 0: 1
1: 11
2: 46
3: 183
4: 766
1161620902_1161620913 29 Left 1161620902 19:5296628-5296650 CCCGGGGCAGCACTGCACCTGGC 0: 1
1: 1
2: 6
3: 46
4: 417
Right 1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG 0: 1
1: 11
2: 46
3: 183
4: 766
1161620907_1161620913 12 Left 1161620907 19:5296645-5296667 CCTGGCGTGTTGGAGGAATGGCG 0: 1
1: 0
2: 6
3: 31
4: 97
Right 1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG 0: 1
1: 11
2: 46
3: 183
4: 766
1161620903_1161620913 28 Left 1161620903 19:5296629-5296651 CCGGGGCAGCACTGCACCTGGCG 0: 1
1: 0
2: 0
3: 26
4: 242
Right 1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG 0: 1
1: 11
2: 46
3: 183
4: 766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161620913 Original CRISPR TTGCTGGAGCAGAGTGAGGA AGG Intronic
900495306 1:2973414-2973436 GTGCTGGGGCAGAGGGAGGAGGG + Intergenic
900509171 1:3050305-3050327 GTGCTGGAGCAGCGGGAGGGTGG + Intergenic
900699323 1:4034300-4034322 TTCCTGGAGGATAGTGAGGGTGG + Intergenic
900728886 1:4238481-4238503 TTGCTGCCGCCAAGTGAGGAAGG - Intergenic
900800902 1:4736417-4736439 TTTTTGGAGCAGAGTGAGCTGGG - Intronic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
902098994 1:13969558-13969580 TGGCTGAAGCAGAGTGACTAGGG - Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903290599 1:22311697-22311719 TGGTCGGAGCAGAGTGAGGGAGG + Intergenic
903293503 1:22329298-22329320 TGGCTGGAGTAGAGTGGGCAAGG - Intergenic
903296045 1:22343675-22343697 TGGCTGCAGCAGAGTGGGCAAGG + Intergenic
903320561 1:22540663-22540685 TGGCTGGAGCAGAGTGGGCATGG + Intergenic
903473817 1:23605902-23605924 GTGCTGGAGCCGAGAGGGGAGGG - Intronic
903655123 1:24944258-24944280 TGGCTGGAGCAGGGTGAGGGAGG - Intronic
903681821 1:25102556-25102578 TGGCTGGAGCAGAGTGAATGGGG - Intergenic
904272985 1:29362580-29362602 TTGCTGGAGAAGAGGGAAAAAGG + Intergenic
904413375 1:30339194-30339216 TTTCTGAAGCAAAGTGAGGTGGG + Intergenic
904451688 1:30617027-30617049 TGGCTGGGGCAGAGTAAAGAGGG + Intergenic
904648599 1:31987363-31987385 CTGGTAGGGCAGAGTGAGGAGGG - Intergenic
904706981 1:32398582-32398604 TGTCTGGAGCAGAGTGACTAAGG - Intergenic
904914048 1:33956960-33956982 TGGCTGGAGCATGGTGAGGAAGG - Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905106528 1:35566342-35566364 GTGTTGCAGCAGAGTGACGATGG + Exonic
905186450 1:36200502-36200524 TTTCTGGTGCAGTGTGAGGCAGG + Intergenic
905451347 1:38058814-38058836 TTGCTGGAGCAGAGTGGCAGAGG + Intergenic
905477237 1:38237687-38237709 TTGCTGGTGCCATGTGAGGAAGG + Intergenic
906155918 1:43613825-43613847 TTTCAGGAGCACAGAGAGGAGGG + Intronic
906188364 1:43879238-43879260 ATGCTGTAACAGGGTGAGGAAGG + Intronic
906283253 1:44568277-44568299 TGGCTGGAGCAGAGTGAGGTGGG - Intronic
907078244 1:51597145-51597167 TGGCTTAAGCACAGTGAGGAAGG + Intronic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907235224 1:53040320-53040342 TTACTGGAGCCAAGTGAGCAAGG - Intronic
907347624 1:53795964-53795986 TGGCTGGAGCAGAGTGAGTGAGG - Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907561845 1:55398269-55398291 TGGCTGGAGCAGAATGAGTGAGG + Intergenic
907615750 1:55924556-55924578 TGGCTGGAGCAGAATGAACATGG + Intergenic
908342197 1:63193085-63193107 TAGCTGGAGCACAGTGAACAAGG + Intergenic
908641396 1:66228025-66228047 TGGCTGGAGCAAAGTGAGTGAGG - Intronic
908647053 1:66289545-66289567 TGGCTGGAACAGAGTGAGCTAGG + Intronic
909584820 1:77278409-77278431 TAGCAGGAACAGGGTGAGGAAGG - Intergenic
909692391 1:78423417-78423439 AAGCTTGAGCAAAGTGAGGAAGG - Intronic
909774250 1:79464413-79464435 TTAGTGGAGCAGAGAGAAGAAGG - Intergenic
909980944 1:82100186-82100208 TCTGTGGAGTAGAGTGAGGAAGG - Intergenic
910104397 1:83615680-83615702 TGGCTGGGGCACAGTGAGTAAGG + Intergenic
911090961 1:94016484-94016506 CAGCTGGAGCAGGGAGAGGACGG + Intronic
911297854 1:96139336-96139358 TGGCTGGAGAAGAATGAAGAGGG + Intergenic
911758468 1:101588593-101588615 TCCATGGAGCAGAGTGGGGAGGG - Intergenic
911878728 1:103204870-103204892 TGGATGGAGCAGAATGAGGGAGG - Intergenic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
912797551 1:112701991-112702013 TGACTGGAAGAGAGTGAGGATGG - Intronic
913192124 1:116421725-116421747 TTGCTGGAGGAGATGGAAGAAGG + Intergenic
914697230 1:150095741-150095763 TGGCTGGAGCATAGTGAATAAGG + Intronic
914728939 1:150353421-150353443 TTCCTGGAGCAGAATGAAGCAGG + Intergenic
914922617 1:151857810-151857832 TGGCTGGAGGAGAGTGAAGGAGG + Intergenic
914976504 1:152368648-152368670 TGGCTAGAGCAGAGAGAGTAAGG - Intergenic
915040070 1:152960904-152960926 TTCCTGGGTCAGAGTGAGGAAGG + Intergenic
915115318 1:153594915-153594937 CTGATGGACCAGAGAGAGGAAGG - Intergenic
915346191 1:155198217-155198239 TTGCCTGGGCAGAGTGAGGCTGG + Exonic
915349045 1:155213217-155213239 GGGCTGGAGCAGAGAGAGAAGGG - Exonic
915352232 1:155233844-155233866 GGGCTGGAGCAGAGAGAGAAGGG - Intergenic
916818552 1:168376172-168376194 TTGCTGGTGCAGGGTAGGGAAGG + Intergenic
917048331 1:170888972-170888994 AGGCTGTAGCATAGTGAGGATGG - Intergenic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
918237207 1:182592201-182592223 AGGCTGGAGCAGAGTGAGGGAGG + Intergenic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
919860037 1:201733794-201733816 TGGCTGAAGCAGAGTTAGCAAGG + Intronic
920460603 1:206136673-206136695 TTGCTGGTGCAGAGTGGGGATGG + Intergenic
920955546 1:210617383-210617405 TTGATGAAGTAGAGAGAGGAAGG + Intronic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921190532 1:212704200-212704222 TGGCTGGAGTGGAGTGAGGAAGG + Intergenic
921329848 1:214024618-214024640 TTGATGGAGCAATGTGAGTAAGG - Intronic
921353278 1:214259844-214259866 TGGCTAGAGCTGAGTGAGCAAGG - Intergenic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921670147 1:217916073-217916095 TGGCCAGAGCAGAGTGAGAAAGG - Intergenic
922127714 1:222744949-222744971 TTGCTAGAGGAGAGTGGGTAGGG - Intronic
922348709 1:224718386-224718408 TGGCTGGAGTGGAGTGAGCAGGG + Intronic
922541095 1:226420530-226420552 CTGCTGGGCCAGTGTGAGGAAGG - Intergenic
922764920 1:228151720-228151742 CTGCTGGGGCAGAGTGGGCATGG + Intronic
922927330 1:229360835-229360857 TGGCGGGAGCAGGGTGGGGAGGG + Intergenic
922937550 1:229433528-229433550 TTGCTGGGCCAGCGTGAGGGTGG + Intronic
922950467 1:229554813-229554835 TTCCTGAAGCCCAGTGAGGATGG - Intronic
923672357 1:236051549-236051571 TTGCTGGTGCCGGGTGATGATGG - Intronic
924299685 1:242624993-242625015 TTGCTTGAGCAGACAGAGTATGG - Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1064961501 10:20970167-20970189 TTGTGTGAGCAGAGCGAGGATGG + Intronic
1065068695 10:22000486-22000508 TGGCTGGAGCAGAGTGATCAAGG - Intronic
1065088873 10:22209235-22209257 TTCCTGGATCAGTGTGTGGATGG - Exonic
1065229288 10:23580350-23580372 TTGCTGTAGCAGAGTGTGCTGGG + Intergenic
1066139554 10:32489718-32489740 AGGCTGGTGCAGAGTGAGCATGG + Intronic
1066541371 10:36450144-36450166 TTGCTGGTGCTAAGTGGGGATGG + Intergenic
1067543279 10:47173171-47173193 GTGCGGGGGGAGAGTGAGGAGGG + Intergenic
1067666483 10:48283852-48283874 TGGCTGAGGTAGAGTGAGGAAGG - Intergenic
1068143903 10:53040885-53040907 CTCCAGGAGTAGAGTGAGGAGGG + Intergenic
1068492633 10:57743162-57743184 TGGCTGGAACAGAGTGAGCAAGG - Intergenic
1069160202 10:65083755-65083777 GGGCTGTAGCAGAGTGAGCAGGG + Intergenic
1069333258 10:67318588-67318610 TAGCTGGAGCAGAGTGAACATGG - Intronic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1070217185 10:74397427-74397449 ATTCTGGAGCAGTATGAGGAAGG + Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070311172 10:75275278-75275300 ATGCTGCAGCAGAGTGACAAAGG - Intergenic
1070823249 10:79375528-79375550 CTGCAGGAGCTGAGTGTGGAGGG + Intergenic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1070873964 10:79783946-79783968 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071640896 10:87306085-87306107 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071654340 10:87431851-87431873 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1072535698 10:96360931-96360953 TTGATTGATCAGAGTGAGGCAGG + Intergenic
1072833013 10:98679228-98679250 CTGCTGATGTAGAGTGAGGATGG - Intronic
1072930523 10:99658663-99658685 TTGCTGGAGCGTGGTAAGGAAGG + Intergenic
1073172025 10:101518663-101518685 TGGCTGGAACAGAGTGAGCAAGG - Intronic
1073300064 10:102465747-102465769 CTGCTGGGGCAGATTGAGGGTGG + Intronic
1073626635 10:105104493-105104515 TTGCTTGAGGCGAGGGAGGAGGG + Intronic
1073682114 10:105716078-105716100 TGGCTGGAGCCCAGTGAAGAGGG - Intergenic
1073805554 10:107093840-107093862 GAGCTGGAGCAGAGTGAAGGAGG - Intronic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074436961 10:113442397-113442419 TGGCTGGGGGAGAGGGAGGAGGG - Intergenic
1074758839 10:116649068-116649090 TTGAGGGAGAAGAGTGGGGAGGG - Intergenic
1074835364 10:117287159-117287181 TTGATAGAGCAAAGTCAGGAAGG - Intronic
1075076123 10:119351617-119351639 TTTATCAAGCAGAGTGAGGATGG + Intronic
1075724459 10:124604348-124604370 TTGCTGGGGCCCAGTGAGGTGGG - Intronic
1075876761 10:125813928-125813950 TACCTGGAGCAGAGTGGGCATGG - Intronic
1076220313 10:128728501-128728523 TTGTTGGAGTTGAGAGAGGAAGG - Intergenic
1076676609 10:132150199-132150221 GCCCTGGAGCAGTGTGAGGAAGG - Intronic
1077211685 11:1374035-1374057 TAACCGGAGCGGAGTGAGGAGGG - Intergenic
1077581597 11:3420818-3420840 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1078043737 11:7893703-7893725 TTGTTGGAGCAGAGAGTGGATGG + Intergenic
1078087247 11:8241514-8241536 TGGCTGGAGCACAGTGTGGGAGG - Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078567185 11:12426375-12426397 TGGCTGGAGCATGGTGAGTAAGG + Intronic
1078885546 11:15496405-15496427 GTGGTGCAGTAGAGTGAGGAAGG - Intergenic
1079003221 11:16774745-16774767 AGGTTGGAGCAGGGTGAGGAAGG - Intergenic
1080305242 11:30828131-30828153 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1080855529 11:36108622-36108644 TTACTGGACAAGAGAGAGGAGGG + Intronic
1081415538 11:42810806-42810828 TTTTTGGAGGTGAGTGAGGAAGG - Intergenic
1081468328 11:43345898-43345920 TGGCTGCAGCAGAGTGATCAAGG - Intergenic
1081552754 11:44129403-44129425 TGGCTGGAGCAGAGTAAAGAAGG - Intronic
1081659551 11:44879638-44879660 TGGCTGGAACAGGGTGAGGAGGG + Intronic
1082775564 11:57241905-57241927 TTGCTTGTGCATAGTGAGGTAGG + Intergenic
1082896675 11:58199014-58199036 TGGCTAGAGCAGAGTGAGTGAGG - Intergenic
1082914764 11:58420903-58420925 TTGCTGGATCATAGAGAGCAAGG + Intergenic
1082986655 11:59175061-59175083 TTGGTGGAGAAGGGAGAGGAGGG - Intronic
1082999067 11:59275245-59275267 TTGCTGGACCATTGTGAGGCTGG - Intergenic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083318806 11:61832684-61832706 TTTCTGCAGCAGAGAGAGGCAGG - Intronic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1084238510 11:67803641-67803663 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1084497749 11:69514862-69514884 TTCCAGGAGCCCAGTGAGGAAGG + Intergenic
1084703048 11:70799982-70800004 TTGCAGTGGCAAAGTGAGGAAGG + Intronic
1084833907 11:71789192-71789214 TGGCTGGAGTGGAGTGAGCAGGG + Intronic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1085506701 11:77064939-77064961 ATGCTGCAGCACAGGGAGGAAGG + Intergenic
1085862107 11:80246256-80246278 TGGCTGGAGCAGGATGAGCAGGG + Intergenic
1085929124 11:81059473-81059495 TGGCTGGAGCAGAGGGAGGTAGG - Intergenic
1086980743 11:93195699-93195721 TGGCTGAAGCAGAGTGATGGAGG - Intronic
1087669576 11:101089679-101089701 TTGAGGGAGAAGAGGGAGGAAGG + Intronic
1087743056 11:101911802-101911824 TTGCTGGAATAGAGTGAGGTAGG - Intronic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1088771297 11:113038243-113038265 TTGCTGGAGAACAGTGAGTGGGG - Intronic
1088971865 11:114780913-114780935 TTGGGGGAGGAGAGTGATGAGGG + Intergenic
1089011107 11:115132497-115132519 TTGGTGGAGCTGAGTTGGGAGGG - Intergenic
1089454487 11:118618117-118618139 TGGCTGGAGAAGAGTCGGGAAGG - Intronic
1089611656 11:119672720-119672742 TGGCTGGAGCAGAGTGGGCAGGG - Intronic
1089794611 11:120970262-120970284 GTGCTGGAGAAGAGGGAGGCTGG + Intronic
1089801734 11:121036360-121036382 GTGGTGGGGCAGAGTGAGGGTGG + Intronic
1089929045 11:122290597-122290619 TTTCTTGAGCAGAGAGACGATGG - Intergenic
1090481724 11:127074811-127074833 TTGCGGGAGCAGAATGTTGACGG + Intergenic
1090846819 11:130536454-130536476 GGGCTGGAGCGGAGTCAGGAGGG + Intergenic
1090940876 11:131387347-131387369 GCGATGGAGCAGAGTGAAGAGGG - Intronic
1090968644 11:131620531-131620553 TAGCTGGGGCTGAGTGAGCAAGG - Intronic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091938253 12:4450651-4450673 TGGCTGGAGCATAGTAAGGAGGG - Intergenic
1091968336 12:4764347-4764369 TGGCGGGAGCAGTGGGAGGAGGG - Intronic
1092090557 12:5800240-5800262 TGGCTGGGGCAGAGTGAGCACGG + Intronic
1092191944 12:6527684-6527706 TTGCATGAACAAAGTGAGGAAGG - Intronic
1092409198 12:8241266-8241288 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1092762240 12:11820651-11820673 TGGCTGGAGCAGAATGAAGGAGG + Intronic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1095304496 12:40623899-40623921 GTGGTGGAGCAGAGAGAGTAAGG + Intergenic
1095349264 12:41189201-41189223 TTCCTGCTGCATAGTGAGGAAGG - Intronic
1095641003 12:44484634-44484656 TTGCTGTAGCCGTGTGAAGAAGG - Intergenic
1096672818 12:53210496-53210518 GTGAGGGAGCTGAGTGAGGAGGG - Intergenic
1096966792 12:55634754-55634776 TTGAGAGAGCAGAGTGAGGGTGG + Intergenic
1096979794 12:55721815-55721837 TTGCTGCAGCAGAGGCAGCAGGG - Exonic
1097029267 12:56079942-56079964 TTGGCGGAGCAGATCGAGGATGG - Exonic
1097626434 12:62007107-62007129 TGGCTGGAGCAGAAGGAGCATGG - Intronic
1097695061 12:62767617-62767639 AGTCTGGAGAAGAGTGAGGATGG + Intronic
1098069710 12:66659009-66659031 TTGCTAGAGCAGGGTAAGCAAGG - Intronic
1098228287 12:68347144-68347166 TTGGTAGAGAAGAGTGAGGAGGG - Intergenic
1098249158 12:68550842-68550864 TGGCTGGAGCACAGTGAGGAAGG - Intergenic
1098287167 12:68919009-68919031 TGGCTGGAGCCCAGTGAGCAAGG - Intronic
1098339235 12:69434649-69434671 TGGCTAGAGCAGAGGGAGGGAGG + Intergenic
1098445739 12:70564019-70564041 TGGCTGGAACAGAGTGAGCGAGG - Intronic
1098742911 12:74197824-74197846 TTGCTAGAGCATAGTCAGCAAGG - Intergenic
1099016369 12:77348382-77348404 TGGCTGGAGCAGAGGGAAGGGGG + Intergenic
1099541034 12:83907907-83907929 TGGCTGGAGCAGAGTGAGGTGGG + Intergenic
1099853437 12:88134259-88134281 TTGTTGGAGGAGAGGGAGGATGG - Intronic
1100169700 12:91960136-91960158 TTACTGGGGCAGAGTGAGGGAGG - Intergenic
1100255144 12:92875787-92875809 TAGCTGTAGCATAGTGAGCAAGG - Intronic
1100442215 12:94627550-94627572 TGGCTGGGGCAGTGTGAGCAGGG - Intronic
1100461458 12:94804014-94804036 ATTCTGGAGCAGAGAGAGAATGG - Intergenic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1100912822 12:99384664-99384686 TTGATGGAACATGGTGAGGAAGG - Intronic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101285553 12:103308556-103308578 TGGAGGGAGCAGAATGAGGAAGG + Intronic
1101709223 12:107249315-107249337 TGGCTGGAGCGGAATGAGGCAGG - Intergenic
1101878001 12:108608145-108608167 TAGCTGGAACAGAGTGAGTTAGG + Intergenic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102247945 12:111367087-111367109 TGGCTGGAGCTGAGTGAACAAGG - Intronic
1102260240 12:111438881-111438903 TGGCTGGATCAGAGCGAGGGAGG + Intronic
1102330041 12:112021196-112021218 TGGCTGGAGCTGGGTGAGAAAGG - Intronic
1102764678 12:115422479-115422501 TGGCTGGAGCAGAGAAAGCAGGG - Intergenic
1102807463 12:115794536-115794558 TGGCTGGAGAAGAGTGACCAAGG + Intergenic
1103361022 12:120353713-120353735 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1103481840 12:121255442-121255464 TTCCTGGAGCACAGGGAGGTGGG - Intronic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103865424 12:124047989-124048011 TGGCTGGAGCATAGTGAGAGAGG - Intronic
1103932562 12:124458306-124458328 GGGCTGCAGCAGAGAGAGGAGGG + Intronic
1103995851 12:124829547-124829569 TGGCTGGAGCAGAGTGAGCGAGG - Intronic
1104002423 12:124868716-124868738 TGGCTGGAGCAGAGTGGGCAAGG - Intronic
1104026070 12:125027377-125027399 TTGCTGGAGCAGGCTGGGCAGGG + Exonic
1104169007 12:126261639-126261661 CCGCTGGAGCAGAGTGAGCCAGG + Intergenic
1104385790 12:128350583-128350605 TGGCTGGAGCAGAGTGAGTGTGG + Intronic
1104588115 12:130063618-130063640 TTGCTGCAGCCGTGTGAAGAAGG + Intergenic
1104642045 12:130473572-130473594 TAGATGGAGCAGAGTGAGGGAGG + Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104968359 12:132520052-132520074 GTGCTGGAGGAGTGCGAGGAAGG - Intronic
1105665583 13:22552344-22552366 TGGCTGGAGCAGAGTGGGACAGG + Intergenic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1106634090 13:31508699-31508721 TTCCTGGAGCACAGTGTAGAAGG - Intergenic
1107200817 13:37714646-37714668 TGGCTGGAGCACAGAGAGCAAGG - Intronic
1107232584 13:38128262-38128284 GTGTGGGAGGAGAGTGAGGATGG - Intergenic
1107798454 13:44079690-44079712 TGGCTGAAGCAGAGCGAGCAAGG + Intergenic
1107799200 13:44088298-44088320 TGGCTGAAGCAGAGCGAGCAAGG - Intergenic
1108586188 13:51871875-51871897 TTCTGGGAGCTGAGTGAGGAAGG - Intergenic
1108621376 13:52187706-52187728 TGGCTGGAACACAGTGGGGAAGG - Intergenic
1109811219 13:67515230-67515252 TTTCTGGAGCAGAGTGGGAGGGG - Intergenic
1110467141 13:75814916-75814938 TGGCTGGAGCAGAGGGAGTGGGG + Intronic
1110469441 13:75842265-75842287 GGGCTGGAACAGAGTGAGTAAGG - Intronic
1111162751 13:84417366-84417388 TAACTGGAGCTGAGTGAGGAAGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112036387 13:95500478-95500500 GTGTTGGAGTAGAGTGAGGGTGG + Intronic
1112118333 13:96382164-96382186 TCAATGGAGCAGAGTGGGGAGGG + Intronic
1112131398 13:96527762-96527784 TGGCTGGAGCAGAGGGAGGCAGG + Intronic
1112202083 13:97286673-97286695 TGGCTGGAGCACAGTGTGGGGGG - Intronic
1112204799 13:97314139-97314161 TGGCTAGAGCAGAGTGAGTGAGG - Intronic
1112423078 13:99271411-99271433 CAGCTGGAGCAGAGTGATGGGGG + Intronic
1112574922 13:100627175-100627197 TGGCTGGAGCACAGAGAGCAGGG + Intronic
1112725823 13:102303070-102303092 TGGGTGGAGCAGAGTGAGTCGGG - Intronic
1113110650 13:106819683-106819705 TTCAAGGATCAGAGTGAGGAAGG + Intergenic
1113662865 13:112118830-112118852 TTGCTGGAGGTGGGTGGGGAGGG + Intergenic
1114846887 14:26333188-26333210 TGGCTGGAGCAGAGTGTGCAAGG - Intergenic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1116986734 14:51227854-51227876 TGGATGGAGCAGAGTGAGGAAGG + Intergenic
1117160990 14:52989495-52989517 TTGTTGGAGGGGAGTGGGGATGG - Intergenic
1117291403 14:54337239-54337261 TTGCTGGAGGGCAATGAGGAAGG + Intergenic
1117873051 14:60220813-60220835 CTACAAGAGCAGAGTGAGGAGGG - Intergenic
1118142925 14:63104489-63104511 TGTCTGGAGCATAGTGAGTAAGG - Intergenic
1118689771 14:68326955-68326977 TTGAAGGAGCAGAGTGATGTTGG - Intronic
1118816303 14:69316667-69316689 TGGCTGGAGCAGAGCAAGTAAGG + Intronic
1118832855 14:69451158-69451180 TTGCTGGCGCAGAGTGATTAGGG + Intronic
1119173607 14:72553292-72553314 CTGCTGGCGCAGAGTCAGAATGG + Intronic
1119939924 14:78629418-78629440 TGGTTGAAGCAGAGTTAGGAGGG + Intronic
1120703373 14:87723131-87723153 TGGCTGGAGAAGAGTGGGCAAGG + Intergenic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1122357836 14:101134637-101134659 GTGCAGGAGCACAGTGAGGTGGG + Intergenic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122735740 14:103839744-103839766 TGGCTGGAGCAGAGTGAGTAAGG - Intronic
1122838172 14:104441491-104441513 TCGCTGGGGCAGAGACAGGAAGG + Intergenic
1123737184 15:23196650-23196672 TAGCTGGAGTAGAATGAGAAGGG + Intergenic
1124096326 15:26651756-26651778 ATGCTGTACCAGAGTGAGGTTGG - Intronic
1124288400 15:28425312-28425334 TAGCTGGAGTAGAATGAGAAGGG + Intergenic
1124294824 15:28492002-28492024 TAGCTGGAGTAGAATGAGAAGGG - Intergenic
1124781135 15:32635156-32635178 AGACTGGAGCAGAGTGAGCAAGG - Intronic
1125207242 15:37167601-37167623 TTGCTGCAGGAGAGGGAAGATGG - Intergenic
1125935671 15:43633444-43633466 TGACTGGAGTAGAGTGAGCAGGG - Intronic
1125948442 15:43729908-43729930 TGACTGGAGTAGAGTGAGCAGGG - Intergenic
1126353956 15:47775256-47775278 GTGCTGGAGAAGAGGGTGGAAGG + Intergenic
1127674773 15:61228830-61228852 TTGCGGGAGCAGAGTGGGGCGGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1127919995 15:63486648-63486670 TTGCTGGGCCAGAGGTAGGAAGG - Intergenic
1127931983 15:63602842-63602864 TGGCTGGAGCAGAGTGAATGAGG + Intergenic
1128243005 15:66114264-66114286 TTGCTGTGGCAGAGAGAAGAGGG - Intronic
1128523068 15:68388220-68388242 TGGCTGGAGTAGAGTGAGCTAGG - Intronic
1128586277 15:68853002-68853024 GAGCCCGAGCAGAGTGAGGAGGG + Intronic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1129152768 15:73699496-73699518 CTCCTGGACCAGAGTGGGGAAGG - Intronic
1129240697 15:74250374-74250396 TGGCTGGAGCAAAGAGAGGGAGG - Intronic
1129449460 15:75642343-75642365 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
1129477274 15:75794603-75794625 CTGTTGCAGCAGAGTGAGGGTGG - Intergenic
1129514516 15:76148853-76148875 TTGCGGGAAGAGAGGGAGGAGGG - Intronic
1129538949 15:76335969-76335991 GTGGTGGAGGAGAGGGAGGAGGG + Intergenic
1129658372 15:77539638-77539660 TTTCTGGAGAAGAGTGAGGGAGG + Intergenic
1129672838 15:77616617-77616639 TTGCAGGTGCAGGGGGAGGAGGG - Intronic
1130078512 15:80710623-80710645 TTGCTGATGCAGAGTGGTGAAGG + Intronic
1131442233 15:92467757-92467779 TTGCTGATGGAGAGTGCGGAGGG - Exonic
1131600591 15:93844807-93844829 TTGCTGGTGCTGCTTGAGGAAGG - Intergenic
1131934611 15:97489685-97489707 TAGCTGGAGTGGAGTGAGCAAGG - Intergenic
1131998334 15:98154966-98154988 TGGCTGTAGCACAATGAGGAGGG + Intergenic
1132530950 16:449146-449168 TGTCAGGAGCAGAGTGAGCAGGG - Intronic
1133079632 16:3308416-3308438 TTCCTAGAGCAGAATGATGATGG + Intronic
1133350167 16:5096069-5096091 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1133755341 16:8758449-8758471 TGGCTGGAGCAGAGAGAGTGGGG + Intronic
1133757672 16:8774866-8774888 TGGCCGGAGAAGAGAGAGGAGGG - Intronic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1133791644 16:9013579-9013601 GTGCTGGAGCAGAGCGAACACGG + Intergenic
1134071448 16:11262445-11262467 TTGCTTGAGCACAGTGGGGGTGG - Intronic
1134075797 16:11290485-11290507 TGGCTGGAGCAGAGAGAGGTGGG + Intronic
1134334668 16:13287224-13287246 TTGATGGAGAAGAGTGTGGATGG + Intergenic
1134595365 16:15491617-15491639 TGGGTGGAGCAAAATGAGGAAGG - Intronic
1134692724 16:16201499-16201521 TGGCTGGAGGAGAGTGAGCATGG + Intronic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1134905362 16:17975312-17975334 TTGCTGGATAAGGGTGAGGAGGG - Intergenic
1134979121 16:18593182-18593204 TGGCTGGAGGAGAGTGAGCATGG - Intergenic
1135197647 16:20407993-20408015 TGGCTGGAGCAGACTGAGACAGG + Intergenic
1135510063 16:23074939-23074961 ATGCTGGAACAGACTCAGGATGG + Intronic
1136020394 16:27436412-27436434 TGGCTGGAGTGGAGTGAGGCAGG + Intronic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1136341959 16:29649907-29649929 TTGCTGGAGCTGAAGAAGGAAGG + Intergenic
1136390016 16:29958089-29958111 TTGCTTGAGCATGGTGAGGAGGG + Intronic
1138197209 16:55060496-55060518 TGGCTGGAGCAGAGTGGGTGAGG - Intergenic
1138413813 16:56859774-56859796 TGGCTGGAGCAGAGGGACCAAGG - Intergenic
1138550271 16:57744001-57744023 TGCCTGGGGCAGAGTGAAGATGG + Intronic
1138653276 16:58473975-58473997 TGGCTGGAGCAGAGTGAGCCAGG - Intronic
1139521924 16:67488033-67488055 ATGCTGCAGAAGAGTGAGGATGG + Intergenic
1139528824 16:67531651-67531673 TTGCTGGAACAGAGAAAGCAGGG + Intronic
1140130618 16:72157537-72157559 TGGCTGGAGCAGAGACAGTAAGG + Intronic
1140488856 16:75317338-75317360 TTGCTAGAGCAGAGGCGGGAAGG - Intronic
1141339270 16:83188028-83188050 TGGCTGAAGCAGAGGGAGCAAGG + Intronic
1141412127 16:83842560-83842582 TTGCTGAAACAAAGTAAGGAGGG - Intergenic
1141598890 16:85113580-85113602 TCACTGGAGAAGCGTGAGGAGGG - Intergenic
1141919861 16:87128448-87128470 TTGGTGAAGCAGGGTGTGGAAGG - Intronic
1143133548 17:4696415-4696437 TTGATGGAGAAAAGTGAGCAAGG + Intronic
1143363205 17:6388047-6388069 AGGGTGGAGCAGAGTGAGAAGGG + Intergenic
1143365049 17:6401964-6401986 TGGCTGGAGCAGGAGGAGGAGGG + Intronic
1143735034 17:8905626-8905648 ATGCTGGAGGTGAGGGAGGAGGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144330839 17:14222797-14222819 TGGCTGGAGCAGTGTGGGGGCGG - Intergenic
1144826984 17:18110794-18110816 TGGCTGGAGCAGAGTGATTGAGG - Intronic
1145019249 17:19416749-19416771 CTGCTGGAGCAGATTTGGGAAGG - Exonic
1145386740 17:22419235-22419257 TTGCTGGAGGGGAAAGAGGAAGG - Intergenic
1145963220 17:28899634-28899656 TGGCTGGAACAGAGTGAGGGGGG - Intronic
1147024871 17:37572661-37572683 TTACTGGAGAAGAGTGATGTTGG - Intronic
1147242108 17:39097200-39097222 TGCCTGGGGCAGTGTGAGGAGGG - Intronic
1147263453 17:39222076-39222098 TTTCTGGAGCCAAGGGAGGAAGG - Intronic
1147422991 17:40331837-40331859 TTGAAGGAGCAGACCGAGGAAGG + Intronic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1148717421 17:49725682-49725704 TGGCTGGAGCAGAGTGTGTCAGG + Intronic
1148770425 17:50063103-50063125 TGGCTGGAGCAGAAAGAGGCAGG - Intronic
1149671515 17:58416964-58416986 TTGCTGAGGCAGAGGGAGGGGGG + Exonic
1150293062 17:63992969-63992991 TGGCAGGGGCAGAGTCAGGAGGG + Intergenic
1150293870 17:63997870-63997892 TTTCTGGAGCAGACCAAGGAAGG - Intergenic
1150355901 17:64484410-64484432 CTGCTGGAGCAGACTGAGTGAGG + Intronic
1150379066 17:64706488-64706510 TGGCTGGAATGGAGTGAGGACGG - Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1152028944 17:77830044-77830066 TTACTGGGGCAGAGGGAGAAGGG - Intergenic
1152471724 17:80493231-80493253 TTGGGGGAGGAGAGAGAGGAAGG + Intergenic
1153227496 18:2909671-2909693 CTCCTGGAGCAGAGAAAGGATGG - Exonic
1153478052 18:5518241-5518263 TGGTTGGAGCAGAGAGAGGGAGG - Intronic
1153568862 18:6448106-6448128 CTGCTTCAGCAGAGTGTGGAAGG + Intergenic
1155777283 18:29780885-29780907 TTGGTAGAGCAGCATGAGGAAGG + Intergenic
1155827673 18:30468547-30468569 TAGCTGGAGTGGAGTGAGGAAGG + Intergenic
1155933967 18:31735681-31735703 ATGCTGGGGCAGAGTGGGGCTGG + Intergenic
1156774184 18:40767070-40767092 TGGTTTGTGCAGAGTGAGGAAGG + Intergenic
1157407639 18:47436602-47436624 TTACTAGGGAAGAGTGAGGAGGG - Intergenic
1157702247 18:49769187-49769209 CAGCTGGAGCAGAGTGAGTGGGG - Intergenic
1157714823 18:49876847-49876869 ATGCTGGAGCAGAGGGTGGAGGG - Intronic
1158244830 18:55420400-55420422 TTTTTGGAGTAGAGTGTGGAAGG - Intronic
1158662454 18:59400922-59400944 TGGCTGGAGCAGAGCTGGGATGG + Intergenic
1159133268 18:64306025-64306047 TAGCTGGAGCTGAGTGAGAGGGG + Intergenic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1159807543 18:72974352-72974374 TGGCTGGAACAGAATGAGCAGGG - Intergenic
1159864276 18:73686441-73686463 TTGCTGGAGGAGAGGCTGGAAGG - Intergenic
1160676319 19:393277-393299 TGGCTGCAGCAGACTGAGTAAGG + Intergenic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1160695974 19:484728-484750 TGGCTGCCGCAGGGTGAGGAGGG + Intergenic
1160699545 19:499146-499168 TGGCTGCAGCAGAATGAGGAGGG - Intronic
1160751762 19:737766-737788 TGGCTGGAGCAGCGTGAGGAGGG + Intronic
1160758793 19:772136-772158 TGGCTGGAGCAGAGGAAGGGGGG - Intergenic
1160988422 19:1850863-1850885 TGGCTGGACCAGGGTGAGGAGGG + Intergenic
1161018671 19:1997340-1997362 TTACTTGAGCAGTGCGAGGAAGG + Exonic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161239336 19:3213344-3213366 TGGCTGGAGCAGAGTGAGCTGGG + Intergenic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161267901 19:3373442-3373464 TGGCTGGAGCAGAATGAGCAAGG - Intronic
1161273395 19:3402857-3402879 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1161274291 19:3406976-3406998 TGGCTGGAGCAGAGTGAGCGAGG + Intronic
1161274904 19:3410509-3410531 TGGCTAGAGCAGAGTGAGGAAGG + Intronic
1161289397 19:3484998-3485020 TGGCTGGAGCAGAGTGAGCCGGG + Intergenic
1161301605 19:3545398-3545420 TGGCTGGAGTAGAGGGAGGAGGG - Intronic
1161302981 19:3551839-3551861 TGGCTGGAGCAGAGAGAGAAGGG - Intronic
1161345446 19:3766859-3766881 TGGCTGGAGCACAGTGAGGAGGG + Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161414742 19:4139698-4139720 TAGCTATAGCAGAGTGAGCAAGG + Intergenic
1161422021 19:4181171-4181193 TGGCTGGAGCAGAGTGAGGCAGG - Intronic
1161427280 19:4210476-4210498 TGGCTGCAGCAGGGTGGGGAGGG - Intronic
1161451750 19:4350237-4350259 TGGCTGGAGCCGAGTGAGTAAGG + Intronic
1161480139 19:4506234-4506256 AGGCTGGAGCCGAGTGAGGAGGG - Intronic
1161488310 19:4547815-4547837 TGGCTGGAGCACAGTGAGCAAGG - Intronic
1161493730 19:4576337-4576359 TGGCTGCAGCAGAGTGTGGAGGG - Intergenic
1161515469 19:4693836-4693858 TGGCTGGAGCACAGGGAGGAGGG - Intronic
1161533854 19:4806651-4806673 TGGCTGGAGCAGAGTGACAAAGG + Intergenic
1161596647 19:5154164-5154186 TGGCTGGAGCAGAGGGAGGCAGG + Intergenic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161629354 19:5344490-5344512 TGGCGGGAGCAGAGTGAGCGAGG - Intergenic
1161633273 19:5370219-5370241 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161650361 19:5480546-5480568 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161681929 19:5684474-5684496 TTAGTGGAGCGGAGTGAGCAAGG + Intronic
1161705812 19:5820920-5820942 GTGTCTGAGCAGAGTGAGGAGGG - Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161760584 19:6168176-6168198 TGGCTAGAACAGAGTGAGCAAGG - Intronic
1161765033 19:6202799-6202821 TGGCTGGAGCAGAGTGAGGGAGG + Intergenic
1161815691 19:6498543-6498565 CGGCTGAAGCAGAGTGAGGGAGG - Intronic
1161857043 19:6772138-6772160 TGGCTGGAGCACAGTGAAGAGGG + Intergenic
1161883456 19:6974334-6974356 TTGCTTCACCACAGTGAGGATGG - Intergenic
1161979658 19:7623957-7623979 GGGCTGGAGCGGAGTGAGGGTGG - Intronic
1162087846 19:8259367-8259389 TGGCTGGAGCAGAGTGGGTGAGG + Intronic
1162110352 19:8396690-8396712 TGGCTGGAGCAGAGTGAGCCGGG + Intronic
1162156382 19:8680923-8680945 TGGCTGGAGTGGAGTGAGTAAGG + Intergenic
1162304437 19:9863223-9863245 TGGCTGGAGCAGATTGAGTAAGG + Intronic
1162370201 19:10274099-10274121 TGGCTGGAGCTGAGTGAGCAAGG - Intronic
1162400720 19:10445013-10445035 TGGCTGGAGCAGAATGAGTGAGG + Intronic
1162418142 19:10550587-10550609 TGGCTGCAGCAGAGTGTGGGAGG - Intronic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1162844455 19:13381678-13381700 TGGCTGGAACAGAGTGAGTGAGG - Intronic
1162844470 19:13381799-13381821 TGGCTGAAGCAGAGCGAGCAAGG + Intronic
1162854892 19:13460661-13460683 TTGCTGTAGCTGAGTGACTAAGG - Intronic
1162875282 19:13616830-13616852 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1163017786 19:14467418-14467440 TGGCTGGAGGAGAGTGAGTGAGG + Intronic
1163113505 19:15175858-15175880 TGGCTGGAACAGAGTGAGTGAGG + Intronic
1163377423 19:16942021-16942043 TGGCTGGAGCAGGAGGAGGAGGG - Intronic
1163462303 19:17446486-17446508 TGGTGGGAGCTGAGTGAGGATGG - Intronic
1163704353 19:18803711-18803733 TGACTGGAGCAGAGTGAGGGAGG + Intergenic
1164011768 19:21209922-21209944 CTGCTTGTGCAGAGTGAGGCTGG + Intergenic
1164061419 19:21678435-21678457 CTGCTGGTGCAGAGCGAGGCTGG - Intergenic
1164324129 19:24177873-24177895 TCCCTGGCCCAGAGTGAGGATGG - Intergenic
1164534538 19:29075472-29075494 CTGCTCTAGCAGAGGGAGGAGGG + Intergenic
1165135451 19:33665683-33665705 CTGCTGGACCAGGGTGAGGCTGG + Intronic
1165323875 19:35102806-35102828 CGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1165387222 19:35517635-35517657 TGGCTGGAGCAGTGTTGGGATGG + Intergenic
1165433119 19:35783602-35783624 TGGCTGGAGCTGAGTGAGTGAGG + Intronic
1165737321 19:38184964-38184986 TGGCTGGAACAGAGCAAGGAGGG - Intronic
1165746229 19:38231238-38231260 TGACTGGAGCAGAGTGAGCAGGG + Intergenic
1165940249 19:39411336-39411358 TGGCTGGAGCAGAGTGGCCAAGG - Intergenic
1166051700 19:40264538-40264560 TGGCTGGAGCAGTGTGAGCTAGG - Intronic
1166099909 19:40565733-40565755 TGGCTGCAGCAGAGTGAGTGGGG + Exonic
1166219623 19:41356040-41356062 TGGCTAGAGCAGAATGAGGTGGG + Intronic
1166531532 19:43546246-43546268 CTCCTGGATCAGAGGGAGGAGGG - Intronic
1166532663 19:43552366-43552388 TTGCTGGGTCTGAGGGAGGAGGG - Intronic
1166700958 19:44881344-44881366 TAGCTGGGGCAGAATGAGGCGGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1167298314 19:48664470-48664492 TTCCTGGATCTGAGGGAGGAGGG - Intronic
1167425506 19:49427851-49427873 TTCCTGGATCTGAGGGAGGAGGG + Intronic
1167427443 19:49436748-49436770 ACGCTGGAGCTGAGTGCGGATGG - Exonic
1167604621 19:50475275-50475297 TGCCTGGAGCTGAGGGAGGAAGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167695957 19:51015767-51015789 TTCCTGGATCTGAGGGAGGACGG - Intronic
1167702061 19:51054648-51054670 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1167842308 19:52131958-52131980 TGGCTGGAGCAGAGGGAGTGAGG + Intronic
1167896668 19:52587345-52587367 TGGCTGGAGCAGAGGGAGTGAGG - Intergenic
1167906109 19:52661997-52662019 TGGCTGGAGCAGAGGGAGTGAGG + Intronic
1167932194 19:52874932-52874954 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167945109 19:52981839-52981861 TGGCTGGAGCAGAGGGAGTGAGG + Intergenic
1167963187 19:53123600-53123622 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1167988842 19:53340804-53340826 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1168161525 19:54513313-54513335 TTGAGGGAGCAGAGAGAGGAAGG + Intergenic
1168266267 19:55225335-55225357 TTCCTGGAGGTGAGGGAGGAGGG - Intergenic
1168311352 19:55462438-55462460 TGGCTGGAGCGGAGTGAGCAGGG - Intergenic
1168357766 19:55713021-55713043 GTGTTGGAGCAGAGTAGGGAAGG - Intronic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168472923 19:56654334-56654356 TGGCTGGAACAGAGTGAGAAAGG + Intronic
925221954 2:2148936-2148958 TTACTGGAGCAGGGGGAGGCAGG - Intronic
926605871 2:14897950-14897972 TGGCTGGGCCAGAGTGAGGTGGG + Intergenic
926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG + Intergenic
926736835 2:16079930-16079952 TTTCTGGACCACAGTGCGGAGGG + Intergenic
926862894 2:17327504-17327526 TGGCTGGAGCAGAGTGTGCATGG - Intergenic
926893816 2:17662040-17662062 TTGATAGAGCTTAGTGAGGAAGG - Intergenic
927144091 2:20149864-20149886 TGGCTGGAGCCCAGAGAGGAAGG - Intergenic
927205650 2:20608723-20608745 TTGGGGCAGCAGAGTGAGCAAGG - Intronic
927272100 2:21222726-21222748 TTCCTGGAGCAGAGTGAGTGAGG + Intergenic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
927865155 2:26583395-26583417 GTGCTGGGACAGAGTGGGGAGGG + Intronic
928074454 2:28250277-28250299 TGGCTGGAGCACAGTGAGTAAGG + Intronic
928247837 2:29646594-29646616 TGGCTAGAGCAGAGTAAGGCAGG - Intronic
928576056 2:32656495-32656517 TGCCTGGAGCAGAGTGTGAAGGG + Intronic
928673661 2:33628524-33628546 TTGTTGTAGCAGAGGGAGAATGG - Intergenic
929836404 2:45404834-45404856 TGGCCAGAGCAGAGTGAGCAAGG - Intronic
929879986 2:45827121-45827143 TGACTGGAGCAGAGTGTGGAGGG - Intronic
930257527 2:49109253-49109275 TTGCAGGAGCAGAGTGGGTGGGG + Intronic
931146717 2:59527262-59527284 TGGCTTGAGCAGAGTGAGCAGGG - Intergenic
931380743 2:61750964-61750986 TGGCTGGAGCAAAGTGATCAAGG + Intergenic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
931842411 2:66168330-66168352 TAGCTAGAGCAGAATGAGCAGGG + Intergenic
932362285 2:71118824-71118846 TTGCAGTGTCAGAGTGAGGAGGG - Intronic
932438489 2:71717096-71717118 CAGCTGGAGCAGGGTGAGCAAGG - Intergenic
932527683 2:72488969-72488991 TAGCTGGAGTGGAGTGAGCAAGG - Intronic
932734089 2:74242188-74242210 TAACTGGGGCAAAGTGAGGAAGG - Intronic
932757166 2:74416969-74416991 ATGCTGCAGCAGAGAGAGCAAGG - Intronic
933124432 2:78586544-78586566 TGGCTGGAGCAGAGGGAGTGAGG + Intergenic
933302644 2:80559828-80559850 TTGCTGCAGGAGGCTGAGGAGGG + Intronic
933360500 2:81276784-81276806 TTGCTGGGGCAGAGGGAAGCAGG + Intergenic
933699455 2:85244153-85244175 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
933718076 2:85376656-85376678 TTTCTGGAGAAGAGTGGGGATGG + Intronic
934087316 2:88520678-88520700 CTGCTGCAGCAGAGCCAGGAGGG - Intergenic
934752044 2:96799753-96799775 TGGCTGGGGCAGAGGGAGGCTGG + Intronic
935608030 2:104990360-104990382 TGGCTGGAGCAGTGTGAGTAAGG + Intergenic
936917558 2:117655451-117655473 TGGCTGGAGCTGAGGGAAGAAGG + Intergenic
937085720 2:119170457-119170479 TCTCTGGTGCAGAGTGAGAAGGG - Intergenic
937317058 2:120938270-120938292 TTGGTGGAGCAGGGTAGGGAGGG - Intronic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
940012849 2:149073026-149073048 TGGCTGGAGAATAGTGAGCAGGG + Intronic
940267738 2:151857804-151857826 TTGCTGGTGCAGAGTAAATAAGG - Intronic
940567573 2:155387350-155387372 TTGGTGGAGAAGACTGGGGAAGG - Intergenic
941196628 2:162460279-162460301 TGGCTGCAGCAGAGTGAGTTTGG - Intronic
941422529 2:165300676-165300698 TGGCTGGAGCAGAGTGGGAAAGG + Intronic
941442685 2:165557579-165557601 GTGCTGGAGGAGAAAGAGGAGGG + Intronic
941598580 2:167509708-167509730 TGGCTGGAGCAGTGTGAGTTAGG + Intergenic
941913745 2:170793616-170793638 TAACTGGAGCAGAATGAGCATGG + Intronic
942697760 2:178665029-178665051 TTGGTGGAACAAAGGGAGGATGG - Intronic
944053309 2:195496011-195496033 TGGCTGGAGCAGAGTGAGTGGGG - Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945504894 2:210627888-210627910 TTGCTGGAGGAAAAGGAGGAAGG - Intronic
946162303 2:217842781-217842803 TGGCTGGAGTAGAGTGATCAAGG - Intronic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
946440837 2:219693762-219693784 TGGCTGGAGCAGAGAGTGCAGGG + Intergenic
946855740 2:223948084-223948106 AGGCTGGAGCAGAGTGAGTGAGG + Intergenic
946884361 2:224208339-224208361 CTGCTGGAGCAGTGTGAGCAAGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947499937 2:230664510-230664532 TGGCTGGAGCACAGTGCAGAGGG + Intergenic
947787212 2:232834016-232834038 TCTCTGGAGCTGAGGGAGGAAGG + Intronic
948257945 2:236581653-236581675 ATGCTTGAGTAGAGTGAAGAGGG + Exonic
948509940 2:238457453-238457475 TTTCTAGTGCAGAGTGAGGTGGG - Intergenic
1168772065 20:421702-421724 TGGCTGGAGCAGAGGGATGAAGG + Intronic
1168809407 20:694445-694467 TGGCTGGAGCACAGTGAACAAGG + Intergenic
1169804069 20:9541512-9541534 TTGCTGGAGTAAAGTCAGAAAGG - Intronic
1170110325 20:12797939-12797961 TGGCTGGAGCAGCTTGAGGAAGG - Intergenic
1170175200 20:13461038-13461060 TGGCTGGAGCAGTGTGAGCAAGG - Intronic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170220360 20:13935609-13935631 TAACTGGAGCAGAGTGAGTGGGG + Intronic
1170770464 20:19328201-19328223 TGGCTGGAGCAGAATGAGGGAGG + Intronic
1170852925 20:20020469-20020491 TGGCTGGTACAGAGTGAGCATGG + Intronic
1171145130 20:22774782-22774804 TTCATGGAGCAGAGGGAGGCCGG + Intergenic
1171181204 20:23092039-23092061 TTGCGGGAGTAGAGTCAGGGTGG - Intergenic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1171414325 20:24967394-24967416 TTCCTGCAGCTGGGTGAGGAGGG - Intronic
1172027961 20:31962362-31962384 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172698002 20:36835550-36835572 TTGATGGACCCGAGTGGGGAGGG - Intronic
1173164606 20:40678169-40678191 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1173539422 20:43840494-43840516 GGGCTGGAGCAGAGTGATCAAGG + Intergenic
1173581768 20:44152030-44152052 TTGGTGGTGGAGAGGGAGGAAGG - Intronic
1173669352 20:44787174-44787196 TGGCTGGAGCAGACAGAGCAAGG + Intronic
1173919095 20:46730625-46730647 TGCCTGGAACAGAGGGAGGAAGG + Intronic
1174166001 20:48583986-48584008 TGGCCGGGGCAGAGTGAGTAGGG + Intergenic
1174181954 20:48680550-48680572 TGGCTGCCTCAGAGTGAGGAGGG - Intronic
1174278340 20:49419921-49419943 TGGCTGGAGGGGAGTGAGCAAGG - Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174299259 20:49569565-49569587 TGGCTGGAGCAGAGTGGGTGAGG - Intergenic
1174302106 20:49589872-49589894 TGGCTGGAGCTGAGTGAGTTGGG - Intergenic
1174313949 20:49682433-49682455 TGGCTGGAACAGAGTGAGTGAGG - Intronic
1174387839 20:50197807-50197829 TGGCTGGAGCAGAGGCAGCAAGG + Intergenic
1174405108 20:50297709-50297731 TGGTTGCAGCAGAGAGAGGAAGG - Intergenic
1174428278 20:50448804-50448826 TGGCTGGAGGAGAGTGAGTGAGG - Intergenic
1174531999 20:51221722-51221744 TGGCGGGAGCAGAGGGAGCAAGG + Intergenic
1174755879 20:53158193-53158215 TGTCTGGAGCCGAATGAGGAAGG + Intronic
1175507951 20:59499602-59499624 TTGCTTTAGAAGAGTGAGTAGGG - Intergenic
1175918790 20:62440285-62440307 TCGCTGGAGCAGACTGAGGCTGG + Intergenic
1176171107 20:63696740-63696762 TTGCTGGAGCAGGGAGAGCGCGG - Exonic
1176697034 21:9990484-9990506 TGACTGGAGATGAGTGAGGAAGG - Intergenic
1177442075 21:21138592-21138614 TTGCTGGAGATGTGAGAGGATGG - Intronic
1177519099 21:22194202-22194224 TTGCTGGAGCTGAGAGAGACTGG - Intergenic
1178016379 21:28351126-28351148 ATGCGGGAGGAGAGGGAGGAAGG - Intergenic
1178431978 21:32525383-32525405 TGGCTGAAGCAGAGCCAGGAGGG + Intergenic
1178466135 21:32849793-32849815 TTGCAGGAGCAGGGAGGGGAGGG + Intergenic
1178601567 21:33999203-33999225 TGGCTGGAGCAGGGTGACAAGGG - Intergenic
1178906733 21:36642797-36642819 TTGCTGGAGAAGAGTGGGGAAGG - Intergenic
1179022169 21:37650219-37650241 TTGCTGGAGCAGAGAGCTCAAGG - Intronic
1179639564 21:42738432-42738454 TTGCTGGAGCACAGTGAGGCTGG + Intronic
1179927991 21:44548825-44548847 TTGCTGGTGCAGAGTGTTCATGG - Intronic
1179936425 21:44608038-44608060 TTCCTGGGGCAGAGTCAGGAGGG + Intronic
1180125807 21:45789621-45789643 TGGCCGGAGCAGAGCGAGCAAGG + Intronic
1180709660 22:17831202-17831224 CTGCTGGAGCAGAGAAAGAATGG + Intronic
1180933475 22:19608971-19608993 TGGCTGCAGCACAGTGAGAATGG - Intergenic
1181041733 22:20195532-20195554 AGGCTGGGGCAGGGTGAGGACGG - Intergenic
1183149258 22:36025186-36025208 TAGCTGGAGCAGAGAGAGCAAGG - Intronic
1184096735 22:42320145-42320167 TGACTGGAGCAGAGTGAGCAGGG - Intronic
1184189118 22:42883193-42883215 TGGCAGGAGCAGGGTGAGGCTGG - Intronic
1184241975 22:43215838-43215860 TTGCTGGAGCTGAATGGGGTGGG + Intronic
1184537906 22:45099975-45099997 GTGCTGGGGCAGGGTGAGGCGGG + Intergenic
1184773961 22:46613976-46613998 CGGCTGCAGCAGTGTGAGGAGGG + Intronic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185316900 22:50183232-50183254 TTCCTGGAGCAGCCAGAGGAGGG - Intergenic
1185344915 22:50306936-50306958 CTGCAGGAGCAGGGTGCGGAGGG + Intronic
949200401 3:1371201-1371223 TTTCTTGAGCAGAATGAAGAAGG + Intronic
949380796 3:3443650-3443672 TTGCTTGAGCAGAGAGCAGAGGG + Intergenic
949629314 3:5905595-5905617 TAGATGGTGCAGACTGAGGATGG - Intergenic
949870335 3:8582730-8582752 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
950155042 3:10715690-10715712 ATGCTGGAGCTGAGTGTGGTGGG + Intergenic
950223272 3:11212865-11212887 TGGCTGGAGCTGAGTGAGTGAGG - Intronic
950399687 3:12760400-12760422 TTACTGGAGCAGAGTGAGGGAGG - Intronic
950455939 3:13092814-13092836 TGCCTGGAGCAGAGTGAGGAGGG - Intergenic
950582545 3:13871940-13871962 TGGCTGGAGTAGAGTGAGGAAGG - Intronic
950719149 3:14870264-14870286 TGGCTGGAGCAAGGTGAGGTTGG + Intronic
952113250 3:30148937-30148959 TAGCCTGAGCAGGGTGAGGAGGG + Intergenic
952235230 3:31472499-31472521 TGGCTGAAGCTGAGTGAGCAAGG - Intergenic
952254328 3:31682407-31682429 TGGCTGGAGCAGGGTGAACAGGG - Intronic
952356021 3:32584836-32584858 CAGCTGGAGCAGTGAGAGGAGGG - Intergenic
952461925 3:33536527-33536549 TGGCAGGAGCAGAGTGAACAAGG + Intronic
952763394 3:36934969-36934991 ATGCTGGAGCTGGGTGAGGGTGG - Intronic
952914424 3:38222477-38222499 CTGCAAGAGCAGAGTGGGGAGGG + Intronic
953067650 3:39489054-39489076 TGGCTGAAGCACAGTGAGGGAGG - Intronic
953239355 3:41134868-41134890 TGGCTGGAGCAGAATGAGTGAGG + Intergenic
953605628 3:44411441-44411463 TGGCTGGAGCAGAGGGAGAATGG - Intergenic
953955006 3:47225032-47225054 TGGCTGGAGTAGAGTGAGCAAGG + Intergenic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955088789 3:55729224-55729246 TGGCTGGCGTAGAGTGAGCAAGG - Intronic
955457191 3:59136352-59136374 TGGCTTGGGAAGAGTGAGGAAGG + Intergenic
955866922 3:63394334-63394356 TTTCTGGATTAGAGTGAGTAAGG - Intronic
955999886 3:64718003-64718025 TGGCTGGAGCACAGCGAGGCAGG - Intergenic
956484040 3:69702706-69702728 CTCCTGGAGCAGAGGGTGGAGGG - Intergenic
956488108 3:69742515-69742537 TGGCTGTAGCAGAGGGAGGTAGG - Intronic
956570049 3:70684121-70684143 AGGCTGGAGCACAGAGAGGAAGG - Intergenic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
956613393 3:71146940-71146962 TTGCTGGCGCCCAGTGAGCAAGG + Intronic
956946797 3:74232493-74232515 TGGCTGGAACAGAGTGAGTAAGG + Intergenic
957054459 3:75433432-75433454 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
957209662 3:77243457-77243479 TTTCTGGAGCTGGGTGTGGAGGG + Intronic
958055040 3:88399421-88399443 ATGCAGGAGCAGAGTGAGTGAGG - Intergenic
959001528 3:100969717-100969739 TTGCTGGAATAGAGTCAGGGTGG + Intronic
960147330 3:114217288-114217310 TACCTGGTGCAGAGTGAGTATGG + Intergenic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
961166459 3:124766980-124767002 TTGCTGAGGCAGCTTGAGGAAGG - Intronic
961307077 3:125965686-125965708 TGGCTGGAGGGAAGTGAGGAAGG + Intergenic
961676227 3:128568616-128568638 TTGTTGGGGTGGAGTGAGGATGG - Intergenic
961947130 3:130703235-130703257 TGGCTGGAGCAAAGTGAGCGAGG - Intronic
962100372 3:132335768-132335790 TTGCTGGAGAGGAGTGACAAGGG + Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962698686 3:137975824-137975846 TGGCTGCAGCAGAGTGAGGTGGG - Intergenic
962826230 3:139102728-139102750 TTGCCTGAGCAGAGGGAGCAAGG + Intronic
962944301 3:140153465-140153487 CTGGTGGAGAAGAGTGAGCAGGG - Intronic
963280289 3:143377874-143377896 TGGCTGGAGCTGAGTAAGCAAGG - Intronic
963730152 3:148963414-148963436 TGGCTGGAGAAAAGTGAGCAAGG + Intergenic
964081407 3:152763078-152763100 TGGCTGGAGCAGAGTGATTAAGG - Intergenic
964089873 3:152862790-152862812 TTGGTGGAACAGAGCGAGGTCGG + Intergenic
964249143 3:154690460-154690482 TTGCTGGAGCTGAGCAAGCAAGG + Intergenic
964361954 3:155907913-155907935 TGGTTGGAGCAGAGTAAGCATGG + Intronic
964419696 3:156488516-156488538 TGGCTGCAGCAGAGTAAGGAAGG + Intronic
964469524 3:157037937-157037959 CTGCTGGAGCTTAGTGAGCAAGG + Intronic
964682829 3:159361419-159361441 TGGCTGAAGCAGAGAGAGCAAGG + Intronic
964719054 3:159753757-159753779 CTGATGGTGGAGAGTGAGGAGGG - Intronic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
964948605 3:162258858-162258880 TGTCTAGAGCAGAGTGAGAAAGG + Intergenic
965167364 3:165212175-165212197 TTTCTTGAGCCTAGTGAGGAGGG - Intergenic
965537320 3:169836836-169836858 TGGCTGGAGCAGAGTGAGCCAGG + Intronic
966225297 3:177591317-177591339 TTGGAGGAGCAAAGAGAGGAGGG - Intergenic
966323927 3:178733304-178733326 TGGCTGGAGTAGAGTGAGCTGGG + Intronic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
966567199 3:181396576-181396598 TGGCTGCAGTAGAGTGAGGCTGG + Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
967886524 3:194337138-194337160 GCCCTGGGGCAGAGTGAGGAGGG + Intergenic
967889252 3:194353402-194353424 TTGCTGGAGGCGAGTGTGGATGG - Intergenic
968289498 3:197527632-197527654 TGGCTGAAGCAGAATGAGGGGGG - Intronic
968471355 4:783936-783958 TTGTTACAGCTGAGTGAGGAAGG - Intergenic
968471548 4:784835-784857 TGGATGGAGCTGAGTGAGAATGG + Intergenic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
968624191 4:1619142-1619164 GTGCTGGAGCTCAGGGAGGATGG - Intronic
968675675 4:1877672-1877694 TGGCTGGAACAGAATGAGAATGG - Intronic
968975767 4:3821391-3821413 TGGCTTGAACAGTGTGAGGATGG + Intergenic
968997272 4:3953742-3953764 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
969756742 4:9154940-9154962 TGGCTGGAGTGGAGTGAGCAGGG + Intergenic
969816712 4:9692509-9692531 TGGCTGGAGTGGAGTGAGCAGGG + Intergenic
970689655 4:18607883-18607905 AGGCTGGAGAAGAGGGAGGACGG - Intergenic
970873397 4:20842377-20842399 TGGCTGGAGCAGAGTAAATAGGG + Intronic
970965665 4:21925009-21925031 TGACTGGAGTAGAGTGAGTAAGG - Intronic
971015680 4:22486562-22486584 TTGTTGGAGCAGGATGAGTATGG - Intronic
971091951 4:23355958-23355980 TGGCTGGAGTAGAGTGAGAAAGG + Intergenic
971507879 4:27386257-27386279 TAGCTGAAGCAGAGTGAATAGGG - Intergenic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972425269 4:38927023-38927045 TGGCTGCAGCAGAGTGAGGCAGG - Intronic
973167658 4:47097243-47097265 TGGCTGGAGCAGAGTGAGAAAGG - Intronic
973339911 4:48993416-48993438 TAACAGGATCAGAGTGAGGAGGG - Intronic
973607868 4:52605800-52605822 TGGCTGGAGCAGAGAGAAGGAGG - Intronic
973755574 4:54070222-54070244 TGGGTGGATCATAGTGAGGAAGG + Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
974981034 4:68957108-68957130 TTCCTGGAGCAGCATGAAGATGG - Intergenic
975101647 4:70520974-70520996 TGGCCAGAGCAGAGTGAGGGAGG + Intronic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975475781 4:74821751-74821773 TGGCAGGAGCACAGTGAGTAAGG + Intergenic
975654627 4:76629315-76629337 TGGCTGGGGCAGAGTGAGTGAGG + Intronic
976035879 4:80820519-80820541 TTGCTGGAGCGTAGTGGGGCAGG + Intronic
976229401 4:82825596-82825618 TAGCTGGAGCAGAGAGAACAAGG + Intronic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
977593083 4:98848615-98848637 TGCCTGCAGCAGAGTGGGGAAGG + Intergenic
977811919 4:101366203-101366225 TTGATGGAGAAGACTGTGGAAGG - Intergenic
977848006 4:101789300-101789322 ATTGTGGAGCAGAGTCAGGATGG + Intronic
978787531 4:112626458-112626480 TGGTTGGAACAGAGTGAGCAAGG - Intronic
979609278 4:122672395-122672417 TTCCTGGACCAAACTGAGGATGG + Intergenic
979840615 4:125435676-125435698 TGTCTGGACCAGAGTGAGAAAGG + Intronic
980071130 4:128243667-128243689 TTCCTGGAGGGGAGTGAGCAGGG - Intergenic
980369640 4:131850676-131850698 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
980467614 4:133205128-133205150 CTTCTGGAGCAGAGTGGGAAGGG + Intronic
980610282 4:135151534-135151556 CATCTGGAGCAGAGTGAGCAAGG - Intergenic
981064545 4:140469014-140469036 GTGCTGCAGTAGAGAGAGGAGGG - Intronic
982048593 4:151475622-151475644 TGGCTGAAGTAGAGTGAGGGAGG + Intronic
982090354 4:151875160-151875182 TGGCTGGAGTAGAGAGAGCAAGG + Intergenic
982209083 4:153020496-153020518 GTGCAGGAGGAGAGTGGGGAAGG - Intergenic
982753504 4:159191103-159191125 TTACTGGAGCATAGAGAAGAGGG + Intronic
982812544 4:159844226-159844248 TACCTGGAGCAGAGTGAGCAGGG - Intergenic
982900916 4:161002527-161002549 ATCCAGGTGCAGAGTGAGGAGGG + Intergenic
983486243 4:168334048-168334070 TTTCTGGAGAAAAGTGGGGATGG + Intergenic
983671313 4:170241043-170241065 TGGCTGAAGTAGAGTGAGCAGGG - Intergenic
984010530 4:174366229-174366251 TGGCTGCAGGACAGTGAGGATGG + Intergenic
984318535 4:178161124-178161146 CTGCTGGAGCTGTGAGAGGAAGG - Intergenic
985018514 4:185662130-185662152 ATGCTGGAGTTGAGTGAGGCTGG + Exonic
986228801 5:5842673-5842695 TGGCTGGAGCCGATGGAGGAAGG + Intergenic
986637612 5:9838279-9838301 TGCCTGGAGAAGGGTGAGGATGG - Intergenic
988401393 5:30765498-30765520 TTCCTGGAGGAGAGTGTGGCTGG - Intergenic
988496588 5:31750812-31750834 TGGCTGGAGTGGAGTGAGTAGGG + Intronic
988627099 5:32889004-32889026 AGGCTGGAGCAGAGTGGGCAAGG - Intergenic
988901854 5:35741451-35741473 TGTCTGGAGCAGAGTGAGCTAGG + Intronic
988967504 5:36434001-36434023 TAGCTTGAGCAGAGTAAGCATGG - Intergenic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
991979013 5:72212345-72212367 TGGCTGGAGCAGAATGTGTAAGG - Intergenic
992146811 5:73858901-73858923 TGACTGGAGCAGAGGGAGTAAGG - Intronic
992388656 5:76310462-76310484 TGGCTGGAGCAGAATGACCAAGG + Intronic
992614201 5:78534060-78534082 ATGCTGGGGCAGGGAGAGGAGGG + Intronic
993139127 5:84008146-84008168 TTGCAGGAGTAAAGTGAGGATGG + Intronic
994052688 5:95380610-95380632 TGGCTGGAGGAGAGTAAGCAAGG + Intergenic
994998187 5:107092554-107092576 TTGGTGGAGCATAGTAAGCAAGG + Intergenic
995110252 5:108420989-108421011 TGGCTAGAGCAGAGTGACTAAGG + Intergenic
995642963 5:114278585-114278607 ATGCTGGAGCAAGGTGGGGAAGG - Intergenic
996139418 5:119887747-119887769 AGGCTGGAGCAGAGTAAGCAAGG - Intergenic
996190408 5:120533673-120533695 TGGCTGGAACAGAGGGAGCAAGG + Intronic
997240983 5:132308122-132308144 CTGCTGGAGGATGGTGAGGAGGG + Intronic
997286185 5:132680390-132680412 TGGCTGGATCAGAGTGAGTGAGG + Intronic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997415669 5:133726479-133726501 CTTCTGGAGGAGAGTGAGGATGG - Intergenic
998141531 5:139702277-139702299 TGGCTGGAGCAGAAGGAGCAGGG - Intergenic
998598707 5:143562047-143562069 TTCCTGGAGTATTGTGAGGATGG + Intergenic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
998882373 5:146656711-146656733 TGGCTGGAGAGGAGTGAGTAAGG + Intronic
999050480 5:148518847-148518869 TTGCTGGAGCAGAGTCCTGCAGG - Intronic
999857721 5:155613445-155613467 TGGATGGAGCAGAGTGAGCCAGG + Intergenic
1000039968 5:157478248-157478270 TTGCTGGCTCAGGCTGAGGATGG - Exonic
1000157019 5:158562266-158562288 TTACTGGAGAAGAGTGAACAGGG - Intergenic
1000158376 5:158574631-158574653 AGGCTGGAACAGAGTGAGCAAGG + Intergenic
1000166151 5:158650624-158650646 TGGCTGGAGAAGAATGAGCAGGG - Intergenic
1000581068 5:163035790-163035812 TTGGTGGAGCTGTGTGAAGAGGG + Intergenic
1000763227 5:165252491-165252513 TGGCTAGAGTGGAGTGAGGAGGG + Intergenic
1000816328 5:165927134-165927156 GAGCTGGAGCAGGGTGAGGGGGG - Intergenic
1001016869 5:168149806-168149828 TGGCTGTAGCAGAGTGAGTGAGG - Intronic
1001164242 5:169349114-169349136 TGGCTGGAGCAAAGTGAGAGAGG - Intergenic
1001483076 5:172101908-172101930 AGGCTGGAGAAGAGTGAGGCTGG + Intronic
1001584466 5:172824017-172824039 CAGCTGGAGCCGAGTGAGCAAGG + Intergenic
1001751795 5:174137062-174137084 TGGCTGGAACTGAGTGAGCAAGG + Intronic
1001763965 5:174230387-174230409 TAGCTGCAGCAGAGTGAGTTTGG - Intronic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1002706921 5:181167508-181167530 TTACTGGGGCTGGGTGAGGAAGG + Intergenic
1002915571 6:1525502-1525524 ATGCTGGAGCAGAATGGGAAGGG - Intergenic
1003257254 6:4485303-4485325 TGGCTGGGGCAGAGTGGGGCAGG - Intergenic
1003522079 6:6866882-6866904 TTGCTGGGGCTGGGGGAGGAGGG + Intergenic
1003715289 6:8639548-8639570 TTGCTGGAGCTGTGTGATAATGG + Intergenic
1004019178 6:11761019-11761041 TGGCTGGTTCAGATTGAGGAGGG - Intronic
1005134852 6:22556318-22556340 CTGCTGGAGTAGAGGAAGGATGG - Intergenic
1005423037 6:25672597-25672619 TGGCTGGAGCAGAGCAAGAAAGG + Intronic
1005995467 6:30928449-30928471 GTGGTGGGGCAGAGTGAGAAGGG + Intergenic
1006178350 6:32137713-32137735 TGAGTGGAGCAGAGTGAGCAAGG + Intergenic
1006184290 6:32171540-32171562 TTTCTGGAGGAGAGTGGGGTAGG + Exonic
1006191132 6:32210267-32210289 TTGCTGGAGCAGAGAGTAGAAGG + Intronic
1006466820 6:34200536-34200558 TGGCTAGAGCAGAGTAAGCAAGG + Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1006803221 6:36772347-36772369 TGGTTGGAGCAGTGAGAGGACGG - Intronic
1006864994 6:37202167-37202189 TGACTGGAGCATGGTGAGGAGGG - Intergenic
1006931273 6:37690083-37690105 TGGCTGGAGCAGAATGAGCCAGG - Intronic
1007547942 6:42708453-42708475 AAGCTGGAGCAGTGTGAGGGGGG + Intronic
1007728415 6:43930982-43931004 TGGCTGGAGCACAGTGAGGAAGG + Intergenic
1007736336 6:43984622-43984644 AGGCTGGAGCAGAGTGAGCGAGG + Intergenic
1008095578 6:47336300-47336322 TAGCTGGAGCAGAGGGAGCATGG - Intergenic
1008291935 6:49726109-49726131 TAGCTGGAGTAGAGGGAGCATGG - Intergenic
1008609750 6:53174798-53174820 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008793349 6:55267849-55267871 TTGCAGGGGCAGAATCAGGAAGG + Intronic
1008815170 6:55556491-55556513 TAGATGGAGAAGAGTGAGCAAGG + Intronic
1009822803 6:68826433-68826455 TGGCTGGAGCAGAGTGATCATGG + Intronic
1010351197 6:74876618-74876640 CAGCTGGAGTAGAGTGAGCAAGG + Intergenic
1011596807 6:89024410-89024432 TTGCTGGAGCACAGAGATCAAGG + Intergenic
1012415142 6:99005013-99005035 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1012417734 6:99027779-99027801 TGGCTGCAGCTGAGTGAGCAAGG + Intergenic
1012489369 6:99763756-99763778 TGGCTGGAGCATAGTGAGCTAGG + Intergenic
1012603695 6:101131099-101131121 TGGCTGGAGCAGAGTGACTGAGG + Intergenic
1012619733 6:101327760-101327782 TTTCTGGAGCAGCCTGAGGTAGG - Intergenic
1013070399 6:106723946-106723968 TGGCTGGAGTAGAGTGAAGAGGG + Intergenic
1013372913 6:109485450-109485472 TGGCTGGAGCACAGTGAGTGAGG + Intergenic
1013732403 6:113184223-113184245 TGGCTGGAGTAGAGAGAGGCAGG + Intergenic
1013774183 6:113660849-113660871 AAGCTGGAGCAGATTGAGTATGG + Intergenic
1014002939 6:116385150-116385172 TGGCTGGAGCAGAGAGAGACTGG + Intronic
1014007873 6:116442207-116442229 TGGCTAGAGCAGAGTGGGGGAGG + Intergenic
1015153355 6:130063284-130063306 TTACTGGCTGAGAGTGAGGATGG + Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015809084 6:137143225-137143247 GTGCTGGAGAAGAGTGAGGAAGG + Intergenic
1016471425 6:144378641-144378663 GTGCTGGAGCAAACTGAGGAGGG + Intronic
1016488295 6:144567299-144567321 GTGTTGGAGCAGACTGGGGAAGG + Intronic
1016580426 6:145623502-145623524 TGGCTAGAGCAGAGTGAGAGAGG + Intronic
1016631745 6:146240977-146240999 TTGTTGGAGTAGATTCAGGAGGG + Intronic
1016695750 6:146992942-146992964 CTGCTGATGAAGAGTGAGGAAGG - Intergenic
1016737441 6:147494549-147494571 GTGCTGGAGCAAAGTGAGAGTGG - Intergenic
1016759579 6:147722432-147722454 TTGCTTGTGCAAAGTGTGGATGG - Intronic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017220488 6:151960570-151960592 TGACTAGAGCAGAGTGAGGCAGG + Intronic
1017771978 6:157650853-157650875 TTGCTGGCCAACAGTGAGGAGGG + Intronic
1018961875 6:168455083-168455105 GTGCCGGGGCGGAGTGAGGACGG + Intronic
1019202543 6:170330120-170330142 TTTCTGGAACAGTGTGAGGGAGG + Intronic
1019500109 7:1360483-1360505 TTCGTGGAGCAGAGTCAGGTTGG - Intergenic
1020133766 7:5574612-5574634 TTGCTGGAGCAGAGCCAGGTGGG - Intergenic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1022026423 7:26452156-26452178 GGGCTGGAGCAGAGCGAGGTTGG - Intergenic
1023537811 7:41231928-41231950 GTGTGGGAGCAGAGTGAGGCCGG - Intergenic
1023641638 7:42264885-42264907 GTGCAGGAGGAGAGTGAGAAAGG + Intergenic
1023934188 7:44727498-44727520 TGGCTGGAGCATAGTGAGCAAGG + Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024785480 7:52902500-52902522 CTGCTGGAGAACACTGAGGAGGG - Intergenic
1027602941 7:80261918-80261940 TGGTTGCAGCATAGTGAGGAAGG - Intergenic
1027814092 7:82946657-82946679 TGGTCGGAGCAGAGTGAGGAGGG + Intronic
1028276389 7:88863104-88863126 TTGCTGTAGCATAGTGAGCACGG - Intronic
1029482802 7:100823371-100823393 TGGCTGGAGCACAGTGGGGTAGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031117910 7:117688043-117688065 TTGCTGGGGCAGAGGGAGGGTGG + Intronic
1031528845 7:122852685-122852707 TAGCTGGAGCAGAGAGAGCAAGG + Intronic
1031545717 7:123049734-123049756 CTGCTAGAGAAGAGTGTGGAAGG - Intergenic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1032220373 7:129989863-129989885 CTGCTGGAGGAGTCTGAGGAAGG + Intergenic
1032415495 7:131732537-131732559 TGGCTGGAGCAGAGGGAGCTGGG - Intergenic
1032445138 7:131975889-131975911 TGGATGGAGCAGAGTGAACAAGG - Intergenic
1033562434 7:142545211-142545233 TGGCTGGAGCAGAGAGAGCCAGG - Intergenic
1033871432 7:145758735-145758757 TGGCTGAAGCTGAGTGAGTAGGG - Intergenic
1035761993 8:2075331-2075353 TTGCTGGTGCTGAGTGAGCAAGG - Intronic
1036616853 8:10394706-10394728 CTGCTGGGGCAGAGTGCAGAAGG - Intronic
1036849583 8:12192402-12192424 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1036870945 8:12434675-12434697 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1037431407 8:18817080-18817102 TGGCTGGAGAGGAGTGAGCAAGG + Intronic
1038820854 8:30950851-30950873 TGGCTGGAGAAGAGTGACTAAGG + Intergenic
1038941907 8:32314472-32314494 TTGCTGGAGCCAACCGAGGAGGG - Intronic
1039148290 8:34474768-34474790 ATGCTGGAACAGAATGAGTAAGG + Intergenic
1039379834 8:37074716-37074738 ATGATTGAGCAGAGAGAGGAAGG - Intergenic
1039393952 8:37206811-37206833 TGGTTGGAGAAGAGTCAGGAGGG + Intergenic
1039826705 8:41180476-41180498 GTGTTTGGGCAGAGTGAGGATGG - Intergenic
1039907042 8:41794281-41794303 TGGTTGAAGCAGAGTGAGGCAGG - Intronic
1040485209 8:47864637-47864659 GTGCCACAGCAGAGTGAGGAGGG + Exonic
1041207973 8:55517660-55517682 TGGCTGGAGCACAGAGAGGCAGG + Intronic
1041389228 8:57334238-57334260 TTCCTGGAACAGAGGTAGGATGG - Intergenic
1042089253 8:65140822-65140844 CCGCTGGAACAGAGTGAGAACGG + Intergenic
1042837418 8:73091201-73091223 CTGCTGGAGGAGAGAGAGGCAGG - Intronic
1042985095 8:74574527-74574549 TTGCTGGAGTAAAGTGAAGGAGG + Intergenic
1044287677 8:90428048-90428070 TAGCTGGAACAGAGTCAGCAAGG + Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1044701418 8:94968571-94968593 TGCCTGGAGCTGAGTGAGCAAGG + Intronic
1044733686 8:95255280-95255302 ATGCTGGAGCATAATGAGTAGGG - Intronic
1045152969 8:99429956-99429978 TGGCTTCAGCAGAGTGAGCAAGG - Intronic
1045976281 8:108133429-108133451 TTGCTGGAGAAGATTCAGGGAGG - Intergenic
1046287164 8:112109154-112109176 TGGCTAATGCAGAGTGAGGAAGG + Intergenic
1046823502 8:118661575-118661597 TGGCTGGAACAGAGAGAGTAAGG + Intergenic
1047171062 8:122492626-122492648 TGGCTGCAGCAGAGTTAGCAAGG + Intergenic
1047236817 8:123048900-123048922 AGGCTGGAGCAGAGTGACAAGGG - Intronic
1047241747 8:123096276-123096298 TGGCTAGAGCAGACTAAGGAAGG - Intronic
1047367884 8:124228983-124229005 TGGCTGGAGCAGAGTGAGCTTGG + Intergenic
1047463277 8:125088933-125088955 TGGCTGGAGCAGAGTCAGCTAGG + Intronic
1047676823 8:127211844-127211866 TTGGGGGAGTTGAGTGAGGAGGG - Intergenic
1047899577 8:129405544-129405566 TTGCTAGAGAAGAGGGTGGAAGG + Intergenic
1048043654 8:130753771-130753793 TTTCTGAAGCAGAGGGAGGCTGG - Intergenic
1048047404 8:130785850-130785872 CAGCTGGAGCAGAGTGAGAGAGG - Intronic
1048059088 8:130899034-130899056 TGGCTAGAGCATAGTGAGCAGGG - Intronic
1048861448 8:138727175-138727197 GTGCTGGAGCTGAGGGAGGAGGG - Intronic
1048938572 8:139377225-139377247 AGGCTGGATGAGAGTGAGGAGGG - Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049137470 8:140916367-140916389 TGGCTGGAACAGAGTGAATACGG - Intronic
1049251963 8:141594015-141594037 TAGCTGGAGCAGAGTGAGCCAGG + Intergenic
1049652976 8:143783839-143783861 TTGATGGTGTAGAGTGAGGAGGG - Intergenic
1049784308 8:144443313-144443335 GTGCTGGTGCTGAGTGTGGAAGG + Exonic
1049847103 8:144808142-144808164 CTTCTGGTGCAGAGTGAGGTTGG - Exonic
1049889429 9:54840-54862 TGGCTGGAACAGAAGGAGGAGGG - Intergenic
1049985959 9:951685-951707 GTTCTGGAGCAGATTGAGGGAGG + Intronic
1050185633 9:2969901-2969923 ATGCTGGAGCAGAGTGAGTGAGG + Intergenic
1050362285 9:4841639-4841661 TTGTTGGAACAGAGTGCAGATGG - Intronic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1051100541 9:13515881-13515903 TAGCTGGAGCAGAGAGAATAAGG + Intergenic
1051225334 9:14892806-14892828 TGCCTGGGGCAGAGTGGGGAAGG - Intronic
1051261425 9:15268974-15268996 TGGCTGGAGTCGAGTGAGTAAGG - Intronic
1051542203 9:18232167-18232189 TGGCTAGAGCAGAGTGAGTGAGG - Intergenic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1053125696 9:35579158-35579180 TTGCTGGGGGAGGGTGGGGATGG - Intergenic
1053578955 9:39383112-39383134 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053634018 9:39976336-39976358 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
1053771729 9:41487168-41487190 TGGCTGGAGATGAGTGAGGAAGG + Intergenic
1053843467 9:42211187-42211209 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054100538 9:60941916-60941938 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054121934 9:61217541-61217563 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054209869 9:62274361-62274383 TGGCTGGAGATGAGTGAGGAAGG + Intergenic
1054315126 9:63574593-63574615 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
1054585808 9:66964970-66964992 ATGATTGAGCTGAGTGAGGAAGG + Intergenic
1055155248 9:73054991-73055013 TTGGTGAAGCACTGTGAGGAGGG + Intronic
1055293641 9:74811883-74811905 ATGCTGGAGAAGAGTGCAGAAGG + Intronic
1055360126 9:75480838-75480860 TTGCTGGAGCAGAATGTGATTGG + Intergenic
1056493107 9:87127263-87127285 TGGCTGGAGCAGAGTGAATGTGG - Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057445643 9:95112585-95112607 AGGCTGTACCAGAGTGAGGAGGG + Intronic
1057500180 9:95590622-95590644 TGGCTGGAGCAGAGTAAACAAGG - Intergenic
1057734076 9:97637064-97637086 GTGCTGGAGCAGAGTGAGTGAGG + Intronic
1057846161 9:98526329-98526351 GTGCTGGAGCAATGTCAGGAAGG - Intronic
1057865586 9:98677827-98677849 GTGCTGGAGCAGAGATTGGATGG - Intronic
1058597446 9:106630188-106630210 TGGATGGAGCAGAGTGCAGAAGG + Intergenic
1059750207 9:117240493-117240515 TGACTGGAGCAGAGTAAGAAAGG + Intronic
1059972972 9:119686336-119686358 TTTCTGCAGCAGAGTGACGGTGG - Intergenic
1060706464 9:125806277-125806299 TGGCTGGAGCAGAGGGAGGGAGG + Intronic
1060744776 9:126124109-126124131 TTGCTCGAGAACAGTGAGGAGGG + Intergenic
1061085754 9:128397255-128397277 TGGCTGGAGCGCAGTGAGGAAGG + Intergenic
1061234335 9:129333860-129333882 TTTCTGGAGGAGAGAGAGGAAGG - Intergenic
1061274613 9:129562218-129562240 TTGCTGGAGGACAGAGAGAATGG - Intergenic
1061277714 9:129579026-129579048 TTGTTGGGGGAGAGGGAGGATGG - Intergenic
1061350566 9:130061486-130061508 TGGCTGGAGCAGAGTGATCTAGG + Intronic
1062534283 9:137014689-137014711 TCGCTGGAGAACAGTGAGGCCGG - Exonic
1185825628 X:3246483-3246505 TTGGTGGAGGAGAGTGATTAAGG + Intergenic
1186214375 X:7283206-7283228 CTTCTGGTGCACAGTGAGGATGG + Intronic
1186506860 X:10100614-10100636 TGGCTGGAGCAGGGTGAGTGGGG - Intronic
1187055006 X:15734652-15734674 TAGGTGGATCAGAGTGAGAAAGG + Intronic
1187731379 X:22258642-22258664 TGGCTGGAGCAGAGCGAGCAAGG + Intergenic
1187765462 X:22636920-22636942 TAGCTGGAGCTGAGTGAGAAAGG + Intergenic
1187932240 X:24304048-24304070 GGGCTGGAACAGAGTGGGGAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189249981 X:39593277-39593299 ATGCTGGTGGAGAGTGAGAAAGG - Intergenic
1189482738 X:41405727-41405749 CAGCTGGAGCAGAGTGAGCCGGG - Intergenic
1190216093 X:48480402-48480424 TGGTTGGAACAGAGTGAGGGGGG + Intronic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1190458558 X:50647894-50647916 GAGCTGGAGCACAGTGAGCAAGG + Intronic
1191135997 X:57066327-57066349 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1191613022 X:63136870-63136892 TGCCTGAAGCAGAGTGGGGAAGG - Intergenic
1191623275 X:63242056-63242078 TGCCTGAAGCAGAGTGGGGAAGG + Intergenic
1192273824 X:69610115-69610137 TGACTGGAGCAGAGTGAACAAGG + Intergenic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1192543656 X:71995483-71995505 TGGCTGGTGCAGAGTGCAGAAGG - Intergenic
1194165361 X:90508141-90508163 TTGCTGCAGCTGCGTGGGGATGG - Intergenic
1194546832 X:95246123-95246145 TTACTGGAGGTGAGGGAGGAAGG + Intergenic
1194643675 X:96432044-96432066 TGGCTGGAACATAGTGAGGAAGG - Intergenic
1195271261 X:103233374-103233396 TTGCCTGAGCAGGGTGAGGAAGG + Intergenic
1195576637 X:106459135-106459157 TGACTGGAGCTGAGTGAGCAAGG - Intergenic
1195582114 X:106517081-106517103 GTGATGGAGCTAAGTGAGGAGGG + Intergenic
1195791630 X:108594589-108594611 TTGCTAGAGCAGAATGAGGGAGG - Intronic
1195993589 X:110708770-110708792 TTGAAAGAGCAGAGTGTGGATGG - Intronic
1196086299 X:111685911-111685933 TTGCAGGAGCATAGTGAGCAAGG + Intronic
1196264773 X:113629747-113629769 GGGGTGGAGAAGAGTGAGGATGG + Intergenic
1196377609 X:115051513-115051535 TTGCTGGGGCAGAGTAAGCAAGG + Intergenic
1196830611 X:119772786-119772808 TGGCTGGAGCAGAGTGAGGGAGG - Intergenic
1196906754 X:120444541-120444563 CGGCTGGAGGAGAGTCAGGAAGG - Intronic
1197798905 X:130328615-130328637 TGGCTGGAGCAGAGCCATGAAGG - Intergenic
1197830334 X:130635181-130635203 GTGCTGGAGGAAAGTGAGGCAGG - Intronic
1197891008 X:131270367-131270389 TGGCTGGAGCATAGTAAGCAAGG - Intergenic
1197916608 X:131542473-131542495 TGACTGGAGCAAAGTGAGCAAGG + Intergenic
1198000824 X:132433787-132433809 TGGCTGGAGCAGAGCCATGAAGG - Intronic
1199424022 X:147680435-147680457 CTGCAGGAGCAGAGTAGGGAGGG + Intergenic
1200250103 X:154548217-154548239 TAGCTGGAGCAGAGTGAGGGAGG + Intronic
1200335581 X:155347837-155347859 TGGCTGGAGCTGAGTAAGCAAGG - Intergenic
1200350887 X:155493388-155493410 TGGCTGGAGCTGAGTAAGCAAGG + Intronic
1200511629 Y:4085951-4085973 TTGCTGCAGCTGCGTGGGGATGG - Intergenic
1200972689 Y:9172586-9172608 TTGCTGGAGCAGGCTGTGGAAGG + Intergenic
1201140839 Y:11026745-11026767 GTGCTGGAGAAGAGTGGAGAGGG - Intergenic
1201298181 Y:12483371-12483393 TTGCTGTTGGAGAGTGATGATGG - Intergenic
1201798801 Y:17930593-17930615 TGGCTGGAGCAGACCGTGGAAGG - Intergenic
1201802752 Y:17975364-17975386 TGGCTGGAGCAGACCGTGGAAGG + Intergenic
1202138327 Y:21691629-21691651 TGGCTGGAGCAGGCTGTGGAAGG - Intergenic
1202166159 Y:21990990-21991012 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202172233 Y:22061981-22062003 TGGATGGAGCAGACTGTGGAAGG - Intergenic
1202219131 Y:22524390-22524412 TGGATGGAGCAGACTGTGGAAGG + Intergenic
1202225199 Y:22595383-22595405 TGGCTGAAGCATAGTGTGGAAGG - Intergenic
1202317915 Y:23600278-23600300 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202324049 Y:23671662-23671684 TGGATGGAGCAGACTGTGGAAGG - Intergenic
1202360102 Y:24099209-24099231 TGGCTGGAGCAGACCGTGGAAGG - Intergenic
1202510675 Y:25570905-25570927 TGGCTGGAGCAGACCGTGGAAGG + Intergenic
1202546722 Y:25998392-25998414 TGGATGGAGCAGACTGTGGAAGG + Intergenic
1202552851 Y:26069780-26069802 TGGCTGAAGCATAGTGTGGAAGG - Intergenic