ID: 1161621787

View in Genome Browser
Species Human (GRCh38)
Location 19:5301610-5301632
Sequence CTGGCTGTAAATGCATTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 144}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161621776_1161621787 30 Left 1161621776 19:5301557-5301579 CCACTCGCCTCAGCCTCCCAAAG 0: 846
1: 25445
2: 116744
3: 172216
4: 180160
Right 1161621787 19:5301610-5301632 CTGGCTGTAAATGCATTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 144
1161621779_1161621787 17 Left 1161621779 19:5301570-5301592 CCTCCCAAAGTGCCAGGATTACA 0: 1442
1: 26662
2: 318278
3: 258215
4: 140881
Right 1161621787 19:5301610-5301632 CTGGCTGTAAATGCATTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 144
1161621780_1161621787 14 Left 1161621780 19:5301573-5301595 CCCAAAGTGCCAGGATTACATGC 0: 9
1: 1217
2: 21866
3: 256856
4: 277181
Right 1161621787 19:5301610-5301632 CTGGCTGTAAATGCATTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 144
1161621781_1161621787 13 Left 1161621781 19:5301574-5301596 CCAAAGTGCCAGGATTACATGCA 0: 5
1: 630
2: 11357
3: 118226
4: 251980
Right 1161621787 19:5301610-5301632 CTGGCTGTAAATGCATTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 144
1161621782_1161621787 5 Left 1161621782 19:5301582-5301604 CCAGGATTACATGCATGAGCCTC 0: 1
1: 23
2: 1579
3: 3878
4: 4919
Right 1161621787 19:5301610-5301632 CTGGCTGTAAATGCATTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 144
1161621777_1161621787 23 Left 1161621777 19:5301564-5301586 CCTCAGCCTCCCAAAGTGCCAGG 0: 482
1: 9209
2: 104664
3: 223803
4: 244969
Right 1161621787 19:5301610-5301632 CTGGCTGTAAATGCATTTAATGG 0: 1
1: 0
2: 0
3: 17
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161621787 Original CRISPR CTGGCTGTAAATGCATTTAA TGG Intronic
901560515 1:10066483-10066505 TTGGATGTAAATGCATTTTTTGG + Intronic
902279252 1:15362408-15362430 CTGTCTGTAAGTGGATTTGATGG + Intronic
904962952 1:34349212-34349234 CAGGCTGAGAATGTATTTAATGG + Intergenic
908954388 1:69604393-69604415 CAAGCTGTAAATTCCTTTAAAGG - Intronic
910209804 1:84781499-84781521 CTGGCTGTAGATGTAGTTACTGG + Intergenic
910922427 1:92363443-92363465 GTGGCTGCAGATGCATTTATAGG + Intronic
912609162 1:111025520-111025542 GGGGCTGTAAATGAACTTAAAGG + Intergenic
917234461 1:172875446-172875468 TTGGCTATGAATGCATTGAAAGG + Intergenic
917379846 1:174393627-174393649 CTTGCTGTACATTCATTTCAGGG + Intronic
917638690 1:176961254-176961276 CTGGGTTTAAACGGATTTAAAGG + Intronic
918611789 1:186500669-186500691 CTGGCTCTTAAGGCATCTAAAGG + Intergenic
919591292 1:199506376-199506398 CAAGCTATAAATGCATTTATAGG + Intergenic
923193806 1:231644979-231645001 GTGGCTGAAAATCTATTTAAAGG - Intronic
923933048 1:238724625-238724647 GTGGCTTTAAATGTATTTATCGG - Intergenic
1064179889 10:13105293-13105315 CTTGGTGTATATGCATTGAAGGG + Intronic
1064861560 10:19831940-19831962 CTGGGTGTATATGCAGTAAAGGG - Intronic
1068680799 10:59817903-59817925 CTGGCTCTAAATGCGTGTGACGG - Intronic
1070083923 10:73216375-73216397 CTGAATGTAAATGCATTAAATGG - Intronic
1070417791 10:76206587-76206609 CTGGCTGTGAATGCCTTTTGTGG + Intronic
1073156992 10:101354704-101354726 CTGGATGCAGATGGATTTAAGGG + Intronic
1074296059 10:112190689-112190711 CTGGCTGGAAATGTCTATAACGG + Intronic
1074890886 10:117735751-117735773 CCAGCTGTAAATGGAGTTAACGG + Intergenic
1075036896 10:119077020-119077042 TTGGGAGTAAATGCGTTTAATGG + Intronic
1076281131 10:129247237-129247259 CTGGCTATGAATGCATCTGAAGG - Intergenic
1078463856 11:11535764-11535786 CTGGCAGGAAATGCATTTACTGG - Intronic
1078654730 11:13227848-13227870 CTGGCTGTCTATGCATGTCAGGG - Intergenic
1081813687 11:45927175-45927197 CTGGCTCTAAAAGTATTTGAAGG + Intronic
1084902661 11:72321480-72321502 CTGGCTGTGAGTGCATTTACAGG + Intronic
1086572170 11:88297634-88297656 CAGGCTGCAAGTGCATTCAAGGG + Intronic
1089278656 11:117356850-117356872 CTGGCTGTAATTGTAATTCATGG + Intronic
1091422352 12:352883-352905 GTGTATGTAAATGCATTCAAAGG - Intronic
1095823596 12:46507999-46508021 CTGACTGTAAATGCTTTGGAAGG - Intergenic
1098914386 12:76241832-76241854 AGGGCAGTAAATGCATTTATGGG - Intergenic
1099172256 12:79378848-79378870 TGGGCTGTAAATTCATCTAATGG - Intronic
1099673210 12:85721532-85721554 CTGGCGTTAAATATATTTAATGG + Intergenic
1099685164 12:85876948-85876970 TTGCCTGTAAATGTTTTTAAAGG + Intronic
1100558418 12:95721525-95721547 CTGTTTGTAAATGTATTCAAAGG - Intronic
1101547234 12:105726749-105726771 CTGACTGTATATACATATAAAGG - Intergenic
1107359788 13:39605768-39605790 CTGGCTGTGAAGTAATTTAATGG - Intergenic
1109073030 13:57793490-57793512 CTGTGTGTATATGCTTTTAAAGG - Intergenic
1110428508 13:75396758-75396780 GATGCTGTAAATACATTTAAGGG - Intronic
1110704782 13:78593297-78593319 CGTGCTTTAAATGCATTTACAGG + Intergenic
1112570148 13:100586801-100586823 TTTTCTGTAAATCCATTTAAGGG + Intronic
1113272505 13:108689389-108689411 ATGTCTGTATATGTATTTAAAGG - Intronic
1116184794 14:41584643-41584665 CTGACTTTATATGCAGTTAATGG + Intergenic
1120754489 14:88229603-88229625 ATGGCTGTGAATATATTTAAAGG - Intronic
1120766675 14:88333713-88333735 CTGGCTTTATATGAATTTTAAGG - Intergenic
1121788744 14:96682788-96682810 CTGGCTGTAAATGGTTCAAAAGG + Intergenic
1121982148 14:98463958-98463980 CTGGCTGTGAATGAATTTCGGGG - Intergenic
1125774579 15:42200456-42200478 CTGAAAGTAAAAGCATTTAAAGG - Intronic
1127266048 15:57362762-57362784 CTGGCTGTGGATGCTTTGAATGG + Intergenic
1127783744 15:62338438-62338460 CTGGCATTGAATGCATTTAGAGG - Intergenic
1131015222 15:89052289-89052311 CTGATTCTAATTGCATTTAATGG + Intergenic
1133936814 16:10276077-10276099 GTGGTAGTAAATGCATTCAAGGG - Intergenic
1136025147 16:27464134-27464156 CTGCCTGTAAATGCATTTCCAGG - Intronic
1136872284 16:33818391-33818413 CTGAATGTAAATGCAATTATTGG - Intergenic
1140033230 16:71354746-71354768 CCCTCTGTAAAGGCATTTAAAGG + Intergenic
1140859368 16:79005786-79005808 CTGGGTGGACATGCATTTTAGGG + Intronic
1141591262 16:85070376-85070398 CTGTCTCAAAATGCATTTATGGG + Intronic
1203099888 16_KI270728v1_random:1297677-1297699 CTGAATGTAAATGCAATTATTGG + Intergenic
1144068587 17:11646364-11646386 CTGACAGTAAAGGCAGTTAATGG - Intronic
1153404121 18:4716871-4716893 ATATCTGTAAATGCATTTGAGGG - Intergenic
1153518815 18:5932452-5932474 CTGACTGTTAATGTATTTAATGG + Intergenic
1155259232 18:24025312-24025334 TTGGCTTTAAATACATTAAAAGG + Intronic
1158360169 18:56663485-56663507 CTGTCTTTAAAAGCATTTAGGGG + Intronic
1159824281 18:73187778-73187800 AGGGATTTAAATGCATTTAAGGG - Intronic
1160123348 18:76149177-76149199 TTGGTTGTAAATGGATTTAAGGG + Intergenic
1161621787 19:5301610-5301632 CTGGCTGTAAATGCATTTAATGG + Intronic
1163456128 19:17406643-17406665 CTGGCTCTAAGTGGCTTTAATGG - Intronic
1163634220 19:18430966-18430988 CTGGCTGAACATGCGTTTGAGGG + Intronic
1167450116 19:49562441-49562463 CTGGCTCTAAATCATTTTAAGGG - Intronic
925542774 2:4984302-4984324 CTGGCTGAAGATGCATTTTAGGG - Intergenic
926299140 2:11589781-11589803 CCGGCTGGAAATGCCTTTGAAGG + Intronic
933112143 2:78416344-78416366 CTGGATTTGAATACATTTAAGGG - Intergenic
935877431 2:107526029-107526051 CTGGGTGTTAATGCATATATCGG - Intergenic
939035105 2:137121681-137121703 TTGGCTGTAAAGGCCCTTAAAGG + Intronic
942260600 2:174157897-174157919 CTGTGTGTTAATGCATTTAATGG - Intronic
942816902 2:180062651-180062673 TTGGCTTTAAATGCATTGTAAGG - Intergenic
944295899 2:198061893-198061915 CTGGCTGCAAATGTATTATAAGG + Intronic
947098688 2:226595123-226595145 CAGGCTGTGATTGCATTCAAAGG - Intergenic
947115231 2:226763033-226763055 TTTGTTGTAAAAGCATTTAAAGG - Intronic
947564917 2:231187598-231187620 CTGGGTGGAAATGAATTTTAGGG - Intergenic
1170424574 20:16226246-16226268 CAGGCAGTAAGTGCATTTCAGGG - Intergenic
1175783718 20:61699234-61699256 GTGGCTGTAAATGCATTTGGGGG + Intronic
1177240264 21:18446630-18446652 TGGGCTGTAAATGCATTTTGGGG - Intronic
1182477549 22:30584422-30584444 CTGGTAGTAAATGCCTTTGATGG + Exonic
1185420870 22:50733683-50733705 CTGTCTGTAAATGCAGCTGATGG + Intergenic
949470307 3:4388927-4388949 ATGGTTCTAAATGTATTTAAAGG - Intronic
953047705 3:39310140-39310162 CTGGCTGTAAAATAATTTAATGG + Intergenic
953196739 3:40741567-40741589 CTGCCTGTAAATGTTGTTAATGG - Intergenic
954649395 3:52151070-52151092 CTCGCTGGAAAGGCATTTTAAGG - Exonic
955618724 3:60837939-60837961 GTGGATGTAAATGCATGTAAAGG - Intronic
956142631 3:66161036-66161058 CTGGCTGTCACAGCTTTTAATGG + Intronic
956266484 3:67402244-67402266 ATGGCTTTAAATGTACTTAATGG + Intronic
956941883 3:74171919-74171941 CTGGCTGCAAAAACATATAACGG + Intergenic
957629515 3:82701194-82701216 CAGCCTGTTAATGCATTTTAAGG + Intergenic
958271910 3:91510605-91510627 CAAACTGTAAATTCATTTAAGGG - Intergenic
959028421 3:101269554-101269576 CAGGTTGAAAATGCATTTACTGG - Exonic
959552858 3:107683168-107683190 GTTACTGTAAATGCATTTAATGG + Intronic
963324810 3:143851062-143851084 CTGGCTGAAAAGCCATCTAAAGG - Intergenic
964715900 3:159721261-159721283 CTGTTTGTAAATGTATTTATTGG - Intronic
964718465 3:159747625-159747647 CTGGCTGTCTATGCTTTTCATGG + Intronic
966253903 3:177896760-177896782 CTGGGAGTAGATGCATTCAAGGG + Intergenic
971541358 4:27820845-27820867 CTGACTGTAATTGCATGAAAGGG + Intergenic
971820604 4:31549436-31549458 CTGCCAGTAAATTCATTTATTGG + Intergenic
973028033 4:45298810-45298832 GTGGTTCTAAATGAATTTAAAGG - Intergenic
975247553 4:72137591-72137613 CTGACTGTTTATTCATTTAAAGG + Intronic
975335711 4:73172971-73172993 CTGAATGTAAATGGACTTAAAGG + Intronic
978284862 4:107064384-107064406 CTCTCTGTAAATCCTTTTAATGG - Intronic
978593030 4:110346870-110346892 CTGGCTGTCAAGGCATTCAAAGG - Intergenic
978946300 4:114502026-114502048 CTGGCAGTAAATTCATAGAAAGG - Intergenic
980550363 4:134327616-134327638 CTGGTAGTAAATGCGTTTGATGG - Intergenic
980747373 4:137036050-137036072 CTGGCTGCGAATGTATTTAATGG + Intergenic
983611817 4:169654491-169654513 ATAGCTTTAAATGCACTTAAAGG - Intronic
984669475 4:182466143-182466165 CTGGGTTTTTATGCATTTAAGGG + Intronic
985053257 4:186013807-186013829 CAGGCTGTAAATGCAAAGAAAGG + Intergenic
985925550 5:3013209-3013231 CTTGTTGCAAATGCATTTATTGG - Intergenic
986966140 5:13274006-13274028 CTGACTATAAATACATTTTAAGG + Intergenic
987590141 5:19914268-19914290 ATTACTGTAAATGCATATAACGG - Intronic
987651111 5:20741019-20741041 TTGACAGTAAATGCATTTAATGG - Intergenic
988744450 5:34120439-34120461 TTGACAGTAAATGCATTTAATGG + Intronic
991942625 5:71867257-71867279 GTGGCAGTAAATGTATTTGATGG + Intergenic
994152858 5:96469017-96469039 CTGGCTAAAAACACATTTAATGG + Intergenic
994921806 5:106054833-106054855 CTGGCAGTAATAGCATTTGAAGG + Intergenic
995018416 5:107339867-107339889 AGGGCTGGAAATGAATTTAAGGG - Intergenic
997555952 5:134798837-134798859 CTGGCTGTATATACATACAATGG - Intronic
1000174424 5:158737067-158737089 CAGGCTGTAAAAGCATTTCACGG - Intronic
1002354617 5:178615638-178615660 CTCTCTCTAAATGCATTTCAGGG - Intronic
1006969427 6:38026170-38026192 CTGGATGTAAGTGTATTTAGGGG - Intronic
1008884064 6:56412160-56412182 CTGGATGGATATGAATTTAACGG - Intergenic
1011178449 6:84591055-84591077 CTTGCTGAAAATTCATTTTAGGG - Intergenic
1013569562 6:111408211-111408233 ATGGATGTAAATGCAATTTAAGG + Intronic
1017061072 6:150485473-150485495 CTGTCTGAAAATGCAGTTACTGG - Intergenic
1021662785 7:22936985-22937007 GTGGATATAAATGAATTTAAAGG + Intergenic
1023556229 7:41425796-41425818 CTGGATGCAAATACATTTCAGGG - Intergenic
1027939079 7:84649690-84649712 ATGGCCTTAAATGCATTTACAGG - Intergenic
1028165951 7:87538757-87538779 CTGGCTGATAATGGGTTTAATGG - Intronic
1029147339 7:98455752-98455774 CTGGGAGGAAATGCATATAATGG + Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1031555270 7:123167484-123167506 CTGCCTGTTAATGCATTCCATGG + Intronic
1034582699 7:152059396-152059418 CTGGCTATAAATGTTCTTAATGG + Intronic
1035007724 7:155680891-155680913 CTCACTGTAAATTCATCTAAAGG - Exonic
1035307621 7:157943387-157943409 TTGGCTGTCACTGAATTTAAAGG - Intronic
1035725214 8:1820365-1820387 CTGGCTGTAAAAGTCTTTTAAGG + Intergenic
1038511597 8:28141473-28141495 TTGGCTGTAAAGGACTTTAATGG + Intronic
1041352207 8:56958518-56958540 ATGGCTTTAAATGCATGAAAGGG + Exonic
1043127318 8:76415292-76415314 ATTACTGTACATGCATTTAATGG + Intergenic
1046050800 8:109020090-109020112 CAAGAGGTAAATGCATTTAATGG - Intergenic
1046950341 8:120014208-120014230 CTTGATGTAAATGCATTGCATGG - Intronic
1048654473 8:136520488-136520510 CTGGCTCTAAAAGCATTTTTGGG + Intergenic
1051141764 9:13986710-13986732 CTGGTAGTAAATGCCTTTGATGG - Intergenic
1056686904 9:88774047-88774069 CAGGCTGCAAAGGCATGTAAAGG - Intergenic
1057224405 9:93282162-93282184 GAGGCAGGAAATGCATTTAAAGG + Intronic
1058573688 9:106376901-106376923 CAGGGAGTAAATGCATTGAAAGG - Intergenic
1185819992 X:3193679-3193701 ATGGCTGTATATGCATCTCATGG - Intergenic
1186435764 X:9542135-9542157 TTGCCTGTAATTGCATTTGATGG + Intronic
1187068724 X:15866631-15866653 CTTGCTGTAAATGTATATACAGG + Intergenic
1190447479 X:50542586-50542608 CTGAATGTATATGCATATAAAGG + Intergenic
1191697890 X:64007886-64007908 CTGGTTGTAAATGCAAAGAATGG + Intergenic
1192269772 X:69567833-69567855 GTGGCTGCAAATGGATTTAGTGG + Intergenic
1198740546 X:139837272-139837294 TTGGCTGTAAATTCTTATAATGG - Intronic
1199307397 X:146282479-146282501 CTGGCTGTAAATGAATTCTTAGG + Intergenic