ID: 1161625114

View in Genome Browser
Species Human (GRCh38)
Location 19:5322016-5322038
Sequence CAGTTTACCCAAATGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 523}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161625114_1161625122 28 Left 1161625114 19:5322016-5322038 CCCATTTCCATTTGGGTAAACTG 0: 1
1: 0
2: 1
3: 52
4: 523
Right 1161625122 19:5322067-5322089 GAGGTCACACAGCCGGCAAGAGG 0: 1
1: 5
2: 78
3: 470
4: 1791
1161625114_1161625120 21 Left 1161625114 19:5322016-5322038 CCCATTTCCATTTGGGTAAACTG 0: 1
1: 0
2: 1
3: 52
4: 523
Right 1161625120 19:5322060-5322082 GTTGCCAGAGGTCACACAGCCGG 0: 1
1: 6
2: 57
3: 394
4: 1377
1161625114_1161625119 9 Left 1161625114 19:5322016-5322038 CCCATTTCCATTTGGGTAAACTG 0: 1
1: 0
2: 1
3: 52
4: 523
Right 1161625119 19:5322048-5322070 GAGGTTTCAACAGTTGCCAGAGG 0: 1
1: 0
2: 0
3: 17
4: 117
1161625114_1161625118 -10 Left 1161625114 19:5322016-5322038 CCCATTTCCATTTGGGTAAACTG 0: 1
1: 0
2: 1
3: 52
4: 523
Right 1161625118 19:5322029-5322051 GGGTAAACTGAGGCTCAGAGAGG 0: 7
1: 176
2: 1116
3: 3607
4: 8006

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161625114 Original CRISPR CAGTTTACCCAAATGGAAAT GGG (reversed) Intronic
900383882 1:2400382-2400404 CAGTTTTCCCATCTGTAAATGGG + Intronic
900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG + Intergenic
900687334 1:3957109-3957131 CAGTTTGCCCATCTAGAAATTGG + Intergenic
901151333 1:7104785-7104807 CAGTTTTCTCACATGTAAATGGG - Intronic
901825162 1:11856667-11856689 CAGTTTTCCCATTTGGAAAATGG + Intergenic
901837768 1:11935211-11935233 CAGTTTGCCCAGCTGGAAAACGG - Intronic
902450511 1:16493972-16493994 CAGTTTTCTCATCTGGAAATGGG - Intergenic
902502347 1:16919370-16919392 CAGTTTTCTCATCTGGAAATAGG + Intronic
902759899 1:18574386-18574408 CAGTTTACCCATCTGCAAATGGG + Intergenic
902790859 1:18766922-18766944 CAGTTTCCCCAACTAGAAAATGG - Intergenic
903008955 1:20317220-20317242 CAGTGTCCCCACATGGAAAGTGG + Intronic
903247263 1:22025281-22025303 CAGTTTGCCCAACTGCAAAATGG - Intergenic
903416547 1:23187392-23187414 CAGTTTACCCATCTGCAAAATGG + Intergenic
903474732 1:23611781-23611803 CAGTTTCCACAACTGGAAAATGG - Intronic
903480145 1:23647140-23647162 CAGTTTCCCCATCTGAAAATGGG + Intergenic
903654979 1:24943489-24943511 CAGTTTCCCCAACTGTAAGTGGG - Intronic
904393745 1:30204193-30204215 CTGCTTACCCGAATTGAAATTGG - Intergenic
904799342 1:33081677-33081699 CAGTTTCCCCAATTGTAAATGGG - Exonic
905001433 1:34672933-34672955 CAATTTACTCAAATGCAAAGTGG + Intergenic
905318812 1:37101159-37101181 CAGGTTACCCACGTGGAAAAGGG + Intergenic
905321121 1:37118042-37118064 CAGTTTTCCCAAATGTGAACTGG + Intergenic
905676439 1:39828854-39828876 CAGTTTTGCCATATGGAAAATGG + Intergenic
906172371 1:43737950-43737972 CAGTTTGCTCAACTGGAAAATGG - Intronic
906733424 1:48102409-48102431 CAGTTTTCTCAAATGTAAAATGG + Intergenic
906983590 1:50658001-50658023 CAATTTAACCAAATGCAATTGGG + Intronic
907063575 1:51456386-51456408 CATTTAACCCAAGGGGAAATGGG + Intronic
907219935 1:52899004-52899026 CAGTTTACACATCTGCAAATTGG - Intronic
907648249 1:56265962-56265984 AAGTTTACACAAATGGTAAGTGG - Intergenic
907910104 1:58817910-58817932 CAGTTTCCCCACCTGGAAAAAGG + Intergenic
909537017 1:76748348-76748370 CAGTGTAACCATATAGAAATGGG + Intergenic
910837415 1:91529730-91529752 CAGTTTCCTCATCTGGAAATGGG + Intergenic
911562135 1:99418621-99418643 CAGTCTACCCAAATGAGAAGGGG + Intergenic
912728599 1:112081092-112081114 CAGTTTACTCATCTGTAAATTGG - Intergenic
913095883 1:115514882-115514904 CCGCTTACCCAATTCGAAATTGG + Intergenic
913279959 1:117176220-117176242 CAGTTTCCCCACATGTAAAAAGG - Intronic
913658573 1:120985296-120985318 CTGTTTCATCAAATGGAAATGGG - Intergenic
914009937 1:143768416-143768438 CTGTTTCATCAAATGGAAATGGG - Intergenic
914397128 1:147280303-147280325 CAGTGTGCCCAAATGACAATAGG - Intronic
914523185 1:148436540-148436562 CTGTTTCATCAAATGGAAATGGG - Intergenic
914648558 1:149677077-149677099 CTGTTTCATCAAATGGAAATGGG - Intergenic
914812507 1:151039151-151039173 TAGTTTCCTCAAATGGAACTTGG + Intronic
915784249 1:158590783-158590805 ATGTTTAGCTAAATGGAAATGGG + Intergenic
915847509 1:159283006-159283028 AATTTTACGCAAATGGAATTAGG + Intergenic
917034907 1:170737770-170737792 CAGTTTACCCATTTGTAAAATGG + Exonic
918239397 1:182608692-182608714 GAGTTTACTCAAATGTAAAATGG - Intergenic
919905978 1:202078528-202078550 TAGTTTCCCCATATGGAAAATGG - Intergenic
920395427 1:205642096-205642118 CAGTTTACAGAAAAGGAAACAGG - Intergenic
921551235 1:216537770-216537792 CAGTTTCCTCAAATGTAAAGTGG - Intronic
921574861 1:216822993-216823015 GAGTTTACCCAATTAGAAAAGGG + Intronic
921705531 1:218318709-218318731 CACTTTAACCAAGTGGAAACTGG - Intronic
922029143 1:221781291-221781313 CAGTTTCCCCAAAGTGAACTGGG - Intergenic
922194353 1:223346657-223346679 CAGTTTCCTCATATGAAAATAGG + Intronic
922384177 1:225065001-225065023 CAGTTTCCTCAAAGGTAAATTGG + Intronic
922845679 1:228682202-228682224 CTGTTTACCCGATTTGAAATTGG + Intergenic
1064248632 10:13690069-13690091 CAGTTGACCCAACTGGACACTGG + Intronic
1065353528 10:24816860-24816882 CATTTTACACAAGTGGAAACAGG - Intergenic
1065513273 10:26500763-26500785 CAGTTTTTCCAGATGCAAATAGG + Intronic
1068360287 10:55968602-55968624 CAGTTTACAGAAAAGTAAATAGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1068773814 10:60850541-60850563 CAGTTTTCCCAACTGTAAAAGGG + Intergenic
1069777962 10:70937807-70937829 CAGTTTACAGATAAGGAAATAGG - Intergenic
1069894799 10:71673714-71673736 CAGTTTCCCCATCTGTAAATTGG + Intronic
1069894936 10:71674645-71674667 CAGTTTCCCCATCTGTAAATTGG - Intronic
1070993732 10:80756263-80756285 AAGTTGACCAATATGGAAATTGG + Intergenic
1071133094 10:82418444-82418466 CAGTTTATGCAAATGAAAAGAGG + Intronic
1071498391 10:86186620-86186642 CAGTTTTCCCATCTGGAAAATGG + Intronic
1072127822 10:92462745-92462767 CAGTTTCCTCATCTGGAAATTGG + Intronic
1072273108 10:93796512-93796534 CAGTTTACTCATGTGGAAAAAGG + Intronic
1072322618 10:94265350-94265372 CAGTTTATCCAGGTGAAAATGGG - Intronic
1072454238 10:95561789-95561811 CAGTTTACCCATCTGTAAAATGG + Intergenic
1072734341 10:97868975-97868997 CAGTTTCCCCATATGTAAAATGG - Exonic
1072848559 10:98860567-98860589 CAGTTTCCCCATCTGTAAATGGG - Intronic
1074181737 10:111071242-111071264 CAGTTTCCTCATATGGAAAAAGG - Intergenic
1074211392 10:111338525-111338547 CATTTTACACATATGGAAATTGG - Intergenic
1074887258 10:117703939-117703961 CAGTTTTCTCAACTGGAAAGAGG + Intergenic
1077674816 11:4186841-4186863 CAGTTTTCCCATATGTAAAATGG + Intergenic
1078260461 11:9701975-9701997 CAGATTCCCCAATTGGAACTTGG - Intronic
1078595699 11:12684615-12684637 CAGTTTCCCCATCTGGAAAATGG + Intronic
1078845036 11:15112917-15112939 CAGTTTTCCCATATGTACATTGG - Intronic
1078979030 11:16510846-16510868 CAGTTTACCCACATGGAAAATGG - Intronic
1079006384 11:16794243-16794265 CAGTTTTCCCAACTGCAAAATGG + Intronic
1079322820 11:19465766-19465788 CAGTTTCCCCAACTGTAAAAAGG - Intronic
1079567276 11:21898387-21898409 CAGATTCCTCAAATGAAAATGGG + Intergenic
1080026757 11:27623242-27623264 CAGTTTCCTCATCTGGAAATAGG + Intergenic
1080062088 11:27967688-27967710 CAGTCAACCCCATTGGAAATAGG - Intergenic
1080348630 11:31355971-31355993 CGGTATATCCAAAAGGAAATGGG + Intronic
1080886697 11:36374772-36374794 CAGTTTACTCATATGAAAATGGG - Intronic
1081495961 11:43610560-43610582 CAGTTTCCCCATATGCAAAATGG + Intronic
1081574792 11:44312146-44312168 CAGTCTACCCATATGCAAAATGG - Intergenic
1083623205 11:64059059-64059081 CAGTTTCCCCCAGTGCAAATTGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084448178 11:69216482-69216504 CAGTTTTCCCATATGCAAAATGG + Intergenic
1085197051 11:74679139-74679161 CAATTTTCCCATCTGGAAATTGG - Intergenic
1085215443 11:74826688-74826710 CAATTTCTCCCAATGGAAATCGG - Intronic
1085780646 11:79405310-79405332 CAGTTTCCCCCACTGAAAATTGG - Intronic
1085878314 11:80435386-80435408 CAGTTTACTCAGTTGTAAATGGG + Intergenic
1085973743 11:81625618-81625640 TAGTTTACCAAAACGTAAATAGG + Intergenic
1086017661 11:82186413-82186435 CAGTTTTCTCATATGGCAATAGG - Intergenic
1086814919 11:91358202-91358224 CATTTTTCCCAAAAGAAAATGGG - Intergenic
1086828661 11:91532444-91532466 CAATTTACAGAAGTGGAAATGGG + Intergenic
1087195501 11:95300624-95300646 CAGTTTACCCATCTGTAAAATGG - Intergenic
1087805451 11:102550837-102550859 CAGTTTTCCCAACTGCAAAATGG - Intergenic
1088846802 11:113675133-113675155 CAGTTTAGCCACATGCAAAGGGG + Intergenic
1090788168 11:130068730-130068752 CAGTTTACCCACAGGGAACTGGG + Intergenic
1093148810 12:15598110-15598132 CAATTTTCCCAAAAGGAAAGAGG + Intergenic
1093987181 12:25548571-25548593 CATTTTCCACAAATGCAAATGGG - Intronic
1094170838 12:27490119-27490141 CAGTTTATCCAAATGACAACTGG - Intronic
1094346897 12:29480300-29480322 CAATTTTCCCATTTGGAAATGGG - Intronic
1094518108 12:31154556-31154578 CAGTCTAACCAAATTGAATTAGG + Intergenic
1094544617 12:31392970-31392992 CAGTTTCCTCAACTGAAAATAGG + Intronic
1097032946 12:56102670-56102692 CATTTTACACAAAGGGAAGTCGG + Exonic
1098392034 12:69979733-69979755 CAGTTTATCCAAATATAAAATGG - Intergenic
1099401962 12:82211306-82211328 TTGGTTACCCAACTGGAAATAGG - Intergenic
1099748392 12:86737161-86737183 TAGTTGACCCAAAAGAAAATAGG - Intronic
1100385807 12:94103696-94103718 CAGTTTTCCCAAAGGTAAAATGG + Intergenic
1101584528 12:106073480-106073502 CAGTTTACCCACCAGAAAATGGG + Intronic
1101844100 12:108348782-108348804 CAGTTTACCCATATGCAAAATGG - Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1101921272 12:108935088-108935110 CTGTCTACCCAACTGGCAATAGG + Intronic
1101953039 12:109191088-109191110 CAGTTTCCTCATATGGAAAATGG - Intronic
1103419621 12:120769932-120769954 AAATTCACCCAAATGGAAACTGG - Intronic
1103881266 12:124167604-124167626 CAGTTTCCCCAACTGCAAATGGG + Intronic
1104919009 12:132280908-132280930 CAGTTTCCCCATATGTAAAATGG + Intronic
1105589382 13:21776850-21776872 CAGTGTTCCCACATGGAAAGGGG - Intergenic
1106259867 13:28056951-28056973 CATTTTACCAATAAGGAAATCGG + Intronic
1106358575 13:29008459-29008481 CAGATGAACCAAAAGGAAATGGG - Intronic
1106968306 13:35101747-35101769 CAGACAACCCAAATGAAAATTGG - Intronic
1106973685 13:35178839-35178861 CAGTTTAACCATTTAGAAATGGG + Intronic
1109706083 13:66094505-66094527 CACTGTACCCAACTGGACATAGG - Intergenic
1111581458 13:90228901-90228923 CAATTTACCAAGAAGGAAATGGG - Intergenic
1111951100 13:94710340-94710362 CAGTTTACAAAAAAGGAAAAAGG - Exonic
1112754554 13:102616861-102616883 CATTTTACACAAATCAAAATAGG - Intronic
1114221463 14:20701383-20701405 CCGCTTACCCAATTTGAAATGGG - Intergenic
1114853406 14:26408225-26408247 CAGTTTACCCCATTGGAGAATGG + Intergenic
1115218998 14:31040736-31040758 CAGTTTACCAAAATGGCTTTAGG + Intronic
1115853261 14:37603908-37603930 CAGTTTTCCCAACTGTAAAATGG + Intronic
1115855230 14:37623028-37623050 CATTTTTCCCAAATGCAATTTGG + Intronic
1117613403 14:57507284-57507306 CAGTTTACTCAAGTGTAAAATGG + Intergenic
1117896879 14:60496362-60496384 CTATTTACCCAAAGGGAAAGTGG - Intronic
1118412564 14:65496962-65496984 CAGTTTCCTCAACTGCAAATTGG + Intronic
1118737927 14:68715651-68715673 CAGTTTACCCAACCATAAATTGG - Intronic
1118941901 14:70346477-70346499 CAGAGGACCCCAATGGAAATTGG + Intronic
1119159792 14:72443261-72443283 CAGTTTACCCATCTGCAAAATGG - Intronic
1119182990 14:72616911-72616933 CAGTTTCCCCATCTGGAAAGCGG - Intergenic
1119760219 14:77145406-77145428 CAGTTTCCCCATAAGGAAAATGG - Intronic
1120296555 14:82648731-82648753 CAAAATACCCAAAAGGAAATGGG - Intergenic
1121091606 14:91186845-91186867 CAGTTTTCCCACATGGAGAATGG - Intronic
1121351198 14:93174520-93174542 CAGTTTCCTCAACTGAAAATGGG - Intergenic
1122454653 14:101841111-101841133 CAGTTTTCTCAACTGGAAAATGG - Intronic
1122765884 14:104069582-104069604 CAGTTTATGAAAATGGAAAGAGG - Intergenic
1124206447 15:27724830-27724852 CAGTTTTCTCATATGTAAATTGG - Intergenic
1126268358 15:46781722-46781744 CAGTTTACCCAAATACAGAAAGG - Intergenic
1126344537 15:47678875-47678897 CAGTTTATCCATCTGGAAATGGG - Intronic
1126872022 15:52999926-52999948 CAGTTTACAGAAAAGGAAACTGG + Intergenic
1126917244 15:53479446-53479468 CAGTTTACTCAACTGTAAAATGG + Intergenic
1127295323 15:57604156-57604178 CAGTGTTCCCCAATGGAAGTAGG + Intronic
1127338050 15:58009806-58009828 CAGTTTACAAAAGTGGAAAGAGG - Intronic
1127662117 15:61109795-61109817 CAGTTTCCCCATCTGTAAATGGG + Intronic
1127817420 15:62623740-62623762 CAGTAAAACCAAAGGGAAATAGG - Intronic
1128040777 15:64571581-64571603 CAGTTTACCCATATGTAAAATGG - Intronic
1128536836 15:68498012-68498034 CAGTTTACCCACCTGTAAAATGG - Intergenic
1128600085 15:68988694-68988716 CTGCTTACCCAATTTGAAATTGG - Intronic
1128788698 15:70416793-70416815 CAGTTTTTCCAACTGGAAAACGG + Intergenic
1128891690 15:71337506-71337528 AAGTTGTCCCAAATGGAAACTGG + Intronic
1129509117 15:76107489-76107511 CAGTTTGCTCATATGGAAAATGG - Intronic
1129645284 15:77424451-77424473 CAGTTTTCCTAAATCCAAATGGG + Intronic
1129880331 15:79002418-79002440 CAGTTTACCCACGTAGAAAGTGG + Intronic
1130857409 15:87853018-87853040 CAGTTTTCTCAATTGGAAAATGG + Intergenic
1131119690 15:89814617-89814639 CAGTTTACCCATCTGGGAAGAGG + Intronic
1131431134 15:92390288-92390310 CAGTTTCCTCAAATGTAAAAGGG + Intergenic
1131997436 15:98145829-98145851 CAATTAACCCACAAGGAAATTGG + Intergenic
1132871373 16:2117143-2117165 CAGTTTCCCCATCTGGAAAGGGG - Intronic
1133881500 16:9786790-9786812 CAGTTTCCTCATATGTAAATAGG + Intronic
1133973222 16:10581420-10581442 CAGTTTCCCCATCTGGAAACTGG + Intergenic
1134521154 16:14919751-14919773 CAGTTTCCCCATCTGGAAAGGGG + Intronic
1134550417 16:15136221-15136243 CAGTTTCCCCATCTGGAAAGGGG - Intronic
1134685782 16:16157265-16157287 CAGTTTTCCCATCTGTAAATTGG - Intronic
1134708830 16:16318402-16318424 CAGTTTCCCCATCTGGAAAGGGG + Intergenic
1134716041 16:16358436-16358458 CAGTTTCCCCATCTGGAAAGGGG + Intergenic
1134784583 16:16930199-16930221 CAGTTTCCCCATATGAATATGGG - Intergenic
1134822735 16:17259665-17259687 CAGTTTCCCCATCTGGAAATAGG + Intronic
1134892252 16:17851472-17851494 CTGTTTACCCACCTGGAAATGGG + Intergenic
1134950775 16:18350243-18350265 CAGTTTCCCCATCTGGAAAGGGG - Intergenic
1134958715 16:18393723-18393745 CAGTTTCCCCATCTGGAAAGGGG - Intergenic
1135277420 16:21125587-21125609 GAGAATACCCAAATGGAAAGGGG + Intronic
1135323582 16:21512415-21512437 CAGTTTCCCCAGCTGTAAATTGG + Intergenic
1135802450 16:25510549-25510571 CAGTTAACTCAACTTGAAATAGG + Intergenic
1135905807 16:26510758-26510780 CAGTTTCCTCATCTGGAAATGGG + Intergenic
1136396711 16:29996447-29996469 CAGTTTACCCAGGTGTAAAGTGG + Intronic
1137707837 16:50548028-50548050 CAGTTTCCCCACCTGTAAATTGG + Intergenic
1137719548 16:50620032-50620054 CAGTTTCCCCATCTGGAAAATGG + Intronic
1137768800 16:50998026-50998048 CAGTTTCCCCAACTGCAAAATGG - Intergenic
1138431214 16:56970320-56970342 CAGTTTACCCATATGTAAAAAGG - Intronic
1138467454 16:57201994-57202016 CAGTTTACTCATTTTGAAATAGG + Intronic
1139863921 16:70049594-70049616 CAGTTTACGTAAATGTAAACTGG + Intergenic
1140507095 16:75480400-75480422 CAGTTTACCCATCTGCAAAAGGG + Intronic
1141318263 16:82982133-82982155 CAGTTTACCCAACTATAAAATGG + Intronic
1141497773 16:84421774-84421796 CAGTTTCCCCATATGCAAAATGG + Intronic
1142035787 16:87861503-87861525 CAGTTTCCCCAGCTGTAAATTGG + Intronic
1142150411 16:88510159-88510181 CAGTTTACCCATATGGAGAAGGG - Intronic
1142405004 16:89883614-89883636 CAGGTAACCAAAATGGAACTCGG - Intronic
1142471936 17:169652-169674 CAGTTTGCCCATCTGTAAATAGG - Intronic
1143047370 17:4092659-4092681 CAGTTAACCCTAATGGGAAACGG + Intronic
1145899897 17:28483731-28483753 CAGTTTCCTCATCTGGAAATGGG - Intronic
1146023601 17:29300159-29300181 CATTTTATATAAATGGAAATTGG + Intergenic
1146487087 17:33251700-33251722 CAGTTTCCCCATATGCAAAGTGG - Intronic
1146846480 17:36184283-36184305 CAGTTTGCCCATCTGTAAATAGG + Intronic
1146920481 17:36706855-36706877 CAGTTTCCCCATCTGTAAATTGG + Intergenic
1146931729 17:36782655-36782677 CAGTTTCCCCACATGCAAAAGGG + Intergenic
1147301721 17:39534489-39534511 CAGTTTATAAAAATGGAAAGTGG + Exonic
1147848988 17:43426728-43426750 CAGTTTACTCAACTGTAAATTGG - Intergenic
1148483069 17:47972813-47972835 CAGTTTTCCCACATGTAAAATGG - Intronic
1148826642 17:50398771-50398793 CAGTTTACTCATTTTGAAATAGG + Intergenic
1149030507 17:52077807-52077829 TGGTTTAGCCCAATGGAAATCGG - Intronic
1149033968 17:52114431-52114453 CAGTTTGCCCAGTTGTAAATGGG + Intronic
1149080758 17:52654312-52654334 CAGCTTACAGAAAGGGAAATGGG + Intergenic
1150286173 17:63955493-63955515 CAGTTTTCCCATCTGGAAAACGG - Intronic
1150301646 17:64052316-64052338 CAGTTTACCAAAATTAAAAAGGG + Intronic
1150541942 17:66110400-66110422 CAATTGAACCAACTGGAAATTGG + Intronic
1150921257 17:69486006-69486028 AAGTTTACATAAATGGAAATAGG - Intronic
1151336798 17:73444628-73444650 CAGTTTCCCCATCTGTAAATTGG - Intronic
1151431003 17:74063169-74063191 CAGTTTTCTCACCTGGAAATGGG + Intergenic
1151615001 17:75204284-75204306 CAGTTAATCCTAATGGAAAACGG + Intergenic
1151624185 17:75266436-75266458 CAGTTTACCCATCTGTAAAATGG - Exonic
1153496553 18:5705204-5705226 TAATTTTCCCAAATGGAACTAGG - Intergenic
1153661932 18:7333204-7333226 CATTTTACCCACATGGGAAGTGG - Intergenic
1153730384 18:8005520-8005542 CAGTTTACCCATCTGTAAAATGG - Intronic
1153758283 18:8305493-8305515 CAGTTTCCCCAACTGTAAAATGG - Intronic
1154946773 18:21169748-21169770 TATGTTAACCAAATGGAAATAGG + Intergenic
1155882903 18:31172103-31172125 CAGTTAACACAAATGTAAAGTGG - Intergenic
1156575178 18:38306442-38306464 CAGTTTACAAAAATAGAAATAGG + Intergenic
1156707989 18:39907145-39907167 CAGATTACCCAAATGAATCTGGG - Intergenic
1156830463 18:41485199-41485221 CAGTTTACCCACTTGTAAAATGG - Intergenic
1156952575 18:42920369-42920391 CAGTTGACTCATATGTAAATAGG + Intronic
1157331742 18:46708984-46709006 CAGTTTTCCCATCTGGAAAATGG + Intronic
1157410343 18:47457944-47457966 CAGTTTACTCATCTGGAAATCGG + Intergenic
1157832810 18:50872769-50872791 CAGTTTTCCCATATGTAAAATGG + Intergenic
1160691227 19:461368-461390 CAGTTTCCCCACTAGGAAATAGG - Intergenic
1160940651 19:1619058-1619080 CAGTTTCCCCAACTGGAACCAGG + Intronic
1161109731 19:2462447-2462469 CAGTTTTCCATAATGGAAATGGG - Intergenic
1161225600 19:3143795-3143817 GAGTTTCCCCACATGGAAACAGG + Intronic
1161625114 19:5322016-5322038 CAGTTTACCCAAATGGAAATGGG - Intronic
1161760440 19:6167312-6167334 CAGTTTGCCCAACTGTAAAATGG + Intronic
1161965140 19:7543573-7543595 CAGTTTCCCCATATGGACAGTGG - Intronic
1162079787 19:8210950-8210972 CAGTTTACCCATCTGTAAAATGG + Intronic
1162261786 19:9539893-9539915 CTGCTTACCCAATTTGAAATTGG - Intergenic
1162312689 19:9916480-9916502 CAGTTTCCTCACCTGGAAATAGG - Intronic
1162389290 19:10379678-10379700 CAGTTTCCCCATCTGGAAAAGGG + Exonic
1162405922 19:10473778-10473800 CAGTTTCCCCAAGTGTAAAAGGG + Intergenic
1162532690 19:11245030-11245052 CAGTTTCCCCATCTGGAAAATGG + Intronic
1162835587 19:13315408-13315430 CAGTTTTCTCAAAGGGAAAGTGG + Intronic
1162843381 19:13372554-13372576 AAGGTTACCCAACTGGAAAGTGG - Intronic
1162851623 19:13435455-13435477 CAGTTTCCCCATCTGAAAATTGG - Intronic
1163481111 19:17556607-17556629 CAGTTTTCTCAAATGGAAAATGG + Intronic
1163566082 19:18052111-18052133 CAGTTTCCCCACCTGGAAAGCGG + Intergenic
1163665550 19:18602277-18602299 CAGTTTCCCCATCTGGAAAGTGG + Intronic
1163760763 19:19135195-19135217 CAGTTTTCTCATCTGGAAATGGG + Intronic
1164202708 19:23031690-23031712 CAGCTTACCCAATTTGAAATTGG + Intergenic
1165321716 19:35089493-35089515 CTGTTTTCCCAAATGTAAAGTGG - Intergenic
1166175755 19:41068355-41068377 CAGTTTCCCCATCTGGAAAATGG + Intergenic
1166568415 19:43779086-43779108 CAGTTTCCCCATCTGTAAATTGG - Intronic
1167630711 19:50624960-50624982 CAATTTACCCACTAGGAAATGGG - Intronic
1167900619 19:52619077-52619099 CATTTTAACCAAATGGTTATGGG + Intronic
1167929112 19:52849228-52849250 CATTTTAACCAAATGGTTATGGG + Intronic
1167992892 19:53375733-53375755 CATTTTAACCAAATGGTTATGGG - Intronic
1167995893 19:53402028-53402050 CATTTTAACCAAATGGTTATGGG - Intronic
925383508 2:3445628-3445650 CAGTTTCCCCATCTGTAAATTGG - Intronic
925875729 2:8309758-8309780 CAGTTTCCTCACATGAAAATGGG + Intergenic
926291817 2:11537451-11537473 CAGTTTCCCCAACTGAAAAATGG - Intronic
926621932 2:15054484-15054506 CAGTTTCCTCAACTGGAAAGCGG - Intergenic
926695399 2:15767072-15767094 CAGTTTCCCCAAGTGTAAATGGG + Intergenic
926955858 2:18299089-18299111 CAGTTTAACCAAATTGAAAAAGG + Intronic
927555652 2:24029646-24029668 CAGTTTACCAAGATGGAGCTGGG - Exonic
927721096 2:25382874-25382896 CATTTTACCCATGAGGAAATAGG - Intronic
928177112 2:29042006-29042028 CAGTTTACCCAACTATAAAATGG - Intronic
929419098 2:41772877-41772899 CAGTTTACCCATCTGTAAAATGG + Intergenic
930171594 2:48257108-48257130 CAGGTTACACCAATGGAATTTGG - Intergenic
930459301 2:51650953-51650975 CAGTTTTCTCATATGTAAATAGG - Intergenic
930608811 2:53518921-53518943 CAGTTTTCCCATATGCAAATGGG - Intergenic
931465810 2:62485975-62485997 CTGCTTACTAAAATGGAAATGGG - Intergenic
932064709 2:68542461-68542483 CAAATTACCCAATTTGAAATTGG + Intronic
932066231 2:68564655-68564677 CAGTTTTCCCACATGTAAAAGGG - Intronic
932783566 2:74579560-74579582 CAGTTTTCTCATATGGAAAATGG + Intronic
932824505 2:74927133-74927155 CAGTTTACCTCAATAGCAATGGG + Intergenic
934732318 2:96667201-96667223 CAGCTTTCCCATATGAAAATGGG + Intergenic
935188231 2:100753624-100753646 CAGTTTACCCATATGCAACAAGG - Intergenic
935979511 2:108613083-108613105 CAGTTTCCCCATCTGTAAATGGG + Intronic
936024248 2:109019184-109019206 CAGTTTCCCCATTTGAAAATGGG + Intergenic
936822059 2:116534199-116534221 CAGTTTCCCCATCTGTAAATTGG + Intergenic
936870584 2:117131133-117131155 CCGCTTACCCAATTTGAAATTGG - Intergenic
937000779 2:118465347-118465369 CAGTTTACTCATCTGGAAAATGG + Intergenic
937077750 2:119119236-119119258 CAGTTTTCTCATCTGGAAATGGG - Intergenic
937301565 2:120845921-120845943 CAGTTTTCCCATCTGTAAATTGG - Intronic
937772931 2:125743280-125743302 CAGTTCACCCATATGGATTTTGG + Intergenic
939525981 2:143295042-143295064 CAGTTTCCCCAACTGTAAAATGG - Intronic
939577807 2:143917236-143917258 CATTTTACATAAAAGGAAATAGG - Intergenic
941367170 2:164622219-164622241 CATTTTACACAAAAGGAAACTGG + Intergenic
941371419 2:164669783-164669805 CAGTTTACTCATCTGTAAATGGG + Intronic
942445841 2:176078561-176078583 CAAGTTACCAAAATGAAAATCGG + Exonic
943404122 2:187457973-187457995 TAGTTTACTCCACTGGAAATTGG + Intergenic
944897607 2:204181041-204181063 CATTTTACACACAGGGAAATAGG + Intergenic
945279126 2:208018748-208018770 TAGTTTATCCAAATGGCAATAGG - Intronic
945296307 2:208174617-208174639 CAATTTCCCCATATGTAAATAGG - Intronic
945420473 2:209630006-209630028 CTGTTTGACCAAATGGAGATAGG + Intronic
946401379 2:219470220-219470242 CAGTTTCCCCATCTGTAAATGGG - Intronic
946657970 2:221969502-221969524 CTGTTTACCTTAATTGAAATAGG + Intergenic
947000540 2:225450608-225450630 CAGTTTCCTCAACTGTAAATGGG + Intronic
947840732 2:233206153-233206175 CAGTTTACCCATCTGTAAAAAGG + Intronic
948610843 2:239165763-239165785 CATTTTACCCAAATTGTAAAAGG - Intronic
949049545 2:241890090-241890112 CAGTATAACCAAATGGCACTAGG + Intergenic
1168811420 20:707023-707045 CAGTTTACCTACATGTAAAATGG + Intergenic
1168833209 20:858820-858842 CAGTTTCCCCATATGTACATGGG - Intergenic
1168839056 20:897358-897380 CCGTTTACTCAATTTGAAATTGG - Intronic
1168984769 20:2038719-2038741 CAGTTTCCCCATCTGGAAAATGG + Intergenic
1169882497 20:10362426-10362448 CAGTTTAACCAGATGCCAATGGG - Intergenic
1170202141 20:13756178-13756200 CAGTTTATTCATATGGAAATTGG - Intronic
1170309575 20:14977580-14977602 CAGTTTCCTCAGCTGGAAATTGG + Intronic
1170790653 20:19506577-19506599 CAGCTTACCCATCTGTAAATTGG + Intronic
1171095039 20:22324818-22324840 CAAGTTAACCAACTGGAAATTGG + Intergenic
1172788217 20:37484436-37484458 TAGATTACCAAAAGGGAAATTGG - Intergenic
1173817953 20:46002038-46002060 CAGTTTCCTCATCTGGAAATGGG + Intergenic
1174237470 20:49105685-49105707 CAGTTTTCACTAATGAAAATTGG + Intergenic
1174403935 20:50291802-50291824 CAGTTTACCCATCTGGTAAATGG - Intergenic
1174884629 20:54319681-54319703 CAGTTAACCCAGATGAAAACAGG + Intergenic
1175220203 20:57412327-57412349 CAGTTTGCTCAACTGGAAAGTGG - Intergenic
1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG + Intergenic
1176880395 21:14185436-14185458 TAAGTTACCCAAATGGAAATGGG - Intronic
1176903530 21:14472907-14472929 CAGTTTATTCAAATGTAAAGGGG - Intergenic
1178584789 21:33862797-33862819 GAGTTTCCCCAATAGGAAATGGG + Intronic
1179213409 21:39346813-39346835 CAGTTTTCCCAAAAGGAAAAAGG - Intronic
1179302743 21:40127397-40127419 CAGATTACCAAAATGGAATGTGG - Intronic
1180153197 21:45963021-45963043 CAGTTTACCCACCTGTAAAATGG - Intergenic
1181141578 22:20809272-20809294 CAGTTTCCCCATATGTAAACTGG + Intronic
1181336925 22:22142877-22142899 GGGTTTACCAAAATGCAAATGGG + Intergenic
1181921114 22:26321206-26321228 CAGTTTACTCATCTGGAAAATGG - Intronic
1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG + Intronic
1182316178 22:29448862-29448884 CAGTTTCCCCATCTGTAAATTGG + Intergenic
1182327838 22:29527473-29527495 TTTTTTACACAAATGGAAATAGG - Intronic
1182353046 22:29709559-29709581 CAGTTTCCCCATCTGGCAATGGG + Intergenic
1182806959 22:33080834-33080856 CAGTTTACCCATCTGTAAAATGG + Intergenic
1182958760 22:34452565-34452587 CAGTTTACTCATCTGTAAATTGG + Intergenic
1183138969 22:35918017-35918039 CAGTTTCCCCAAATGTAAAACGG + Intronic
1183229869 22:36575090-36575112 CATTTTACAGAAAAGGAAATTGG - Intronic
1183393176 22:37557277-37557299 CAGCTTACCCAGATGTAAAAGGG + Intergenic
1183592408 22:38787546-38787568 CAGTTTTCTCATCTGGAAATTGG + Intronic
1184566212 22:45293636-45293658 CAGTTTCCCCATCTGGAAAATGG + Intronic
949221599 3:1640730-1640752 CATTTTACAGAAATGGAAAAAGG + Intergenic
949601731 3:5606469-5606491 CAGTTTCCCCAACTGTAAAATGG - Intergenic
949761793 3:7479041-7479063 CAGTGTACCCATATGTAAAGTGG + Intronic
950107088 3:10395052-10395074 CAGTTTCCCCAGCTGCAAATTGG + Intronic
950450486 3:13062395-13062417 CATTTTACAGAAAAGGAAATAGG + Intronic
950673138 3:14539156-14539178 CAGTTTCCCCAACTGCAAAATGG + Intronic
950675509 3:14551860-14551882 CAGTTTCCTCAACTGCAAATGGG + Intergenic
950678558 3:14569343-14569365 CAGTTTCCCCAACTGTAAAATGG - Intergenic
951208565 3:19949085-19949107 GAGTTTGCCCAGACGGAAATTGG + Intronic
951593618 3:24293655-24293677 CAGTTCATTCAAATGGAATTTGG + Intronic
951987845 3:28640700-28640722 CAGTTTCTCCATATGTAAATTGG + Intergenic
953340879 3:42133177-42133199 CATTTTATCCAAAGGGCAATGGG - Intronic
954704662 3:52473019-52473041 CAGTTTCCCCAACTGTAAAATGG - Intronic
954785479 3:53089474-53089496 CACTTTACCCAAGTGGATTTGGG - Exonic
955509868 3:59668829-59668851 CATTTTTCCCAAATGCAAAAAGG + Intergenic
955511988 3:59690571-59690593 CAATTTACCCACATGCAGATGGG + Intergenic
955580302 3:60412631-60412653 CAGTTTGCCCATCTGCAAATGGG - Intronic
957327124 3:78710613-78710635 CAGTTGACCCATATGTAAAATGG - Intronic
957549325 3:81683545-81683567 CTTTTTACTCAAATGAAAATAGG + Intronic
958408871 3:93788125-93788147 TAGTTTCTCCAAATGGATATTGG - Intergenic
958938920 3:100288510-100288532 CAGTTTTCCCATCTGTAAATTGG + Intronic
959108357 3:102092207-102092229 CAGTTTAACTAAATGGTGATGGG - Intergenic
959486448 3:106932614-106932636 CAGGTTGCAGAAATGGAAATGGG - Intergenic
959709141 3:109367486-109367508 CAGTTTACTCATCTGCAAATAGG + Intergenic
959740979 3:109719337-109719359 CAGTTTTCCCATTTGCAAATGGG - Intergenic
960147321 3:114217189-114217211 CAGTTATCCCAAATGCAAAATGG + Intergenic
961099481 3:124186364-124186386 CAGCATTCCCAAATGTAAATAGG + Intronic
961712989 3:128841449-128841471 CCGCTTACCCAATTTGAAATTGG + Intergenic
962187501 3:133275188-133275210 TAGTTTCCCCAATTGAAAATGGG + Intronic
963784641 3:149521860-149521882 CAGTTTACCCATCTAGAAATTGG + Intronic
964821475 3:160775135-160775157 CAGTTTCCCCAACTGTAAAATGG - Intronic
966394235 3:179485461-179485483 TATATTACCCAAATGGAAATAGG - Intergenic
967506889 3:190262686-190262708 CACCTTACCCAAATTGCAATTGG + Intergenic
969134708 4:5020516-5020538 CAGTTTTCCCACCTGGAAAATGG - Intergenic
969225311 4:5793411-5793433 CATTTTTCCTAAATGCAAATAGG + Intronic
969815550 4:9684695-9684717 CAGTTTCCCCAACTGTAAAATGG + Intergenic
969838995 4:9866796-9866818 CAGTTTACCCACATGTAAAATGG - Intronic
970377332 4:15472233-15472255 CAGTTTACTCATACGCAAATTGG + Intronic
971889626 4:32502285-32502307 CAAATGACCCAAATAGAAATTGG + Intergenic
972071346 4:35021673-35021695 CCGCTTACCCAATTTGAAATTGG + Intergenic
972273753 4:37537854-37537876 CATTTTACGATAATGGAAATTGG - Intronic
972480861 4:39494580-39494602 CAGTTTAGCCAAATGGTTCTGGG - Intergenic
972588419 4:40460500-40460522 CAGTTCACTCAACTGGAAAATGG + Intronic
974083467 4:57235736-57235758 CAGTTCCCTCAAATGTAAATTGG + Intergenic
974775077 4:66469143-66469165 TAGTTTAACCTAATGGAATTAGG + Intergenic
975495065 4:75028041-75028063 CAGTTTCCCCAACTGTAAAATGG + Intronic
975936237 4:79584651-79584673 AAAATTAGCCAAATGGAAATGGG - Intergenic
976105113 4:81608308-81608330 CAGTTTCCTCAAATGTAAAATGG + Intronic
979322963 4:119345695-119345717 CAGTTTCCCCATCTGGAAAATGG + Intergenic
981793884 4:148572808-148572830 TAGTTTCCCCATATGTAAATTGG - Intergenic
981942067 4:150292241-150292263 CTGTTTTCCTAAATGGATATAGG - Intronic
983240799 4:165230344-165230366 CAGTTTCCCCATCTGGAAAATGG + Intronic
984035090 4:174657329-174657351 CAGTTTACCCATTTGGACACCGG + Intronic
984211663 4:176857181-176857203 CAGTTCAACCAAATGGATATTGG + Intergenic
984562929 4:181292290-181292312 TAGATTACTCAAATGGACATGGG + Intergenic
985219108 4:187683632-187683654 CAGTTTTCCCATCTGTAAATTGG + Intergenic
985443447 4:190002564-190002586 CAGCTTACCCAGATTGAACTAGG - Intergenic
985886982 5:2687441-2687463 CAGTTTCCCCACATGTAAACTGG + Intergenic
987016917 5:13829925-13829947 CTGTTTTCCTGAATGGAAATTGG - Intronic
987844949 5:23271550-23271572 GGGTTTACCCAATAGGAAATAGG + Intergenic
988265925 5:28951136-28951158 CAGTTTCCCCAGTTGAAAATGGG - Intergenic
988821508 5:34890627-34890649 CAGTTTTCCCACATGTAAAATGG - Intronic
988823380 5:34910341-34910363 AAGTTAACCAAAATGGAAATTGG - Intronic
988942938 5:36164211-36164233 CAGTCTCCCCATATGTAAATGGG + Intronic
990148042 5:52785069-52785091 CAGTTTTCTCAAATGTAAAGTGG - Intergenic
990177623 5:53125699-53125721 CAGTTTCCCCAATTAGAAAATGG - Intergenic
992051213 5:72942522-72942544 CATTTTACCCAAATGTTAAAAGG - Intergenic
992127034 5:73652789-73652811 CAGTTTCCCCATCTGTAAATTGG - Intronic
992938816 5:81741147-81741169 CAGTTTCCCCATATGTAAAATGG + Intronic
993270026 5:85785034-85785056 CAATTCACCCAAAAGAAAATTGG - Intergenic
993866948 5:93207033-93207055 CAGGTTACCCACAAGGAAAAGGG + Intergenic
995033382 5:107505891-107505913 CAGTTTTCTCAAATGGAAAATGG - Intronic
995885251 5:116887437-116887459 CAGTTTCCTCATCTGGAAATGGG - Intergenic
996037107 5:118770778-118770800 CAGTTTCCCCATGTGGAAAATGG + Intergenic
996433310 5:123404957-123404979 CATTTTACCTAAAAGAAAATAGG + Intronic
997263240 5:132479506-132479528 CAGTTTACCCCAGTGGAAAGTGG + Intergenic
997612140 5:135222793-135222815 CAGTTTACTCATCTGGAAAATGG - Intronic
997963612 5:138340194-138340216 CAGTTTACCCATATGTAAAGTGG - Intronic
998106865 5:139474235-139474257 CAGTTTCCCCAAGTGTAAAACGG - Intergenic
998196715 5:140079814-140079836 CAGTTTCCCCAACTGTAAATTGG - Intergenic
998459164 5:142296657-142296679 CAGTTTCCCCATCTGGAAAATGG - Intergenic
999102630 5:149038963-149038985 CAGTCTCCCCAACTGGAAAATGG + Intronic
999238769 5:150115483-150115505 CAGTTTTCCCATATGTAAAATGG - Exonic
999576816 5:152988014-152988036 CATTTTACCCTAATGGCAATAGG + Intergenic
999766988 5:154748748-154748770 CAGTTTCCCCATCTGTAAATTGG - Intronic
999819701 5:155214034-155214056 CAGTTTCCTCATATGTAAATTGG + Intergenic
999931617 5:156439212-156439234 CAGTTTCCTCAAATGGAAAAAGG - Intronic
1000875048 5:166626870-166626892 CAATTTACACAATTTGAAATTGG + Intergenic
1001151405 5:169231433-169231455 AAGTTTACACAAATGGAATCAGG + Intronic
1001489043 5:172142757-172142779 CAGTTTCCCCATATGTAAAATGG - Intronic
1001545609 5:172568839-172568861 CAGTTTCTCCATTTGGAAATGGG + Intergenic
1001596813 5:172903748-172903770 CAGTTTCCCCAGATGTAAAATGG - Intronic
1001668277 5:173451689-173451711 CAGTTTACCCATCTGTAAAAGGG - Intergenic
1002214866 5:177623921-177623943 GAATATACCCAAAAGGAAATGGG - Intergenic
1002919984 6:1561222-1561244 CAGTTTCCCCATCTGTAAATTGG + Intergenic
1003688148 6:8325240-8325262 CAGTTTGCCTAAATTGAAACAGG - Intergenic
1004365613 6:15010214-15010236 CAGTTTACATAATTGGAAATGGG - Intergenic
1004441154 6:15655991-15656013 CAGTTTCCTCAAATGTAAAATGG + Intronic
1004870486 6:19899328-19899350 CAGTTTACTCAAAAGAAATTTGG - Intergenic
1005557200 6:26998616-26998638 CATTTTACACAACAGGAAATAGG + Intergenic
1005938395 6:30542475-30542497 CAGTTTATGCAAATGGAGCTTGG - Exonic
1005986336 6:30878050-30878072 CAGTCTTCCAAAATGGAAAGGGG - Intronic
1006399204 6:33806586-33806608 CAGTTTCCCCACATGTAAGTTGG - Intergenic
1007275544 6:40670839-40670861 CAGTTTCCCCAATTCCAAATGGG - Intergenic
1007478653 6:42135798-42135820 CAGTTTCCTCAACTGCAAATTGG - Intronic
1008093907 6:47319214-47319236 CAGTTTACTCAAAAGGCAGTGGG + Intergenic
1009293176 6:61909757-61909779 CATTTTGCCCAAATACAAATTGG + Intronic
1009419887 6:63454010-63454032 CAGTTTTCCTACATGTAAATTGG - Intergenic
1009903463 6:69838570-69838592 CAGTTTACTCATATGTAAAGTGG - Intergenic
1010190288 6:73188269-73188291 CAGTTTCCCAAAATATAAATAGG + Intronic
1010260380 6:73808605-73808627 CAGTTTTCCCAACTGTAAAGTGG + Intronic
1010780254 6:79937511-79937533 CAGTTTACTCACCTGGAAAATGG + Intronic
1011107291 6:83796464-83796486 TAGTTTACTCAGATTGAAATAGG - Intergenic
1011385324 6:86790870-86790892 CAGTTTTCCCATATGAAAATCGG - Intergenic
1011920065 6:92563113-92563135 AAGTTTAACCAAACGGAAGTGGG - Intergenic
1012444321 6:99292661-99292683 CAGTTTTCCCATCTGGAAATGGG + Intronic
1012470196 6:99564089-99564111 CTGTTAATACAAATGGAAATTGG - Intronic
1012787378 6:103648203-103648225 CAGTTTATCCAAATAGAGTTTGG - Intergenic
1013110753 6:107062982-107063004 AAGTTCACACAACTGGAAATTGG - Intergenic
1014089605 6:117388822-117388844 CAGTTTCCACACCTGGAAATGGG - Intronic
1014880025 6:126712156-126712178 CAGTTTTCCCAACTTGACATTGG - Intergenic
1014883871 6:126756274-126756296 CAATTTATCCCAATTGAAATGGG - Intergenic
1016605773 6:145923460-145923482 CAGTTTATCAAAATGGTTATAGG - Intronic
1017108523 6:150910648-150910670 CAATTTACCCACAAAGAAATTGG - Intronic
1017312790 6:152993415-152993437 AAGATGAGCCAAATGGAAATGGG + Intronic
1017811829 6:157989304-157989326 CAGTTTCCCCAAGTGTAAAATGG - Intronic
1017847569 6:158272620-158272642 CAGTTTCCCCAACTGTAAAATGG - Intronic
1017923173 6:158888601-158888623 CCGCTTACCCAATTTGAAATTGG + Intronic
1020530472 7:9327548-9327570 CAGTTTACAAAACTGGAAAGTGG + Intergenic
1020793974 7:12660349-12660371 CTGCTTACCCAATTTGAAATTGG - Intergenic
1021660395 7:22913958-22913980 CTGCTTACCCAATTTGAAATTGG - Intergenic
1021793275 7:24227755-24227777 CATTTTACAGAAATGGAGATGGG + Intergenic
1021910934 7:25385545-25385567 CAGTTTACAAAAATGGAGAAGGG - Intergenic
1022117505 7:27275172-27275194 CAGTTTCCCCATATGTAAAATGG - Intergenic
1023553100 7:41389692-41389714 CAGTTTCCCCATCTGGAAAGTGG - Intergenic
1024135128 7:46399151-46399173 CAGTTTACTCATCTGTAAATTGG + Intergenic
1024228736 7:47347843-47347865 CATTTTACCCATAAAGAAATGGG - Intronic
1026191354 7:68131054-68131076 CAGTTTCCTCAAATGTAAAATGG + Intergenic
1026819337 7:73536424-73536446 AAGTTTAAGAAAATGGAAATGGG - Exonic
1026940958 7:74287726-74287748 CAGTTTCCCCATCTGTAAATTGG - Intergenic
1027265651 7:76493938-76493960 CAGTTTCCTCTAATGAAAATGGG - Intronic
1027317021 7:76992055-76992077 CAGTTTCCTCTAATGAAAATGGG - Intergenic
1027591704 7:80126813-80126835 CAGTTAACACAAATGAAAAATGG + Intergenic
1027644408 7:80779202-80779224 CAGTTTACACAACTGTAAAATGG + Intronic
1027702927 7:81491285-81491307 CAGTTTCCTCATATGTAAATAGG - Intergenic
1028089781 7:86684277-86684299 CAGTTTCCTCAACTGAAAATAGG + Intronic
1028980555 7:96963266-96963288 TAGTTTTTCCAAATAGAAATGGG - Intergenic
1029597101 7:101543749-101543771 CAGTTTCCCCACATTGAAAATGG + Intronic
1029598871 7:101552232-101552254 CAGTTTTCCCAACTGTAAAATGG - Intronic
1029662345 7:101971091-101971113 CAGTCTCCCCAGATGGAAAATGG - Intronic
1030542023 7:110842916-110842938 CAGGCTACCCGAATGGAAATTGG + Intronic
1030635885 7:111948224-111948246 CAGTTTTCCCATATGTAAAATGG - Intronic
1030891578 7:115005460-115005482 TAGCTTGCCCAAATGGTAATAGG + Intronic
1031357727 7:120808514-120808536 CAGTTTACTCATATGTAAAATGG - Intronic
1032349419 7:131146530-131146552 CAGTATACCCAAGTGGCAAATGG - Intronic
1034061842 7:148099169-148099191 CAGTTTCCCCACATGAAAAGTGG + Intronic
1036171726 8:6493274-6493296 CAGTTTTCAAAAATGAAAATGGG - Intronic
1036429932 8:8680806-8680828 CAGTTCACCCAAATGGGAGGAGG + Intergenic
1037056479 8:14448360-14448382 CAGTTTACTCCAGAGGAAATTGG - Intronic
1037418515 8:18676983-18677005 CACTTTACTCAAGTGAAAATGGG + Intronic
1037536672 8:19831039-19831061 CAGTATACTCAAAGGAAAATAGG - Intronic
1037881926 8:22577813-22577835 CAGTTTCCCCATGTGGAAAATGG - Intergenic
1039869930 8:41537416-41537438 CAGTTTAGCTACATGGATATTGG - Intronic
1040421273 8:47242481-47242503 CAGTTTCCCCATATGTAAACAGG + Intergenic
1040458988 8:47628768-47628790 CTGTCTAACAAAATGGAAATGGG + Intronic
1040988196 8:53319278-53319300 AAGTTTATCCAATTAGAAATAGG + Intergenic
1041578467 8:59428238-59428260 CAGTCTGCCCAAATTCAAATTGG - Intergenic
1041617686 8:59927446-59927468 CAGTTTCCCCATGTGGAAAAGGG + Intergenic
1041619016 8:59943493-59943515 CAGTTTCCCCACTTGGAAATTGG - Intergenic
1041977360 8:63815299-63815321 CAGTATATGCAAATGGAAGTGGG + Intergenic
1042206974 8:66339265-66339287 CAGTTTACCAAATTGTAAATGGG - Intergenic
1042999079 8:74735085-74735107 CAGTTTACCCAACTTGAAGTAGG + Intronic
1043882069 8:85555335-85555357 CAGTTTCCTCATATGCAAATTGG - Intergenic
1044163046 8:88944763-88944785 GAGTTAACCCAAATGAAAACTGG - Intergenic
1045105058 8:98884429-98884451 CAGATTCCCCAAATGTAACTTGG + Intronic
1045497831 8:102723062-102723084 CAGTTTCCTCAACTGGAAAATGG + Intergenic
1045899041 8:107253643-107253665 CATTTTACCCCAATGCAACTTGG - Intronic
1046477897 8:114772676-114772698 CAGTTTACCTAAATAGCAAGGGG + Intergenic
1046601670 8:116324430-116324452 CTGTTTCTCCAAATGGAAAATGG - Intergenic
1046769157 8:118101197-118101219 CAGTTTCCACATCTGGAAATGGG - Intronic
1046860602 8:119087003-119087025 CATTTTACAGAAAAGGAAATGGG - Intronic
1047186854 8:122641202-122641224 CAGTTTACTCATTTGTAAATGGG + Intergenic
1047322923 8:123805305-123805327 CTGTTTCATCAAATGGAAATGGG - Exonic
1047364911 8:124202866-124202888 CAGTTTCCTCACATGTAAATGGG - Intergenic
1048165099 8:132055268-132055290 CAGTTTACCCATCTGTAAAATGG + Intronic
1048207048 8:132423652-132423674 CAGTTTACCCAACTGCACAGTGG - Intronic
1048874261 8:138824570-138824592 CAGTTTACCCAAATGACAAATGG + Intronic
1049189916 8:141281403-141281425 CAGTTTCCCCACCTGTAAATGGG + Intronic
1053060182 9:35024516-35024538 CCGCTTACCCAATTTGAAATTGG + Intergenic
1053133919 9:35637471-35637493 CCGCTTACCCAATTTGAAATTGG - Intronic
1053287311 9:36858415-36858437 CAGTTTCCCCAAATGGACAATGG + Intronic
1056509125 9:87285873-87285895 CAGTTTACTCATATGAAAAATGG + Intergenic
1056676654 9:88682042-88682064 CAGTTTCCCCAACTGTAAAATGG - Intergenic
1056720599 9:89068350-89068372 CAGTTTACCCAGTAGGAAAATGG - Intronic
1058591681 9:106572026-106572048 CAGTTTACCCATCTGTAAAATGG + Intergenic
1058712368 9:107691348-107691370 CAGTTTCCTCACATGGAAAATGG - Intergenic
1059419967 9:114184741-114184763 CAGTTTCCCCATCTGTAAATGGG - Intronic
1059439933 9:114301216-114301238 CAGTTTCCTCATCTGGAAATGGG + Intronic
1059656490 9:116362391-116362413 CAGTTTCCCCATATGTAAAATGG + Intronic
1059770188 9:117416566-117416588 CAGTTTCCTCACATGGAAAATGG - Intergenic
1060175338 9:121493439-121493461 CAGTTTCCCCACATGCAAAATGG + Intergenic
1060364923 9:123001706-123001728 CAGTTTACTAAATTGTAAATTGG + Intronic
1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG + Intronic
1061295554 9:129675047-129675069 CAGTTTACCCGAGTGGAAAGCGG + Intronic
1061410611 9:130419197-130419219 CAGTTTACCCAACTGTAAACGGG - Intronic
1061586795 9:131574884-131574906 CAGTTTCCCCAGCTGGAAGTGGG - Intergenic
1061630053 9:131866648-131866670 CAGTTTTCCCATCTGGAAAATGG + Intronic
1061665356 9:132157735-132157757 CACTTTACCCAAATGAAAAATGG - Intergenic
1061880332 9:133565751-133565773 CAGTTCCCCCAGAAGGAAATCGG - Intronic
1062357607 9:136172228-136172250 CAGTTTACTCATCTGTAAATGGG + Intergenic
1062495322 9:136828767-136828789 CAGGTCACTCAAATGCAAATAGG - Intronic
1186351314 X:8742459-8742481 CAGTGTTCTCAAATGGAAAATGG + Intergenic
1187236247 X:17470146-17470168 CAGTTTCCCCAGCTGTAAATAGG - Intronic
1187529925 X:20086975-20086997 CAGTTTCCCCACCTGGAAAATGG - Intronic
1189215912 X:39323435-39323457 CAATATACCCAAATAGAAAGTGG - Intergenic
1189392588 X:40589031-40589053 TTGTTTTCCGAAATGGAAATTGG + Exonic
1190651500 X:52572842-52572864 CAGTTAACCCAAATGTTAAACGG - Intergenic
1190982156 X:55465756-55465778 CAGTTTACTCATCTGGAAAAAGG - Intergenic
1190986542 X:55507426-55507448 CAGTTTACTCATCTGGAAAAAGG + Intergenic
1191097659 X:56690754-56690776 CAGTTTCCTCAACTGTAAATTGG + Intergenic
1191716619 X:64198074-64198096 CAGTTTTCCCAAATGGCAAATGG + Intronic
1192381697 X:70623726-70623748 CAGTTTCCCCAACTGTAAAGTGG - Intronic
1192462240 X:71326905-71326927 CAGTTTCCCCAATTGTAAAATGG + Intergenic
1192936069 X:75859488-75859510 CCATTTACCCAATTTGAAATTGG + Intergenic
1196185221 X:112738293-112738315 CAGTTTCCTCATCTGGAAATAGG + Intergenic
1197951333 X:131900678-131900700 CAGGTGAGGCAAATGGAAATGGG - Intergenic
1198407315 X:136326368-136326390 CATTTTATACAAAAGGAAATAGG + Intronic
1198630116 X:138627826-138627848 CAGTATGCCCACATAGAAATTGG + Intergenic
1199299222 X:146193579-146193601 CAGTTTCCTTATATGGAAATAGG + Intergenic
1199455547 X:148023970-148023992 CAGTTTCCCCATATGAAAAATGG + Intronic
1200232552 X:154451266-154451288 CAGCTTAGCCAAGTGGAACTTGG - Intergenic