ID: 1161626742

View in Genome Browser
Species Human (GRCh38)
Location 19:5331418-5331440
Sequence CCACCATGCCTGGCAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1812
Summary {0: 1, 1: 2, 2: 34, 3: 400, 4: 1375}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161626738_1161626742 5 Left 1161626738 19:5331390-5331412 CCCAAAGTGTTGGGATTATGGAC 0: 7
1: 296
2: 5104
3: 57001
4: 293155
Right 1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG 0: 1
1: 2
2: 34
3: 400
4: 1375
1161626732_1161626742 18 Left 1161626732 19:5331377-5331399 CCCGCTTTAACCTCCCAAAGTGT 0: 3
1: 67
2: 1756
3: 25691
4: 171579
Right 1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG 0: 1
1: 2
2: 34
3: 400
4: 1375
1161626731_1161626742 21 Left 1161626731 19:5331374-5331396 CCTCCCGCTTTAACCTCCCAAAG 0: 3
1: 95
2: 3986
3: 57613
4: 198038
Right 1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG 0: 1
1: 2
2: 34
3: 400
4: 1375
1161626736_1161626742 8 Left 1161626736 19:5331387-5331409 CCTCCCAAAGTGTTGGGATTATG 0: 190
1: 4260
2: 56361
3: 350596
4: 246209
Right 1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG 0: 1
1: 2
2: 34
3: 400
4: 1375
1161626733_1161626742 17 Left 1161626733 19:5331378-5331400 CCGCTTTAACCTCCCAAAGTGTT 0: 3
1: 65
2: 1879
3: 24626
4: 157052
Right 1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG 0: 1
1: 2
2: 34
3: 400
4: 1375
1161626739_1161626742 4 Left 1161626739 19:5331391-5331413 CCAAAGTGTTGGGATTATGGACG 0: 4
1: 120
2: 2580
3: 32406
4: 195793
Right 1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG 0: 1
1: 2
2: 34
3: 400
4: 1375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161626742 Original CRISPR CCACCATGCCTGGCAAAATC AGG Intronic
900197337 1:1383185-1383207 CCACCATGCCTGGCTAATTTTGG - Intergenic
900230996 1:1557640-1557662 CCACCACGCCTGGCTAATTTTGG - Intronic
900345290 1:2207583-2207605 ACACCATGCCTGGCAGGAGCTGG + Intronic
901102954 1:6733519-6733541 CCACCGTGCCTGGCTAATTTTGG - Intergenic
901166964 1:7228313-7228335 CCACCATGCCCGGCTGAGTCCGG - Intronic
901682159 1:10919577-10919599 CCACCACGCCTGGCTAATTTTGG + Intergenic
901694791 1:10998912-10998934 CCACCGTGCCTGGCACACTGGGG - Intergenic
901732754 1:11292290-11292312 CCACCACACCTGGCCAGATCAGG + Intronic
901850793 1:12013955-12013977 CCACCAGGCCTGGCTAATTTTGG + Intergenic
901866171 1:12108363-12108385 CCACCGTGCCTGGCGACATACGG + Intronic
901869439 1:12128985-12129007 CCACCATGCCTGGCTAATTTTGG + Intronic
901882993 1:12204885-12204907 CCACCTTGCCTGGCCAGACCAGG - Intronic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902289747 1:15428342-15428364 CCACCATGCCCGGCTAATTTTGG - Intronic
902312264 1:15590214-15590236 CCACCACGCCTGGCCCAATCTGG - Intronic
902319348 1:15649516-15649538 CCACCACGCCTGGCTAATTTTGG - Intronic
902403108 1:16168588-16168610 CCACCGTGCCTGGCAATGCCCGG + Intergenic
902751992 1:18522594-18522616 ACACCATGCCTGGCTAATTTTGG - Intergenic
902832564 1:19026670-19026692 CCACCATGCCTGGCCTAAGTGGG + Intergenic
902869696 1:19306717-19306739 CCACCATGCCTGGCCCATCCTGG + Intronic
902894124 1:19467161-19467183 CCACCATGCCTGGCAACTACGGG + Intronic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
903040142 1:20523318-20523340 CCACCATGCCTGGCCTCAGCTGG + Intergenic
903054854 1:20628818-20628840 CCACCATGCCTGGCCATGTTTGG - Intergenic
903270763 1:22186827-22186849 CCACCATGCCTGGCCTCACCTGG + Intergenic
903348115 1:22700706-22700728 CCACCATGCCCAGCTAAATTTGG - Intergenic
903418776 1:23203184-23203206 CCACCGCGCCCGGCCAAATCTGG + Intergenic
903481502 1:23656870-23656892 TCACCATGCCTGGCCAAAGCTGG + Intergenic
903498131 1:23785338-23785360 CCACCATGCCCGGCAAATTTTGG - Intronic
903599831 1:24529263-24529285 CCACCATGCCTGGCCACACCTGG - Intronic
903609019 1:24596528-24596550 CCACCATGCCTGGCTAATTTTGG - Intronic
903621430 1:24701029-24701051 CTGCTATGCCTGGCAAAACCTGG - Intergenic
903626997 1:24738023-24738045 CCACCATGCCTGGCTAATTTTGG + Intergenic
903692072 1:25181462-25181484 CCATCATGCCTGGCTAATTTAGG + Intergenic
903746320 1:25589149-25589171 CCACCACGCCTGGCTAATTTTGG - Intergenic
903910654 1:26722396-26722418 CCACCATGCCAGGCTAATTTTGG + Intronic
904057029 1:27677836-27677858 CCACCATGCTTGGCTAATTATGG - Intergenic
904188368 1:28723648-28723670 CCACCACGCCTGGCTAATTTTGG - Intergenic
904190535 1:28739586-28739608 CCACCATGCCCGGCTGAGTCAGG + Intronic
904250435 1:29220101-29220123 CCACCATGCCTGGCCATGACTGG - Intronic
904544634 1:31259394-31259416 CCACCGCGTCTGGCAAAACCAGG + Intergenic
904583836 1:31567989-31568011 CCACTATGCCTGGCCAAAAGTGG - Intergenic
904682222 1:32237246-32237268 CCACCATGCCTGGCTAATTTTGG + Intergenic
904727373 1:32559750-32559772 CCACTATGCGTGGCACAATGTGG + Intronic
904803346 1:33113129-33113151 CCACCATGCCTGGAGAGATGGGG + Intronic
904844662 1:33401037-33401059 CCACCATGCCTGGCCCAAGATGG - Intronic
904940892 1:34164497-34164519 CCAGCGTGCCTGGCAGAATCAGG + Intronic
905230577 1:36512666-36512688 CCACCCTGCCTGGCTAATTTGGG - Intergenic
905332868 1:37219223-37219245 CCACCATGCCTGGCTAATTTTGG - Intergenic
905339837 1:37270923-37270945 TCACCATGCCTGGCCAGCTCTGG - Intergenic
905459836 1:38115246-38115268 CCACATTTCCTGGCAAATTCTGG - Intergenic
905555064 1:38876024-38876046 CCACCATGATTGGAAAGATCTGG - Exonic
905672111 1:39798664-39798686 CCACCATGCCTGGCCAGAGCAGG - Intergenic
905770476 1:40634786-40634808 CCACCACGCCTGGCTAATTTTGG - Intronic
906095370 1:43219804-43219826 CCACCATGCCTGGCTAGAGATGG - Intronic
906255859 1:44349446-44349468 CCACCACGCCTGGCCAGTTCTGG + Intronic
906388245 1:45390726-45390748 CCACCACGCCTGGCTAATTTTGG + Intronic
906388949 1:45396969-45396991 CCACCATGCCTGACTAATTTTGG + Intronic
906432458 1:45766080-45766102 CCACCATGCCCAGCCAAAGCAGG - Intergenic
906440539 1:45839413-45839435 CCACCACGCCCAGCAACATCTGG + Intronic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907373799 1:54019496-54019518 CCACCATGCCTGGCCTCCTCTGG - Intergenic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908151411 1:61306426-61306448 CCACCATGCCTGGCTAATTTTGG + Intronic
908221330 1:62009795-62009817 CCACCAGGCCTGGCCAAAAGTGG - Intronic
908227929 1:62074809-62074831 CCACCACGCCTGGCTAATTTTGG - Intronic
908286657 1:62611855-62611877 CCACCATGCCTGGCCAGATAAGG - Intronic
908548061 1:65181537-65181559 CCACCATGCCTGGCTAATTTTGG + Intronic
908645005 1:66268380-66268402 CCACCATGCCTGGCCGAAGAGGG - Intronic
908679631 1:66645991-66646013 CCACCATGCCTGGCTACTTTTGG + Intronic
908845423 1:68319862-68319884 ACACAATGCCAGGCTAAATCTGG - Intergenic
909253311 1:73385687-73385709 TCACCATGCCTTGGAACATCTGG - Intergenic
909325471 1:74346660-74346682 CTAGAATGCCTGGCATAATCAGG + Intronic
909360176 1:74750409-74750431 CCACCATGCCTGGCTAATTTTGG - Intronic
909674523 1:78224349-78224371 TCACCTTGCCTGGCAATGTCTGG + Intergenic
910178106 1:84452908-84452930 CCACCGTGCCTGGCCGAATGTGG - Intergenic
910318297 1:85914541-85914563 CCACCATGCCTGATTAAATTTGG + Intronic
910414917 1:86987359-86987381 CCACCATGCCTGGCCCAACTAGG + Intronic
910459471 1:87433673-87433695 CCTTCATGCAAGGCAAAATCTGG - Intergenic
911004987 1:93210987-93211009 CCACCATGCCCGGCCAATTAAGG - Intronic
911128227 1:94361535-94361557 CCACCACACCTGGCCAAAACTGG + Intergenic
911291855 1:96066000-96066022 CCAGCATGGCTGGAAAAAGCAGG + Intergenic
912347930 1:108982243-108982265 CCACCATGCCTGGCCTAGTATGG - Intronic
912572813 1:110637041-110637063 CCACCATGCCTGGCTAATTTGGG - Intergenic
912921192 1:113868934-113868956 CCACCACGCCCAGCCAAATCTGG - Intronic
913006383 1:114636510-114636532 CCACCATGCCTGGCTAATTTTGG - Intronic
913270401 1:117087578-117087600 CCACCATGCCTGGCCATATTAGG + Intronic
914017726 1:143835917-143835939 CCACCATGCCTAGCTAATTTTGG - Intergenic
914316707 1:146520016-146520038 CCTTCATGCCAGGCAAAATTTGG - Intergenic
914429120 1:147603794-147603816 CCACCGTGCCCGGCCAGATCAGG + Intronic
914497649 1:148213345-148213367 CCTTCATGCCAGGCAAAATTTGG + Intergenic
914502535 1:148259772-148259794 CCACTATGCCTGGCTAATTTTGG - Intergenic
914656336 1:149744452-149744474 CCACCATGCCTAGCTAATTTTGG - Intergenic
914812607 1:151040036-151040058 CCACCATGCCTGGCCCAGTAAGG + Intronic
915062867 1:153200991-153201013 CCACCGCGCCTAGCAAAAGCAGG + Intergenic
915080953 1:153351828-153351850 CCACCACGCCCGGCCAAATGTGG + Intergenic
915139560 1:153758818-153758840 CCACCATGCCTGGCCAGGCCTGG - Intronic
915467455 1:156105829-156105851 CCACCGTGCCTGGCCAGATAAGG - Intronic
915491860 1:156254594-156254616 CCACCATGCCTGGCTAATTTTGG + Intronic
915705313 1:157838061-157838083 CCACCACGCCTGGCCTAATCTGG + Intronic
915717844 1:157961379-157961401 CCACCGTGCCTGGCCAATTTTGG - Intergenic
916040658 1:160958470-160958492 CCACCAAGCCCGGCCAATTCTGG + Intergenic
916173903 1:162022401-162022423 CCACCACGCCTGGCTAATTTTGG + Intronic
916263434 1:162866171-162866193 CCACCATGCCTGGCCTATTTAGG - Intronic
916537077 1:165713614-165713636 CCACAATGCCTGGCCGAATGTGG - Intergenic
916861385 1:168809475-168809497 CAACCATACATGGCAGAATCAGG + Intergenic
916943461 1:169700422-169700444 CCACCACACCTGGCCAAAACAGG + Intronic
917078368 1:171229906-171229928 CCACCATGCCTGGTCTCATCAGG - Intergenic
917626967 1:176856046-176856068 CCACCGTGCCTGGCACAGGCTGG - Intergenic
918196701 1:182229130-182229152 CCACCATACCTGGCTAATTTTGG - Intergenic
918272117 1:182912152-182912174 CCACCGTGCCTGGCGGAATCTGG - Intronic
918769530 1:188536850-188536872 CCACCATGCCCGGCTAATTTTGG - Intergenic
919069562 1:192736556-192736578 CCACCATGCCTGGCTGAGACTGG + Intergenic
919104188 1:193128590-193128612 CCACCATGCCTGGCCTAGGCTGG + Intronic
919201060 1:194356119-194356141 CCACCATGCCTGGCAATAATTGG + Intergenic
919348507 1:196418186-196418208 CCACCGTGCCCAGCCAAATCTGG - Intronic
919695722 1:200573138-200573160 CCACCATGATTGACAACATCGGG - Intronic
919876810 1:201875300-201875322 CCACCATGCCTGGCTATAAATGG - Intronic
919966647 1:202533440-202533462 CCACCATGCCTTGCTAATTTTGG + Intronic
919998477 1:202776075-202776097 CCACCAAGCCTGGCTAATTTTGG - Intronic
920130518 1:203728568-203728590 CCACCATGCCTGGCCGACTGGGG - Intronic
920214483 1:204352219-204352241 CCACCATGCCGGGCTAATTTTGG - Intronic
920371948 1:205484716-205484738 CCACCATGCCTGGTCATAGCTGG - Intergenic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
920584589 1:207145386-207145408 CCACCATGCCTGGCCATACTTGG + Intergenic
921235005 1:213117733-213117755 CCACCATGCCTGGCCAAGTAAGG - Intronic
921620714 1:217323487-217323509 CCACCGTGCCTGGCCAAGTCAGG - Intergenic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922290625 1:224206355-224206377 CCACCATGCCTGGCTAATTCTGG + Intergenic
922295027 1:224242618-224242640 CCACCATGCCTGGCCAATTTTGG + Intronic
922407638 1:225332705-225332727 CCACCATGCCCAGCCAAAGCAGG - Intronic
922761906 1:228138389-228138411 CCACCACACCTGGCTAATTCAGG + Intergenic
923324538 1:232869735-232869757 CCATCATGCCTGGCTAATTTTGG + Intergenic
923401532 1:233619755-233619777 CCACCACGCCTGGCTAATTTTGG - Intronic
923404754 1:233648852-233648874 CCACCATGCCTGGCCAACAAAGG + Intronic
923590892 1:235318726-235318748 CCACCATGCCCAGCAAATTTTGG - Intronic
923915954 1:238505273-238505295 TCACCATGCCTGGCAATTTATGG - Intergenic
924320530 1:242843991-242844013 CCACCATGCCTGGCTAATTTTGG + Intergenic
924448733 1:244158745-244158767 CCACCACGCCTGGCTAATTTTGG + Intergenic
924546715 1:245034446-245034468 CCACCATGCCTGGCTAATTTTGG - Intronic
924653748 1:245953704-245953726 CCACCGTGCCTGGCCAAGTAGGG + Intronic
924852737 1:247846895-247846917 CTACCACGCCTGGCTAAATTTGG - Intergenic
1063030529 10:2229838-2229860 CCACCATACCTGGCTAATTCAGG + Intergenic
1063091958 10:2873270-2873292 CCACCGTGCCTGGCAATCTTAGG + Intergenic
1063701192 10:8386931-8386953 CCACCATGCCTGGCCTATGCAGG + Intergenic
1064266728 10:13831293-13831315 CCACCATACCTGGCCAATCCTGG - Intronic
1064269532 10:13852394-13852416 CCACCATGCCTGGTAGAGACAGG + Intronic
1064350460 10:14571499-14571521 CAACCATGTCTGTCAAACTCTGG - Intronic
1064612200 10:17115089-17115111 CCAACATGCCTGGCTAATTTTGG - Intronic
1064642281 10:17426947-17426969 CCACCATGCCTGGCTAATTTTGG - Intronic
1064735523 10:18378459-18378481 CCACCATGCCCGGCCAACTGTGG - Intronic
1064741905 10:18442435-18442457 CCACCACGCCTGGCCGAATCTGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1064920065 10:20506186-20506208 CCACCATTCCTGGCTAATTTTGG - Intergenic
1064954673 10:20894625-20894647 CCACCATGCCCGGCCTATTCTGG - Intronic
1065037170 10:21651355-21651377 CCACCATGCCTGGCCGTATTTGG + Intronic
1065210034 10:23394244-23394266 CCACCATGCCCAGCCAAATTTGG - Intergenic
1065216134 10:23450628-23450650 CCACTATGCCTGGCTACATCTGG + Intergenic
1065349986 10:24786762-24786784 ACACCATGCCTGGCCAAGGCAGG + Intergenic
1065642750 10:27802007-27802029 CCACCACGCCTGGCTAATTTTGG - Intergenic
1065655036 10:27939583-27939605 CCACCATGCCTGGCTAATGTAGG - Intronic
1065831486 10:29618518-29618540 CCACCATGCCTGGCCCAGCCTGG + Intronic
1065977306 10:30853707-30853729 CCACCATGCCTGGCCATAAATGG - Intronic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1066404979 10:35109884-35109906 CCACCATGCCTGGCCCACTATGG - Intergenic
1066407283 10:35129907-35129929 CCACCATGCCCGGCCTAAACTGG - Intronic
1066615770 10:37293119-37293141 CCACCACGCCTGGCTAATTTTGG + Intronic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067090113 10:43262148-43262170 CCACCAAGGCTGCCCAAATCTGG - Intronic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067424137 10:46190127-46190149 CCACCATGCCTGGTGACATTGGG - Intergenic
1067765434 10:49082374-49082396 CCACCATGCCTGACCATATGTGG - Intronic
1067813003 10:49445298-49445320 TCACCATTCCTGGCAAATGCGGG + Intergenic
1069128934 10:64674542-64674564 CCACCACGCCTGGCTAACTTTGG - Intergenic
1069483023 10:68801032-68801054 CCACCATGCCTGGCTAATTTTGG - Intergenic
1069493576 10:68882782-68882804 CCACCATGCCCGGCATAAATTGG + Intronic
1069531615 10:69223868-69223890 CCACCATGCCTGGCCTCATTTGG + Intronic
1069547879 10:69341741-69341763 CCACCATGCCTGGCCTCTTCTGG + Intronic
1069670880 10:70202195-70202217 CCACAATGCCTGACTAATTCTGG - Intergenic
1069696835 10:70392702-70392724 CCACCATGCCTGGCCACATCTGG - Intergenic
1069910971 10:71759020-71759042 CCACCATGCCAGGCAAATTTTGG + Intronic
1069937353 10:71926957-71926979 CCACCATGCCCGGCTAATTTGGG + Intergenic
1070096830 10:73345650-73345672 CCACCATGCCTGGCTAATTTTGG - Intronic
1070186341 10:74066344-74066366 CCACCACGCCTGGCCAATTTTGG + Intronic
1070196456 10:74161665-74161687 CAACCATTCCTGGCAGAATCAGG + Intronic
1070449235 10:76541346-76541368 CCCCCATGCCTGGCTAATTTTGG - Intronic
1070507900 10:77131675-77131697 CCACCGTGCCTGGCAACAGCTGG - Intronic
1070615821 10:77968535-77968557 CCACCATGCCCGGCTAATTTTGG - Intergenic
1070838107 10:79464101-79464123 GCACCAGGCCTGGCACACTCTGG - Intergenic
1070860543 10:79655375-79655397 CCACCATGCCTGGTGACATTGGG - Intergenic
1070905811 10:80072196-80072218 CCACCATGCCCGGCTAATTTTGG + Intergenic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1071113772 10:82193293-82193315 CCACCATGCCCGGCTAATTTGGG + Intronic
1071262525 10:83933680-83933702 CCACCGTGCCTGTCCAAATGTGG - Intergenic
1071590361 10:86866649-86866671 CCACCATGCCCGGCCAACTCAGG + Intronic
1071943567 10:90615208-90615230 CCACCATGCCTGGCACCAGCTGG - Intergenic
1072003184 10:91217937-91217959 CCACCAAGCCTGGCTAATTTTGG + Intronic
1072097771 10:92199236-92199258 CCACCATGCCTGACTAATTTTGG - Intronic
1072121309 10:92407653-92407675 CCTCCATGCCTGGCTAATTTTGG + Intergenic
1072157282 10:92735441-92735463 CCACCATGCCTGGCAGATTTTGG + Intergenic
1072159032 10:92749322-92749344 CCACTATGCCTGGCCGAAACTGG + Intergenic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1072487483 10:95869535-95869557 CCACCATGCCTGGCCAGAAGTGG + Exonic
1072590571 10:96825278-96825300 CCACCAAGCCTGGCTAATTTTGG - Intergenic
1072625528 10:97108601-97108623 CCACCACACCTGGCCAAATGTGG - Intronic
1072776208 10:98197100-98197122 CCACCATGCCTGGCTATTTTTGG + Intronic
1072847492 10:98848263-98848285 CCACCATGCCTGGATAATTTTGG - Intronic
1072875480 10:99168905-99168927 CCACCATGCCCGGCCAGGTCAGG - Intronic
1072995081 10:100236486-100236508 CACCCACGCCTGGCAAGATCTGG - Intronic
1073082246 10:100867598-100867620 CCACCATGCCTGGCCCAGTGGGG - Intergenic
1073306665 10:102508259-102508281 CCACCGTGCCCGGCCAAAACAGG + Intronic
1073483487 10:103801854-103801876 CCACCATGCCTGGCTAATTTTGG + Intronic
1073628822 10:105127238-105127260 ACACCATGCCTTCGAAAATCAGG - Intronic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1073783664 10:106865434-106865456 CCACCATGCCTGGCCCAGTTTGG - Intronic
1074543783 10:114386855-114386877 CCTCCATGCTTCGCAAAATGAGG + Intronic
1074553957 10:114471180-114471202 TCACCATGTCTGGCAGAGTCTGG + Intronic
1074938475 10:118211115-118211137 GCACTATGCCTTCCAAAATCAGG - Intergenic
1075006025 10:118830809-118830831 CCACAATGCCTGGCTAATTAAGG - Intergenic
1075046664 10:119151666-119151688 CCACCATGCCCGGCTAATTTTGG + Intronic
1075113116 10:119603980-119604002 CCACCATGCCTGGCCTAGACTGG + Intergenic
1075141043 10:119835986-119836008 CCACCATGCCTGACTAATTTTGG + Intronic
1075356851 10:121786514-121786536 TCACCATGCCTGGCTAATTTTGG - Intronic
1075368200 10:121912031-121912053 CCACCATGCCCGGCCAAGCCCGG + Intronic
1075374073 10:121963941-121963963 CCACCATGCCCGGCTAATTTTGG - Intronic
1075577198 10:123585934-123585956 TCCCCATGCCTGGAAAAGTCCGG + Intergenic
1075711959 10:124535695-124535717 CCGCCATGCCTGGCCTAGTCTGG + Intronic
1075761004 10:124856562-124856584 CCACCGTGCCTGGCCAACTCTGG + Intergenic
1075765502 10:124889836-124889858 CCACCATGCCTGGTTAATTTTGG - Intergenic
1075842002 10:125512647-125512669 CCACCATACCTGGCTAATTTTGG + Intergenic
1076607564 10:131699174-131699196 CCACCATGCCCGGCGCTATCAGG + Intergenic
1076660412 10:132052070-132052092 CCACCATGCCTGGCTAATTGTGG - Intergenic
1076708322 10:132314979-132315001 CCACCACGCCTGGCTAATTTTGG - Intronic
1076711930 10:132341141-132341163 CCACCATGCCTGGCTAATGTTGG - Intronic
1076718486 10:132381161-132381183 CCAGCATGGCTGGAAAAAGCAGG + Intergenic
1076774493 10:132687229-132687251 CCACCAAGCCTGGCCAACACTGG + Intronic
1077608456 11:3627985-3628007 CCACCGTGCCTGGCCAAATTTGG - Intergenic
1077813996 11:5667484-5667506 CCACCACACCTGGCCAAATCTGG + Intronic
1078215247 11:9306393-9306415 CCGCCATGCCCGGCGAATTCTGG - Intronic
1078255510 11:9655315-9655337 ACACCATGCCTGGCCTAAGCAGG + Intergenic
1078314312 11:10279800-10279822 CCACCACGCCTGGCTAATTTTGG + Intronic
1078341297 11:10499501-10499523 CCATCATGTCTGGCCAAACCTGG + Intronic
1078457150 11:11484303-11484325 CCACCATGCCTGGCCTCACCTGG - Intronic
1079258135 11:18850643-18850665 CCACCACGCCTGGCTAATTTTGG - Intergenic
1079324280 11:19478192-19478214 CCACCATGCCTGCCAAAAGGAGG - Intronic
1079527415 11:21407261-21407283 CCATCATGCCTGGCTAACTTTGG - Intronic
1079986616 11:27206792-27206814 CCACCATGCCCGGCTAAGGCTGG + Intergenic
1080103777 11:28490224-28490246 CCACCATCCCTGGCAATGCCAGG - Intergenic
1080279630 11:30541743-30541765 CCACCACGCCTGGCTAATTTTGG + Intronic
1080505271 11:32906549-32906571 CCACCATGCCTGGCTAAATTCGG + Intronic
1080518442 11:33045065-33045087 CCACCATGCCTGGCCAATCCTGG - Intronic
1081057998 11:38434806-38434828 CCACCATGCCTGGCTAATTTTGG + Intergenic
1081248283 11:40796797-40796819 CCACGATGCCTGGCTAATTTTGG + Intronic
1081553051 11:44131888-44131910 CCACCATGCCCGGCTAATTTTGG + Intronic
1081790755 11:45782208-45782230 CCACCATGCCTGGCCATAAATGG + Intergenic
1081883994 11:46479044-46479066 CCACCATGCCTGGCTAATTTTGG - Intronic
1081898346 11:46606463-46606485 CCACCATGACTGGCTAATTTTGG + Intronic
1081932991 11:46885484-46885506 CCACCGCGCCTAGCCAAATCAGG - Intronic
1082052132 11:47779878-47779900 CCACCATGCCTGGCTAGTTTTGG + Intronic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082783874 11:57305984-57306006 CCACCATGCCTGGCCCACTATGG - Intronic
1082806718 11:57456335-57456357 CCACCACGCCTGGCTAATTTTGG - Intergenic
1082857410 11:57820742-57820764 CCACCATGCCTGGCCCATCCAGG + Intergenic
1083224232 11:61274490-61274512 CCACCATACCTGGCAAACACAGG + Exonic
1083409221 11:62480372-62480394 TCACTGTGCCTGGCAAAGTCAGG - Intronic
1083449158 11:62731039-62731061 CCACCATGCCTGGCTAATTTTGG + Intronic
1083549459 11:63575500-63575522 CCTCCATGCCTGGCAGGACCAGG - Intronic
1083586865 11:63866197-63866219 CCACCACGCCTGGCTAATTTTGG - Intronic
1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG + Intergenic
1083950516 11:65953181-65953203 CCACCACGCCTGGCTAATTTTGG + Intronic
1083951340 11:65958230-65958252 CCACCACGCCTGGCCAAATTGGG + Intronic
1084073800 11:66756483-66756505 CCACCATGCCTGGCTAATTATGG + Exonic
1084291042 11:68167882-68167904 CCACCATGCCTGGCCCACTTTGG - Intronic
1084388600 11:68860613-68860635 CTACCATGCCTGGCTAATTTTGG - Intergenic
1084572800 11:69969659-69969681 CCACCGTGCCTGGCCGCATCCGG - Intergenic
1084726858 11:70947506-70947528 CCACCATGCCTGGCTAATCCTGG + Intronic
1084897782 11:72287463-72287485 CCATCATGCCTGGCTAATTTTGG + Intergenic
1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG + Intergenic
1085212394 11:74792686-74792708 CCACCATGCCTGGCAAGAGTAGG + Intronic
1085252969 11:75155608-75155630 CCACCATGCCCGGCTAATTTTGG + Intronic
1085363974 11:75920310-75920332 CCACCACGCCTGGCTAATTTTGG + Intronic
1085542369 11:77284006-77284028 CCACCATGCCTGGCTAATTTTGG + Intronic
1085559971 11:77462677-77462699 GCACCATGCCTGGCTAATTTTGG - Intronic
1085575485 11:77599166-77599188 CCACCATGCCTGGCCACACCTGG + Intronic
1085698152 11:78722993-78723015 CTTGCATGCCTTGCAAAATCAGG - Intronic
1086158581 11:83695584-83695606 CCACCATGCCTAGCTAATTTTGG - Intronic
1086293372 11:85336565-85336587 CCACCATGACTGGCATCAGCAGG + Intronic
1086373573 11:86178282-86178304 CCACCACGCCCGGCCAGATCAGG - Intergenic
1086689494 11:89773036-89773058 CCACCATGACTGGCTAATTTTGG - Intergenic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1087043462 11:93824058-93824080 CCACCATGCCTGGCTAATTTTGG + Intronic
1087251340 11:95903825-95903847 CCACCATGCCTGGCCTAATGAGG - Intronic
1087654483 11:100905823-100905845 CCACCATTCCTGGCTAATTTTGG - Intronic
1087789613 11:102392390-102392412 CCACCACGCCTGGCTAAGTTTGG + Intergenic
1087938326 11:104061893-104061915 CCACCATGCCTGGCCGTTTCTGG + Intronic
1087985778 11:104677570-104677592 CCACCATGCCTGGCTAATGTTGG - Intergenic
1088054054 11:105554034-105554056 CCACCATGCCCAGCCAAATGAGG - Intergenic
1088288313 11:108209600-108209622 CCACCGTGCCTGGCCCAATGTGG - Intronic
1088456552 11:110038853-110038875 CCACCATGCCTGGCCAAGAAAGG - Intergenic
1088476245 11:110242298-110242320 CCACCATGTCTGGCTAATTTTGG - Intronic
1088610034 11:111568096-111568118 CCACCACGCCTGGCCAAAATTGG - Intergenic
1088680674 11:112239030-112239052 CCACCATGCCTGGCTAATTTTGG - Intronic
1089063943 11:115647889-115647911 CCACCATCCCTGGCTAAGTTTGG + Intergenic
1089206461 11:116767818-116767840 CCTCCATGCCTGGCTAATTTTGG - Intronic
1089381014 11:118031848-118031870 CCACCATGCCTGGCCGATGCTGG - Intergenic
1089420129 11:118325841-118325863 CCACCGTGCCTGGCCAGATATGG - Intergenic
1089430439 11:118419600-118419622 CCACCATGCCTGGCTAATTTTGG - Intronic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1089516055 11:119032313-119032335 CCACCAAGCCTGGCTAATTTTGG - Intergenic
1089723083 11:120447663-120447685 CCACCATGCCTGGCTAATTTTGG - Intronic
1090059558 11:123452356-123452378 CCACCATGCCTGGCCAAGGAAGG - Intergenic
1090092223 11:123708944-123708966 CCACCGTGCCTGGCTTGATCAGG + Intergenic
1091083006 11:132690225-132690247 TCACCATGCCTGGCCAAGCCAGG + Intronic
1091505229 12:1061012-1061034 CCACCACGCCTGGCCACATGTGG + Intronic
1091745623 12:2990910-2990932 CCACCATGCCTGGTCACAACTGG - Intronic
1091751910 12:3027712-3027734 CCACCATGCCTGGCTAATTTTGG - Intronic
1092078347 12:5691973-5691995 CCACCAGGCCTCACAAGATCTGG - Intronic
1092127219 12:6083410-6083432 CCACCACGCCTGGCTAATTTTGG - Intronic
1092182274 12:6453860-6453882 CCACCATGCCCGGCTAATTTTGG - Intronic
1092295408 12:7193384-7193406 CCACCATGCCCGGCTAATTTTGG + Intronic
1092425483 12:8372166-8372188 CCACCATGCCTGGCTAATTTTGG + Intergenic
1092493645 12:8969961-8969983 CCACCATACCTGGCTAACTTTGG - Intronic
1092686831 12:11058081-11058103 CCACCTTGCCTGGCTAATTTTGG - Intronic
1092692328 12:11127955-11127977 CCACCATGCCCGGCTAACTTTGG - Intronic
1092692553 12:11129996-11130018 ACACCATGCCTGGCTAATTTTGG - Intronic
1093191476 12:16079852-16079874 CCACCATGCCTGGCTAAATTTGG + Intergenic
1093298954 12:17429165-17429187 CGACCATGCCTGGCTAATTTTGG + Intergenic
1093474830 12:19543417-19543439 CCACCATGCCTGGCTAATTTTGG + Intronic
1093480109 12:19595620-19595642 CCACCGTGCCCGGCCATATCTGG + Intronic
1093592061 12:20914049-20914071 CCACCATGCCTGGCTTATTTTGG + Intronic
1093748610 12:22772391-22772413 CCACCGTGCCCGGCCAAAACAGG + Intergenic
1093963583 12:25302070-25302092 CCACCATGCCTAGCCAATCCTGG - Intergenic
1094019485 12:25898878-25898900 CCACCATGCCTGGCACACTTAGG + Intergenic
1094357199 12:29590497-29590519 CCACCATGCCTGGCCACACGTGG - Intronic
1094459996 12:30685770-30685792 CCACCATGCTTGGCTAATTTTGG - Intronic
1094642351 12:32288382-32288404 CCACCATACCTGGCTAATTTTGG + Intronic
1095107536 12:38253336-38253358 CCACCATGCCTGGTCAATGCAGG + Intergenic
1095723608 12:45427785-45427807 CCACCATGCCCGGCTAATTTTGG - Intronic
1096030797 12:48412928-48412950 CCACCATGCCTGGTTAATTTTGG + Intergenic
1096168827 12:49449499-49449521 CCACCGTGCCTGGCCCAGTCTGG + Intronic
1096661959 12:53131198-53131220 CCACCATGCATGGCCTATTCTGG + Intergenic
1096920042 12:55073997-55074019 CCACCACGCCTGGCTAATTTTGG + Intergenic
1097034247 12:56112239-56112261 CCACCATGCCTGGCTCAAAATGG + Intronic
1097160685 12:57044539-57044561 CCACCACGCCTGGCTAATTTTGG + Intronic
1097202511 12:57291364-57291386 CCACTGTGCCTGGCAAAAGATGG - Intronic
1097204062 12:57305030-57305052 CCACCACGCCTGGCTAATTTTGG - Intronic
1097690178 12:62727811-62727833 CCACCATGCCCGGCTAATTTTGG + Intronic
1098344382 12:69485753-69485775 CCACCATGCCTGACCTAAACAGG + Intronic
1098391586 12:69975312-69975334 CCACAGGGCCTGGCAAATTCTGG - Intergenic
1098434396 12:70453324-70453346 CCACCGTGCCTGGCCAAATTAGG - Intergenic
1098841076 12:75479081-75479103 CCACCATGCCAGGCTAATTTTGG + Intergenic
1098960157 12:76731629-76731651 CCACCATGCCCGGCTAATTTTGG + Intergenic
1099058694 12:77878376-77878398 CCACCATGCCTGGCTAATTTTGG + Intronic
1099338950 12:81402699-81402721 CCACCCTGCCTGGCTAATTTTGG - Intronic
1099619389 12:84981879-84981901 GCAGAATGCCTGGCAAAAGCAGG + Intergenic
1099977024 12:89556773-89556795 CCACCAGGCCTGGCTAATTCTGG + Intergenic
1100027185 12:90145067-90145089 CCAGCATGCCTGGCAACAGCAGG - Intergenic
1100255302 12:92877262-92877284 CCACCATTCCTGGCCTAACCTGG + Intronic
1100400643 12:94226235-94226257 CCACTCTGCCTTCCAAAATCAGG - Intronic
1100438234 12:94591601-94591623 CCACCATGCCTGGCTAATTTTGG - Intronic
1100438565 12:94594378-94594400 CCACCGTGTCTGGCAGAACCAGG + Intronic
1100499578 12:95160893-95160915 CCACCATGCCTGGCCACAAGTGG - Intronic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1100555691 12:95691546-95691568 CCACCACGCCTGGCTAATTGTGG + Intronic
1100597261 12:96082319-96082341 CCACCATGCCTGGCCAATTTTGG - Intergenic
1100612468 12:96202812-96202834 CCACCATGCCTGGCCACCACAGG + Intronic
1100636468 12:96439246-96439268 CCACCACTCCTGGCTAAATTTGG - Intergenic
1101006172 12:100403187-100403209 CCACCACGCCTGGCAGAAAGAGG - Intronic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1101485181 12:105150629-105150651 CCACCATGCCCGGCTAATTTTGG - Intronic
1101703481 12:107197679-107197701 CCACCATGCCTAGCTAAATGAGG + Intergenic
1102017778 12:109659407-109659429 CCACCATGCCCGGCAGAACTGGG - Intergenic
1102055129 12:109890864-109890886 CCACATTGCCTGGCAAAGCCTGG - Intergenic
1102086617 12:110146097-110146119 CCACCGTGCCCGGCCTAATCTGG + Intronic
1102087269 12:110152876-110152898 CCACCATGCCTGGCTTATTCGGG + Intronic
1102103289 12:110298430-110298452 CCACCACGCCTGGCCAAAACAGG - Intronic
1102246067 12:111356781-111356803 CCACCACACCCGGCAAAAGCAGG - Intergenic
1102312494 12:111857392-111857414 CCACCATGCCTGGCTATTTTGGG + Intronic
1102337550 12:112094810-112094832 CCACCATGCCCAGCTAAATTTGG + Intronic
1102362393 12:112299468-112299490 CCACCATGCCTGGCTAATTTTGG - Intronic
1102660332 12:114521530-114521552 CCACCATGCCCGGCTAATTTTGG - Intergenic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1102802800 12:115751261-115751283 CCACCATGCCTGGCCTAAGCAGG + Intergenic
1102916985 12:116761433-116761455 CCACCATGCCTGGCCCCATTAGG + Intronic
1103024968 12:117566270-117566292 CCACCACGCCTGGCTAATTTTGG + Intronic
1103130713 12:118466248-118466270 CCACCACGCCTGGCCAATTTCGG - Intergenic
1103262995 12:119604918-119604940 ACACCATGCCTGGCTAAGTTAGG + Intronic
1103395237 12:120602016-120602038 CCACCACGCCTGGCCAAATAGGG + Intergenic
1103547205 12:121710783-121710805 CCACCATGCCTGGCCAGAAAGGG + Intergenic
1103604668 12:122078282-122078304 CCACCACGTCCGGCAAACTCAGG + Intergenic
1104513695 12:129404482-129404504 CCACCATGCCCGGCCAAGACTGG + Intronic
1104787918 12:131461676-131461698 CTACCACGCCTGGCCAAACCAGG - Intergenic
1104789446 12:131472668-131472690 CCGCCATCACTGCCAAAATCAGG - Intergenic
1104849508 12:131864894-131864916 CCACCACGCCTGGCTAATACGGG - Intergenic
1104867503 12:131966749-131966771 CCACCATGCCCGGCTAATTGTGG - Intronic
1105404374 13:20121145-20121167 CCACCATGCCCGGCTACCTCCGG + Intergenic
1105452105 13:20509039-20509061 CCACCACGCCTGGTTAAATTTGG - Intronic
1105491769 13:20895023-20895045 CCACCATGCCTGGCTAATTTTGG - Intronic
1105508962 13:21035508-21035530 CCATCAAGCCAGGCAAAATTGGG + Intronic
1105533743 13:21244452-21244474 CCACCACGCCCGGCCAAATATGG + Intergenic
1106247025 13:27959259-27959281 CCACCATGCCCGGCTAATTTTGG - Intergenic
1106685562 13:32055328-32055350 CCACCATGCCTGGCCTAAGATGG + Intronic
1106781126 13:33060114-33060136 CCACCATGCCGGGCCAAGACGGG + Intronic
1106936550 13:34728665-34728687 CCACCATGCCTGGCCCATTTTGG - Intergenic
1107046529 13:35998965-35998987 CCACCATGCCTGGCCTATTTGGG - Intronic
1107463453 13:40627678-40627700 CCACCATGCCTGGCTAATTTTGG - Intronic
1107532993 13:41302180-41302202 CCACCATGTCTGGCTAATTTTGG + Intergenic
1107556957 13:41524699-41524721 CCACCATGCCTGGTAAATTATGG - Intergenic
1107794121 13:44032275-44032297 CCACCATGCCTGGCCTCATTAGG + Intergenic
1107963444 13:45578763-45578785 CCACCGTGCCTGGCCAGATTTGG - Intronic
1108087517 13:46809662-46809684 CCACCGTGCCTGGCCAGATCTGG - Intergenic
1108114033 13:47108557-47108579 CCACCGTGCCCGGCCACATCTGG + Intergenic
1108362643 13:49681441-49681463 CCACCACGCCTGGCTAATTTTGG + Intronic
1108402177 13:50057046-50057068 CCACCATGCCTGGCGAAACATGG + Intergenic
1108554351 13:51578472-51578494 CCACCATGCCTGGCTAATTTTGG - Intergenic
1108597134 13:51959354-51959376 CCACCATGCCTGGCTAGATAGGG - Intronic
1108827725 13:54435124-54435146 CCACCACGCCTGGCCAAAGATGG + Intergenic
1109090376 13:58035900-58035922 CCACCATGCCTGGCCAGCTTAGG + Intergenic
1109177343 13:59172973-59172995 CCACCATGCCTGGCATCACCTGG - Intergenic
1109273542 13:60280100-60280122 ACACCATGCCTGGCTAATTTTGG - Intergenic
1109344537 13:61099107-61099129 CCACCACGCCTGGCTAATTTTGG + Intergenic
1109347145 13:61127359-61127381 CCACCATGCCTGGCCAAATCAGG + Intergenic
1109564603 13:64095678-64095700 CCACCATGCCTGGCTAATTTTGG - Intergenic
1111014156 13:82355434-82355456 CCACCATGCCAGGCTAATTTTGG + Intergenic
1111177094 13:84608893-84608915 CCACCATGCCTGGCCTCATGGGG + Intergenic
1111626467 13:90794246-90794268 CCACCATGCCTGGCCAGACAGGG + Intergenic
1111646692 13:91040429-91040451 CCACCATGCCTGGTCATATGTGG - Intergenic
1111732568 13:92095685-92095707 CCACCATGCCCGGCTAATTTTGG + Intronic
1111991841 13:95124402-95124424 CCACCATGCCTGGCAGCAGTGGG - Intronic
1112005897 13:95253455-95253477 CCATCATGCCAGGCCAAATTTGG - Intronic
1112124486 13:96449247-96449269 CCACTGTGCCTGGCATAATCTGG + Intronic
1112356749 13:98679851-98679873 CCACCATGCCTGGCTAATTTTGG - Intergenic
1112590117 13:100755611-100755633 CCACCATGCCTGGCCATATTCGG - Intergenic
1113018576 13:105856609-105856631 CCACCACGCCTGGCACAGGCCGG + Intergenic
1113053101 13:106236562-106236584 CCACCATGCCTGGCCCTCTCTGG + Intergenic
1113080817 13:106518050-106518072 CCACCACGCCTGGCAACATAAGG - Intronic
1113954385 13:114089392-114089414 CCTCCATGCCAGGGAAGATCAGG - Intronic
1114040715 14:18676057-18676079 CCACCATGCCTGGTTAACTTTGG + Intergenic
1114045753 14:18874562-18874584 CCACCATGCCTGGTTAACTTTGG + Intergenic
1114118458 14:19644909-19644931 CCACCATGCCTGGTTAACTTTGG - Intergenic
1114290979 14:21288331-21288353 CCACCATGCCTGGCTAGTTTTGG + Intronic
1114300906 14:21376918-21376940 CTACCATGCCTGGCTAATCCAGG - Intronic
1114488794 14:23082890-23082912 CCACCATACCTGGCTAATTTCGG + Intronic
1114632565 14:24168788-24168810 CCACCATGCCTGGCCTCACCTGG - Intergenic
1114858933 14:26491135-26491157 CCACCGTGCCCGGCCACATCTGG + Intronic
1115058928 14:29167773-29167795 CCACCATGCCTGTCCAAGGCTGG - Intergenic
1115154395 14:30321555-30321577 CCATCATGCCAAGGAAAATCTGG + Intergenic
1116007731 14:39314096-39314118 CCACCATGCCCGGCCAGATGTGG - Intronic
1116020463 14:39454045-39454067 CCACCATGCCTGGCTAGTTTTGG + Intergenic
1116881736 14:50177165-50177187 CCACCACGCCTGGCTAATTTTGG - Intronic
1116998736 14:51351133-51351155 CCACCATGCCCGGCTAATTTTGG - Intergenic
1117049418 14:51845337-51845359 CCACCATGCCTGACTAATTTTGG - Intronic
1117232044 14:53729820-53729842 CCACCACGCCTGGCTAATTTTGG - Intergenic
1117348045 14:54853249-54853271 CCACCATGCCTGGCCTTATGGGG + Intronic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1117415316 14:55490202-55490224 CCACCATGCCTGGCCATCTCAGG + Intergenic
1117685778 14:58251436-58251458 CCACCATGCCTGGCTAAGCCAGG + Intronic
1118020012 14:61701833-61701855 CCACCACGCCTGGCTAATTTTGG - Intronic
1118195571 14:63622612-63622634 CCACCATGCCTGGCTACTTTTGG - Intronic
1118264476 14:64281283-64281305 GAACCATGCCTGGCAACATCAGG - Intronic
1118505082 14:66402429-66402451 CCACTATCCCTGGGAACATCTGG + Intergenic
1118612366 14:67551734-67551756 CCACCACGCCTGGCTAATTTTGG - Intronic
1118658804 14:67984222-67984244 CCACCATGCCTGGCCAGGGCTGG + Intronic
1118740396 14:68735436-68735458 CCACCATACCTGGCCATCTCTGG - Intergenic
1118994908 14:70826930-70826952 CCACCGTGCCTGGCCCAATTTGG - Intergenic
1119349095 14:73949644-73949666 CCACCACGCCCGGCCAAATTTGG + Intronic
1119371342 14:74146969-74146991 CCACCATGCCTGGCCTCATGTGG - Intronic
1119462340 14:74817765-74817787 CCACCATGCCAGGCCATAACAGG - Intronic
1119496819 14:75086751-75086773 CCACCATGCCCGGCTAATTTTGG - Intronic
1120127137 14:80758232-80758254 CCACCATGCCTGGCAGGTTAAGG - Intronic
1120233631 14:81866212-81866234 CCACCGTGCCTGGCCAGATGTGG + Intergenic
1120501327 14:85300647-85300669 CCACCATGCCTGGCCAGATATGG - Intergenic
1120955373 14:90077406-90077428 CCACCATGCCCGGCCAATCCTGG + Intronic
1121008586 14:90506314-90506336 CCACCATGCCCGGCTAATTTTGG - Intergenic
1121067352 14:90980882-90980904 CCACCACGCCTGGCAATATAAGG - Intronic
1121068979 14:90999053-90999075 CCACCATGCCCAGCTAATTCGGG - Intronic
1121275200 14:92662644-92662666 CCACCAAGCCTAGCAAACCCAGG - Intronic
1121331267 14:93051187-93051209 CCCCCATGCCTGGGAAATTGAGG - Intronic
1121349343 14:93161093-93161115 CCACCATGCCTGGCTAATTTTGG - Intergenic
1121540887 14:94725545-94725567 CCACCATGCCTGGCTAATTTTGG + Intergenic
1121569072 14:94933010-94933032 CCACCATGCCCGGCTAATTTTGG + Intergenic
1122225334 14:100273439-100273461 CCACCATGCCTGGCTGATTTTGG + Intronic
1122470318 14:101961885-101961907 CCACCACACCTGGCCAAATGTGG + Intergenic
1122497200 14:102166150-102166172 CCACCACGCCTGGCAGAGACCGG + Intronic
1123037391 14:105477077-105477099 CCACCCTGCCCGGCAGAATCTGG - Intronic
1202939245 14_KI270725v1_random:129400-129422 CCACCATGCCAGGCTAATTTTGG - Intergenic
1123425362 15:20166564-20166586 CCACCATGCCCGGCCCACTCTGG - Intergenic
1123534585 15:21173096-21173118 CCACCATGCCCGGCCCACTCTGG - Intergenic
1123807653 15:23891205-23891227 CCACCATGCCTGGCTACTTTTGG - Intergenic
1123818776 15:24005535-24005557 CCACCATGCCCGGCTAATTTTGG + Intergenic
1123917163 15:25043058-25043080 CCACCATGCCTGGCATCATTAGG + Intergenic
1124032359 15:26023092-26023114 CCACCATGCCCGGCTAATTTGGG + Intergenic
1124548805 15:30657997-30658019 CCACCATGCCTGGCCACACATGG + Intronic
1125133271 15:36309921-36309943 CCACCATGCCTGGCTAATCTTGG + Intergenic
1125342297 15:38686890-38686912 CCACCATGCCTGGTAAAACATGG - Intergenic
1125630846 15:41145801-41145823 CCACCATGCCTGGCCGAGCCTGG - Intergenic
1125822378 15:42643347-42643369 CCACCATGCCTGGCTAATTTTGG + Intronic
1125832345 15:42725828-42725850 CCACCACGCCTGGCTAATTTTGG - Intronic
1125857322 15:42962775-42962797 CCACCACGCCTGGCCAACACTGG + Intronic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1126017504 15:44366479-44366501 CCACCATGCATGGCTAATTGTGG - Intronic
1126165961 15:45653967-45653989 CCACCATGCCTGGCTAATTTTGG - Intronic
1126392656 15:48176761-48176783 CTACCATGCTTGCCAAAATGTGG - Intronic
1126414595 15:48404654-48404676 CCACCATACCTGGCTAATTTGGG + Intergenic
1126527837 15:49677440-49677462 CCACCATGCCTGGCTTGAACTGG + Intergenic
1126606174 15:50478900-50478922 CCACCACGCCTGGCTAATTTTGG - Intronic
1126614414 15:50562181-50562203 CCACCATGCCCGGCTGAATTAGG + Intronic
1126636591 15:50786116-50786138 CCACCATGCTTGGCTAATTTTGG + Intergenic
1126770372 15:52049898-52049920 CCACCACGCCTGGCAAATTAAGG + Intronic
1127085852 15:55423935-55423957 CCACCATGCCCGGCTAATTTTGG - Intronic
1127360495 15:58240873-58240895 CCACCATGCCTGGCCGACCCAGG - Intronic
1127698929 15:61478270-61478292 CCAAGAGGCCTTGCAAAATCCGG + Intergenic
1127822097 15:62667251-62667273 CCACCGTGCCTGGCGAACACTGG + Intronic
1127979986 15:64027414-64027436 CCACCATACCTGGCTAATTTTGG - Intronic
1128050613 15:64661112-64661134 CCACCATGTCTGGCTAATTTTGG + Intronic
1128259587 15:66223568-66223590 CCACCACGCCTGGCTAATTTTGG - Intronic
1128270453 15:66304746-66304768 CCACCATGCCTGGCTAATTTTGG - Intronic
1128398168 15:67250462-67250484 CCACCATGCCTGGCACATGGAGG + Intronic
1128630455 15:69260545-69260567 CCACCGTGCCTGGCCACAACTGG + Intronic
1128704291 15:69827446-69827468 CCACCATGCCTAGCCCAATAAGG + Intergenic
1128754856 15:70174906-70174928 CCACCATGCCTGGCTAATTTTGG + Intergenic
1129015352 15:72462908-72462930 CCACCATGCTTGGCCAGCTCAGG + Intergenic
1129099703 15:73248751-73248773 CCACAATGCCCGGCAAAAGAAGG + Intronic
1129260955 15:74367001-74367023 CCACCATGCCTGGCCAGACCTGG + Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1129789460 15:78331266-78331288 CCACCATGCCCAGGACAATCTGG - Intergenic
1129928507 15:79387078-79387100 CCACCATGCCTGGCTAATTATGG + Intronic
1129939143 15:79478664-79478686 CCACCATGCCCGGCCAATTTTGG - Intergenic
1130016419 15:80189963-80189985 ACACCATGCCTGGCAATTTTGGG + Intergenic
1130638570 15:85648684-85648706 CCACCATGTCTGGCTAATTTTGG - Intronic
1130875858 15:88013712-88013734 CCACAGTGCCTGGCCAAGTCAGG - Intronic
1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG + Intergenic
1130962208 15:88668365-88668387 CCACCACACCTGGCTAATTCTGG - Intergenic
1131240983 15:90743147-90743169 CCACCATGCCTGGCTAAAGATGG + Intronic
1131245930 15:90792952-90792974 CCACCATGCCTGGCCATGTTTGG - Intronic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1131318951 15:91368016-91368038 CCACCACGCCTGGCTAATTTTGG + Intergenic
1131516888 15:93084758-93084780 CCACCGTGCCTGGCTATCTCAGG + Intronic
1132201587 15:99958059-99958081 CCACCACGCCTGGCTAATTTTGG + Intergenic
1132233756 15:100203744-100203766 CCACCATGCCTGGCTAATTTGGG - Intronic
1132489285 16:216845-216867 CCACCACGCCTGGCTAACTCTGG + Intronic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132575994 16:664445-664467 CCACCAGGGCTGGGAAATTCGGG + Intronic
1132753466 16:1470282-1470304 CCACCATGCCTGGCTCAAAATGG + Intronic
1132795069 16:1716448-1716470 CCACCACGCCTGGCTAATTTTGG + Intronic
1132855219 16:2041893-2041915 CCACCACGCCTGGCCACACCCGG + Intronic
1133149235 16:3814542-3814564 CCACCACGCCTGGCCATAACTGG + Intronic
1133178221 16:4032342-4032364 CCACCAGGAATGGCAAGATCTGG + Intronic
1133197647 16:4182889-4182911 CCACCATGCCCGGCTAATTTAGG - Intergenic
1133211726 16:4267012-4267034 CCACCAAGCCTGGCTAATTATGG + Intronic
1133228757 16:4356238-4356260 CCACCATGCCTGGCCACACCTGG + Intronic
1133408312 16:5545127-5545149 CCACCATGCCTGGCTAATTTTGG + Intergenic
1133558778 16:6930560-6930582 CCACCATGCCTGGCTAATTTTGG + Intronic
1133753716 16:8745542-8745564 CCACCATGCCTGGCTAATTTTGG - Intronic
1133753857 16:8746531-8746553 CCACCACGCCTGGCTAATTTTGG + Intronic
1133800725 16:9082904-9082926 CCACCATGCCGGGCTAATTTTGG + Intergenic
1133855915 16:9549099-9549121 CCACCATGCCTGGCCAAGAATGG + Intergenic
1133870100 16:9677942-9677964 CCACCATGCCTGGCTAATTTTGG - Intergenic
1133940129 16:10302269-10302291 CCACCACGCCTGGCTAATTTTGG - Intergenic
1134060771 16:11198295-11198317 CCACCCTGCCTGGCGAATTTTGG - Intergenic
1134170823 16:11968187-11968209 CCACCGCGCCTGGCCAAAACTGG - Intronic
1134180763 16:12045909-12045931 CCACCGTGCCTGGCCAAGGCAGG + Intronic
1134191829 16:12127572-12127594 CCACCATGCCCGGCTAATTTTGG + Intronic
1134239564 16:12495433-12495455 CCACCATGCCTGGCGTCATCTGG + Intronic
1134253098 16:12588540-12588562 CCACCATGCCTGGCTGGATCTGG - Intergenic
1134326946 16:13216032-13216054 CCACCACGCCTGGCTAATTTTGG - Intronic
1134391145 16:13821304-13821326 CCACCATGCCTGGCTAATTTTGG + Intergenic
1134414834 16:14034324-14034346 CCACCATGCCTGGCCAAAGATGG - Intergenic
1134489437 16:14685217-14685239 CCACCATGCCTGGGTAATTTTGG - Intronic
1134536425 16:15030255-15030277 CCACCATGCCCGGCCAATTCAGG - Intronic
1134584942 16:15402253-15402275 CCTTAAGGCCTGGCAAAATCAGG + Intronic
1134642010 16:15836875-15836897 CTACCATGCCTGGCTAATTTTGG + Intronic
1134660896 16:15983706-15983728 CTACCATGCCTGGCTAATTTTGG + Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135026077 16:19000065-19000087 CCACCACGCCGGGCAGAGTCCGG + Intronic
1135062079 16:19279603-19279625 CCACCATGCCTGGCTAATTTTGG + Intergenic
1135094448 16:19553756-19553778 CCACCATGCCTGGCTAATATCGG - Intergenic
1135139800 16:19911705-19911727 CCACCATGGCTGGCTAATTTTGG - Intergenic
1135307511 16:21379672-21379694 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1135396001 16:22132094-22132116 CCACTGTGCCTGGCTACATCTGG - Intronic
1135466403 16:22689421-22689443 CCACCATGCCTGGCCTATTTTGG + Intergenic
1135548941 16:23383799-23383821 CCACCACGCCTGGCCCTATCTGG + Intergenic
1135566373 16:23514257-23514279 CCACCATGCCTGGCTAATTTTGG + Intronic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1135744343 16:25003385-25003407 CCACAATGCCTGGCTAATTTTGG + Intronic
1135799220 16:25476921-25476943 CCACCATGCCTGGCCCAAAGCGG + Intergenic
1135829722 16:25762561-25762583 CCACCATGCCTGGCCACGTTTGG - Intronic
1136020270 16:27435739-27435761 CCACCATGCCAGGCCCAAACAGG + Intronic
1136089840 16:27910858-27910880 CCACCACGCCTGGCAAGTTTTGG - Intronic
1136090286 16:27914674-27914696 CCACCATGCCTGGATAATTTAGG + Intronic
1136113845 16:28082083-28082105 CCACCATGCCTTGCTAATTTTGG - Intergenic
1136304256 16:29358792-29358814 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1136353799 16:29730020-29730042 CTACCATGCCTGGCCAATTTTGG - Intergenic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1136558391 16:31023159-31023181 CCACCACGCCTGGCTAATTTTGG - Intergenic
1136580026 16:31145827-31145849 ACAGCATCCCTGGCAATATCTGG + Exonic
1136591155 16:31218526-31218548 CCACCACGCCTGGCTAATTTTGG - Intronic
1136859503 16:33689163-33689185 CCACCATGCCCGGCCCACTCTGG + Intergenic
1137266624 16:46874268-46874290 ACACCATGCCTGGCTAATTTTGG - Intergenic
1137440342 16:48493541-48493563 CCACCGTGCCTGGCCAACTTAGG - Intergenic
1137625088 16:49902671-49902693 CCACCATGCCTGGCCAACAATGG - Intergenic
1137630182 16:49937775-49937797 CCACCATGCCTGGCCAATCCAGG + Intergenic
1137655910 16:50157916-50157938 CCACCATGCCTGGCTCATTTTGG + Intronic
1137841981 16:51649322-51649344 CCACCATGCCTGGCTAATTTTGG + Intergenic
1138046677 16:53732336-53732358 CCACCATGCCTGGCCCATTGTGG + Intronic
1138061093 16:53891141-53891163 CCACCATGCCTGGCTAATTTTGG + Intronic
1138085838 16:54133029-54133051 CCACCATGACTGGCTAATTTTGG - Intergenic
1138444789 16:57056809-57056831 CCACCATGCCTGGCTAATTTTGG + Intronic
1138500930 16:57443736-57443758 CCACCGTGCCTGGCCAATTTTGG + Intronic
1138525974 16:57607431-57607453 CCACCATGCCTGGCCAGCACTGG - Intergenic
1138698122 16:58834614-58834636 TCACCATGCCTGGCTAATTTTGG - Intergenic
1138727924 16:59161284-59161306 CCACCATGCCTGGCTAATTTTGG + Intergenic
1138754420 16:59465895-59465917 CCACCATGCCTGGCCACAACAGG + Intergenic
1138810483 16:60144164-60144186 CCACCATGCCTGGTTAACTTTGG - Intergenic
1139398800 16:66663351-66663373 CCACCATGCCTGGCTAATCTTGG - Intronic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139609210 16:68042993-68043015 CCACCATGCCCAGCCACATCTGG + Intronic
1139743340 16:69054397-69054419 GCACCATGCCTCTTAAAATCAGG - Intronic
1139764374 16:69214677-69214699 CCACCACGCCTGGCTAATTTTGG + Intronic
1139828259 16:69774815-69774837 CCACCATGCCTGGCTAATTTTGG - Intronic
1139859644 16:70010531-70010553 CCACCATGCCCGGCCAATTCAGG + Intergenic
1140149527 16:72348198-72348220 CCACCACGCCTGGCTAATTTGGG - Intergenic
1140386692 16:74546547-74546569 CCACCACGCCTGGCCTAGTCAGG - Intronic
1140757212 16:78078505-78078527 GCACCATGCCTGGCTAATCCAGG - Intergenic
1140960383 16:79906433-79906455 CCACCATGCCTGGCCACATGTGG - Intergenic
1141006466 16:80357439-80357461 CCACCATGGCTGGCTAATTTTGG - Intergenic
1141520787 16:84577530-84577552 CCACCATGCCTGGCCGGAACAGG + Intronic
1141662840 16:85450771-85450793 CCACCGTGCCCGGCCAAACCTGG - Intergenic
1141712320 16:85707197-85707219 CCACCATGCCTGGCCACAAATGG - Intronic
1141859121 16:86704570-86704592 CGAGCATCCCTGGTAAAATCAGG - Intergenic
1142163852 16:88574494-88574516 CCACCACGCCTGGCCAGATTTGG + Intronic
1142193902 16:88730717-88730739 CCACCATGCCCAGCCAAATACGG + Intronic
1142470254 17:159336-159358 CCACCACGCCTGGCTAATTTTGG - Intronic
1142517130 17:439543-439565 CCACCATACCTGGCTAATTTTGG + Intergenic
1142732400 17:1869247-1869269 CCACCATGCCCGGCCGAAACAGG - Intronic
1142874976 17:2846561-2846583 CCACCATGCCTGGCCAACTTTGG + Intronic
1143123291 17:4623755-4623777 CCACCAGGCCTGGCTAATTTTGG + Intergenic
1143218933 17:5245362-5245384 CCACCATGCCTGGCCTACTTTGG - Intergenic
1143222750 17:5276274-5276296 CCACCATGCCCGGCTAATTAAGG - Intergenic
1143421164 17:6793595-6793617 CCACCGTGCCTGGACAAATTTGG + Intronic
1143466156 17:7138080-7138102 CCACCATGCCCGGCTAATTTTGG + Intergenic
1143533354 17:7519505-7519527 CCACCATGCCTGGCCAACTTAGG + Intergenic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1143682722 17:8489414-8489436 CCACCATGCCCGGCCAGATTTGG - Intronic
1143695484 17:8612696-8612718 CCACCACGCCTGGCTAATTTTGG - Intronic
1143836004 17:9693546-9693568 CCACCATGCCTGGCTGAATTTGG - Intronic
1143851703 17:9817710-9817732 CCACCATACCTGGCCCAATGAGG + Intronic
1143864868 17:9916602-9916624 CCACCATGCCTGGAGAGGTCAGG - Exonic
1144123853 17:12182792-12182814 CCACCACGCCTGGCCAATTTTGG + Intergenic
1144144285 17:12382250-12382272 CCACCACGCCTGGCTAAACTGGG - Intergenic
1144313725 17:14038905-14038927 CCACCACGCCCGGCCCAATCAGG - Intergenic
1144547043 17:16206671-16206693 TCACCATGCCTGGCAAATTATGG + Intronic
1144560723 17:16318643-16318665 CCACCACACCTGGCCAAAGCTGG - Intronic
1144664753 17:17094761-17094783 CCACCATGCCTGGCTAATTTTGG + Intronic
1144747891 17:17627790-17627812 CCACCATGCCTGGCCTCACCTGG + Intergenic
1145020668 17:19428108-19428130 CCACCATGCCTGGCTAATTTTGG + Intergenic
1145020772 17:19429065-19429087 CCACCATGCCTGGCTAATTTTGG + Intergenic
1145092297 17:19995902-19995924 TCACCACGCCTGGCCAACTCTGG + Intergenic
1145206796 17:20988760-20988782 CCACCACGCCTGGCTAATTTTGG - Intergenic
1145350941 17:22082616-22082638 TCACCGTGCCTGGCAAATTATGG + Intergenic
1145409242 17:22641889-22641911 CCACCATGCCTGGTGACATTGGG + Intergenic
1145872859 17:28290036-28290058 CCACCATGCCTGGCCACAGATGG - Intergenic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1145954282 17:28843733-28843755 TCACCATGCCTGGTAAAATTTGG + Intronic
1145979277 17:29002307-29002329 CTACCATGCCTGCCTAAATATGG - Intronic
1146247548 17:31302690-31302712 CCACCACGCCTGGCTAATTTTGG - Intronic
1146363382 17:32197713-32197735 CCACCGTGCCTGGCCACACCCGG + Intronic
1146391453 17:32427253-32427275 CCACCATGCCCGGCTAATTTTGG + Intergenic
1146454456 17:32998068-32998090 CTACCACACCTGGCAAAATTTGG + Intergenic
1146851925 17:36229274-36229296 CCACCACGCCTGGCTAATTTTGG - Intronic
1146867835 17:36353147-36353169 CCACCACGCCTGGCTAATTTTGG - Intronic
1146975033 17:37103887-37103909 TCACCATGCCTGGCTAATTTTGG - Intronic
1147003001 17:37378423-37378445 CCACCATGCCTGGCCAAAGCTGG - Intronic
1147070709 17:37953764-37953786 CCACCACGCCTGGCTAATTTTGG - Intergenic
1147082236 17:38033290-38033312 CCACCACGCCTGGCTAATTTTGG - Intronic
1147098181 17:38157255-38157277 CCACCACGCCTGGCTAATTTTGG - Intergenic
1147271899 17:39278990-39279012 CCACCATGCCTGGCTAATTTTGG - Intronic
1147378856 17:40040229-40040251 CCACCATGCCCGGCTAATTTTGG + Intronic
1147497200 17:40928041-40928063 GCACAATGCCTGGCACCATCGGG + Intronic
1147609182 17:41791760-41791782 CCACCATGCCTGGCCGATCCTGG + Intergenic
1147617533 17:41838537-41838559 CCACTGTGCCTGGCCAACTCTGG + Intronic
1147623924 17:41886969-41886991 CCACCACGCCTGGCTAATTTTGG - Intronic
1147682064 17:42255933-42255955 CCACCATGCCTGGCTAATTTTGG - Intronic
1147734448 17:42626290-42626312 CCACCACGCCTGGCTAATTTTGG + Intergenic
1147766301 17:42838603-42838625 CCACCATGCCTGGCCAGACTAGG + Intronic
1147778410 17:42920703-42920725 CCACCATGCCTGGCTAATTTTGG + Intergenic
1147844205 17:43393498-43393520 CCACCATGCCCGGCTAATTTTGG - Intergenic
1147855835 17:43479157-43479179 CCATCATGCCTGGCTAATTTTGG + Intergenic
1147870860 17:43586516-43586538 CCACCATGCCTGGCCTAGGCAGG - Intergenic
1147917762 17:43898810-43898832 CCACTATGCCTGGCTAATTTTGG - Intronic
1147950324 17:44103993-44104015 CCACCATGCCTGGCCTTCTCAGG + Intronic
1147983369 17:44289015-44289037 CCACCATGCCCGGCTAAATTTGG + Intergenic
1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG + Intergenic
1148061106 17:44837060-44837082 CCACCATGCTGGCCAATATCGGG - Intergenic
1148288751 17:46421216-46421238 CCATCACGCCTGGCCAAATGAGG + Intergenic
1148310920 17:46638793-46638815 CCATCACGCCTGGCCAAATGAGG + Intronic
1148639712 17:49177706-49177728 CCACTGTGCCCGGCAGAATCTGG - Intergenic
1148800608 17:50222751-50222773 CCACCGTGCCTGGCAAATCTTGG - Intergenic
1148886197 17:50774733-50774755 CCACTGTGCCTGGCAAAGTTAGG - Intergenic
1148925910 17:51085001-51085023 CCACCATGCCTGGCTAATTTTGG + Intronic
1148947026 17:51271953-51271975 CCACCATGCCTGGCCTATTGGGG + Intronic
1149440220 17:56667630-56667652 CCACCATACCTGGCCTAGTCTGG + Intergenic
1149620659 17:58042548-58042570 CCACCATGTCTGGCTAATTTTGG + Intergenic
1149741923 17:59054951-59054973 CCACCACACCTGGCTAAATAGGG + Intronic
1149770258 17:59315333-59315355 CCACCATGCCTGGCCACTTGTGG + Intergenic
1149779413 17:59385423-59385445 CCACCATGCCTGGCTAATTTTGG - Intronic
1149825335 17:59823160-59823182 CCACCATGCCTGGCCCATTCAGG - Intronic
1149930925 17:60754355-60754377 CCACCATACCTGGCTAATTACGG + Intronic
1150111587 17:62504994-62505016 CCACCATGCCTGGCTAATTTTGG + Intronic
1150167115 17:62954730-62954752 CCACCACGCCTGGCTAATTTTGG + Intergenic
1150688473 17:67341314-67341336 CCACCATGCCTGGCTAATTTTGG - Intronic
1150774622 17:68069484-68069506 CCACCGTGCCTGGCTCAACCTGG + Intergenic
1151334756 17:73433437-73433459 CCACCATGCCCGGCTAATTTTGG + Intronic
1151584533 17:75001079-75001101 CCACCATGCCTGGCTAATTTTGG - Intronic
1151586932 17:75014732-75014754 CCACCATGCCCAGCCAAGTCTGG + Intronic
1151796378 17:76349021-76349043 CCACCACGCCTGGCCAAAAATGG - Intronic
1151941131 17:77292644-77292666 CCACCATGCCTGGCCAATTTTGG + Intronic
1151949386 17:77341620-77341642 CCACCACGCCTGGCTAATTTTGG - Intronic
1152102050 17:78307668-78307690 CCACCATGCCCGGCCTAATTAGG + Intergenic
1152440413 17:80305329-80305351 CCACCACGCCTGGCTAATTTAGG + Intronic
1152510626 17:80784849-80784871 CCACCACGCCTGGCTAATGCTGG + Intronic
1152746915 17:82044749-82044771 CCACCACGCCCGGCCAAACCCGG + Intergenic
1152763282 17:82121096-82121118 CCACCATGCCTGGCAACGGCTGG - Intronic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153060359 18:988817-988839 CCACCATGCCTGGCTAATTTTGG + Intergenic
1153198492 18:2626109-2626131 CCACCATGCCTGGCTAATTTGGG + Intergenic
1153334169 18:3905078-3905100 CCACCATGCCCGGCCTATTCAGG - Intronic
1153452347 18:5243779-5243801 CCACCATGCCCGGCTAATTTTGG - Intergenic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1153832815 18:8938241-8938263 CCACCATGCCTGGCCACAGGTGG - Intergenic
1153888065 18:9485222-9485244 CCACCATGCCTGGCAACTGTGGG + Intronic
1154235047 18:12597295-12597317 CCACCAGGCCCAGAAAAATCTGG - Intronic
1154308474 18:13248111-13248133 CCACCATGCCTGGCTAATTTTGG + Intronic
1154530715 18:15341976-15341998 CCACCATGCCCGGCTAATTTTGG + Intergenic
1154952763 18:21226380-21226402 CCACCATACCTGGCTAATTTTGG + Intergenic
1155133171 18:22959783-22959805 CTAGCATTCCTGGAAAAATCTGG - Intronic
1155306014 18:24479068-24479090 CCACCATGCCTGGCTAATTTTGG + Exonic
1155307805 18:24496125-24496147 CCACCATGGCTGGCTAATTTTGG + Intergenic
1155408874 18:25519905-25519927 CCACCGTGCCCGGCCACATCTGG + Intergenic
1155474567 18:26225403-26225425 GCACTATGCCTAGCAAAAACGGG - Intergenic
1155613076 18:27690791-27690813 CCACCATGCCTGGCCAGAAATGG + Intergenic
1155773658 18:29731357-29731379 CCACCACGCCTGGCTAATTTTGG - Intergenic
1155973430 18:32102916-32102938 CCACCATGCCTGGCCAATTTGGG + Intronic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156261596 18:35449408-35449430 CCACCATGCCTGGCTAATTTTGG - Intronic
1156505704 18:37590231-37590253 CCACCATGCCTGGCCAACTCTGG + Intergenic
1156703193 18:39848971-39848993 CCTCCATGCCTGGCCAAACAGGG - Intergenic
1157064482 18:44331642-44331664 CCAGCATGGCTGGAAAAAACAGG + Intergenic
1157207478 18:45712871-45712893 CCACCATGCCTGGCCAAAGGAGG + Intergenic
1157253428 18:46116406-46116428 CCACCATGCCTGGCTAATTTTGG - Intronic
1157642571 18:49232759-49232781 CCACCACGCCTGGCTAATTTTGG + Intronic
1157681652 18:49612173-49612195 CCAGCATCCCTGGCATCATCTGG - Intergenic
1157748943 18:50161229-50161251 CCACCATGCCCGGCTAATTTTGG - Intronic
1157996087 18:52557810-52557832 CCACCATGCCTGGCTAATTTTGG + Intronic
1158136980 18:54218807-54218829 CCACCACGCCTGGCTAATTTTGG - Intronic
1158231711 18:55263487-55263509 CCACTATGCCTGGCTAAGGCAGG + Intronic
1158285058 18:55871352-55871374 CCACCATGCCTGGATAATTTTGG + Intergenic
1158426913 18:57348493-57348515 ACACCATGCTTGGCAGACTCAGG - Intergenic
1158560993 18:58513587-58513609 CCACCATGCCTGGCAAATTTGGG - Intronic
1158596450 18:58820747-58820769 CCACCATGCCTGACAAATTTTGG + Intergenic
1158600207 18:58850088-58850110 CCACCACGCCTGGCTAATTTTGG + Intergenic
1158625926 18:59071656-59071678 CCACCATGCCTGGCTAATTTTGG + Intergenic
1158714974 18:59870495-59870517 CCATCATGCCTGGCTAATTTTGG + Intergenic
1159141290 18:64398394-64398416 CCACCATGCCAGGCACATTGTGG - Intergenic
1159253322 18:65910039-65910061 CCACCATGCCTGGCCAGTTTAGG + Intergenic
1159509032 18:69372406-69372428 CCACCATGCCCAGCCAAATGTGG - Intergenic
1160078217 18:75698593-75698615 CCACCACGCCCGGCCAAATGTGG - Intergenic
1160205313 18:76826644-76826666 CCACCATGCCTGGCTAACTTTGG - Intronic
1160445919 18:78926609-78926631 CCACCGTGCCTGGCAATTTCCGG - Intergenic
1160724523 19:611856-611878 CCACCACGCCTGGCCATATGTGG - Intronic
1160753155 19:744604-744626 CCACCATGCCTGGCCATTACAGG - Intronic
1160842711 19:1153688-1153710 CCACCACGCCTGGCTAAGTTTGG + Intronic
1160997576 19:1890588-1890610 CCACCATGCCTGGCAATTGTTGG + Intergenic
1161095734 19:2389519-2389541 CCAACATGCCTGGCTAATTTTGG + Intergenic
1161127010 19:2563632-2563654 CCACCACGCCTGGCTAATTTTGG + Intronic
1161138731 19:2635868-2635890 CCACCGTGCCTGGCCAACTTGGG + Intronic
1161157683 19:2741502-2741524 CCACCATGCCTGGCTAATTTTGG - Intergenic
1161160674 19:2760363-2760385 CCACCATGCCTGGCTAATTTTGG - Intronic
1161178715 19:2864995-2865017 CCACCATGCCTGGCCAACGCTGG - Intergenic
1161274155 19:3406071-3406093 CCACCATGCCCAGCTAAATTTGG + Intronic
1161369571 19:3903124-3903146 CCACCATGGCTGGCTAATTTTGG + Intronic
1161523374 19:4738429-4738451 CCTCCCTGCCTGGCTAATTCGGG - Intergenic
1161566012 19:5003202-5003224 CCACCATGCCCGGCCCAAGCAGG - Intronic
1161621628 19:5300616-5300638 CCACCATGCCCGGCTAATTTTGG - Intronic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1162026354 19:7896088-7896110 CCACCACGCCTGGCTAATTTTGG + Intronic
1162076540 19:8191620-8191642 CCACCATGCCTGGCCATTCCTGG - Intronic
1162244122 19:9384562-9384584 CCACCATGCCTGGCCGGAACTGG + Intergenic
1162256621 19:9495552-9495574 CCACCACGCCTGGCTAATTTTGG - Intronic
1162356225 19:10186683-10186705 CCACCATGCCTGGCTGATTCTGG - Intronic
1162521783 19:11185130-11185152 CCACCATGCCCGGCAAGCCCAGG - Intronic
1162611211 19:11755025-11755047 CCACCATGCCTGGCCCAAAGAGG - Intergenic
1162852218 19:13439696-13439718 CCACCGTGCCTGGCCCAGTCTGG + Intronic
1162925216 19:13927489-13927511 CCACCATGCCTGGCCAAGAGTGG - Intronic
1162986185 19:14271714-14271736 CCACCATGCCCGGCCAAGACAGG + Intergenic
1163041088 19:14603020-14603042 CCACCGTGGCTGGCCAAAACAGG + Intronic
1163071513 19:14845998-14846020 CCACCATGCCAGGCTAATTTTGG - Intergenic
1163268890 19:16237578-16237600 CCACCATGCCTGGCTAATTTTGG - Intronic
1163333302 19:16655391-16655413 CCACCATGCCTGGCCTAATCTGG - Intronic
1163416553 19:17190344-17190366 CCACCATTCCTGGCTAATTTTGG + Intronic
1163869834 19:19811310-19811332 TCACCATGCCTGGCTAATTTTGG + Intronic
1163983190 19:20921126-20921148 CCACCGTGCCTGGCCTAATATGG - Intergenic
1164131302 19:22364543-22364565 CCACCACGCCTGGCCTAATTTGG + Intergenic
1164145853 19:22512208-22512230 CCACCATGCCTGGCCGAAGCAGG + Intronic
1164515813 19:28934297-28934319 CCACCACGCCTGGCCCAATTTGG - Intergenic
1164646811 19:29864156-29864178 CCACCACGCCTGGCTAATTGAGG - Intergenic
1164682514 19:30145128-30145150 CCACCCTGGCTGGCAAGAGCAGG + Intergenic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1164991787 19:32689917-32689939 CCACCACACCTGGCAGAAACTGG - Intergenic
1165103611 19:33455806-33455828 TTACCATGCCTGGCAATATCAGG + Intronic
1165192281 19:34074997-34075019 CCACCATGCCCGGCTAATTTTGG + Intergenic
1165371654 19:35411290-35411312 CCACTATGCCTGGCTAATTTTGG + Intergenic
1166021692 19:40037065-40037087 CCACCGTGCCTGGCTAATTTTGG + Intronic
1166372278 19:42308834-42308856 CCACCATGCCTGGCCTCATCTGG + Exonic
1166537949 19:43587175-43587197 CCACCATGCCTGGCTAATTTTGG - Exonic
1166682231 19:44776256-44776278 CCACCATGCCTGGTCAGACCAGG - Intergenic
1166706996 19:44913595-44913617 CCACCATGCCTGGCTAATGCAGG + Intergenic
1166709167 19:44926155-44926177 CCACCATGCCTGGCCAATGCAGG + Intergenic
1166826802 19:45614906-45614928 CCACCATGCCCGGCCAGATGCGG - Intronic
1166971327 19:46570290-46570312 CCACCATGCCTGGCCACAATGGG + Intronic
1167032879 19:46975155-46975177 CCACCATGCCTGGCCAGAAGGGG + Intronic
1167141617 19:47655236-47655258 CCACCACGCCTGGCCAAACTGGG - Intronic
1167176927 19:47871275-47871297 CCACCGTGCCTGGCCAACCCTGG + Exonic
1167326190 19:48827328-48827350 CCACCGTGCCTGGCAAGGACAGG + Intronic
1167345019 19:48940065-48940087 CCACCACGCCTGGCCAAGTGGGG - Intronic
1167474974 19:49694851-49694873 CCACCATGCCTGGCCAAGGATGG - Intronic
1167584659 19:50367254-50367276 CCACCATGCCTGGCCATGTTAGG + Intronic
1167617332 19:50542627-50542649 CCACTATGCCTGGCTAATTTTGG + Intronic
1167628024 19:50605338-50605360 CCACCGTGCCTGGCCAATTTTGG + Intergenic
1167678553 19:50905101-50905123 CCACTATGCCTGGCTAATTTTGG + Intergenic
1167856981 19:52249971-52249993 CCACCATGCCTGGATAATTTTGG + Intergenic
1167884432 19:52488629-52488651 CCACCACGCCTGGCTAATTTTGG - Intronic
1167899699 19:52610568-52610590 CCACCATGCCTGGCCCATTCTGG + Intronic
1168047673 19:53805668-53805690 CCACCATGCCTGGCTCATTTTGG + Intronic
1168235096 19:55057934-55057956 CCAGCATGCCTGGCTAACTCTGG + Intronic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
1168646260 19:58060837-58060859 CCACCGCGCCCGGCCAAATCTGG - Intronic
926035947 2:9635793-9635815 CCACCACGCCTGGCCAGATATGG + Intergenic
926075970 2:9943109-9943131 CCACCGTGCCTGGCCAAATCAGG - Intergenic
926092939 2:10062158-10062180 CCACCACGCCTGGCTAATTTTGG + Intronic
926105720 2:10149279-10149301 CCACCATGCCCGGCTAATTTTGG + Intronic
926180217 2:10636173-10636195 CCACCATGCCTGGCCCATCCAGG + Intronic
926194637 2:10755321-10755343 CCACCGTGCCTGGCCACACCTGG + Intronic
927165509 2:20316743-20316765 CCACCATGCCTGGCCGTGTCTGG - Intronic
927512626 2:23653876-23653898 CCACCGTGCCTGGCCGAAGCTGG - Intronic
927771381 2:25865141-25865163 CCACCATGCCTGGCCTAAATTGG - Intronic
927818475 2:26242052-26242074 CCACCACACCTGGCCAATTCTGG + Intronic
927876783 2:26662005-26662027 CCACCATGCCCGGCCAAGACAGG + Intergenic
928055700 2:28051935-28051957 CCACCATGCCTGGCCAAGTCAGG + Intronic
928099495 2:28427741-28427763 CCACCATGCCTGGCCTAAAATGG + Intergenic
928162684 2:28942766-28942788 CCACCATGCCCGGCCAACTTTGG + Intronic
928162703 2:28942886-28942908 CCACCATGCCTGGCCAGGTATGG + Intronic
928230756 2:29496981-29497003 CCACCATGCCTGGCCTCATCAGG - Intronic
928237857 2:29560722-29560744 CTACCATGCCTGGCTAATTTTGG + Intronic
928262014 2:29776642-29776664 CCACCATGCCCAGCAAAATCAGG - Intronic
928294874 2:30073867-30073889 CCACCCACCCTGGCAATATCTGG - Intergenic
928340496 2:30439317-30439339 CCACCATGCCTGGCTGAGACTGG + Intergenic
928421815 2:31142968-31142990 CCACCATGCCCGGCTAATTTTGG - Intronic
928495840 2:31830770-31830792 CCACCATGCCTGGCCGATTTTGG + Intergenic
928757155 2:34541184-34541206 CCACCCTGCCTGACAAACCCCGG + Intergenic
928865972 2:35918257-35918279 CCAACATGGCTGGAAAAAGCAGG - Intergenic
928963512 2:36954221-36954243 CCACCACGCCTGGCCAAATTTGG - Intronic
929104976 2:38355982-38356004 CCACCATGCCTGGCCACATTTGG + Intronic
929236519 2:39610824-39610846 CCACCATGCCTGGCTAATTTTGG + Intergenic
929347641 2:40906036-40906058 CCACCATGCCCGGCTAACTTTGG + Intergenic
929382341 2:41367872-41367894 CCACCAGGCCTGGCTAATTTTGG - Intergenic
929470882 2:42191770-42191792 CCACCACGCCCGGCAAAACTAGG - Intronic
929596088 2:43177041-43177063 CCACCACGCCTGGCCAAACAAGG + Intergenic
929800515 2:45096339-45096361 CCACCATGCCTGGCAGATCAGGG + Intergenic
929814671 2:45221445-45221467 CCACCATGGCTGGCCAGGTCTGG + Intergenic
929861573 2:45682737-45682759 CCACCATGCCTGGCTATTTTTGG + Intronic
930007649 2:46910750-46910772 CCACCATGCCTGGCCTATCCTGG - Intronic
930012393 2:46947426-46947448 CCACTATGCCTGGCCAGATTTGG - Intronic
930028918 2:47046502-47046524 CCACCATGCCTGCCAAGATGGGG + Intronic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930116317 2:47721464-47721486 CCACCATGCCTGGCTAATTATGG + Intronic
930330681 2:49979142-49979164 CCACCACGCCTGGCTAATTTTGG - Intronic
930333944 2:50022001-50022023 CCACCATGCCTGGCTAATTTTGG + Intronic
930344428 2:50161316-50161338 AACCCATTCCTGGCAAAATCTGG + Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930687777 2:54327416-54327438 CCACCATGCCCGGCATACCCAGG + Intergenic
930742917 2:54851119-54851141 CCACCATGCCTGGCCTCATTGGG - Intronic
930779221 2:55206817-55206839 CCACCATGCCCGGCCCAATTTGG - Intronic
931232819 2:60388822-60388844 CCACCATGCCCGGCAAATTTTGG - Intergenic
931273564 2:60723768-60723790 CCACCATGCCCGGCCGACTCAGG + Intergenic
931283138 2:60810896-60810918 CCACCATGCCTGGCCGAGACAGG - Intergenic
931329444 2:61264734-61264756 CCACCATGCCCGGCCAACTATGG - Intronic
931338300 2:61372556-61372578 CCACCATGCCTGGCGGAAACAGG - Intronic
931351287 2:61491170-61491192 CCACCATGCCTGGCCAGTTTGGG - Intronic
931445500 2:62323893-62323915 CCACCATGCCTGGCCCTATACGG + Intergenic
931474333 2:62571986-62572008 CCACCATGCCTGACAAATATGGG + Intergenic
931474897 2:62577479-62577501 CCACCATGCCTGGCCAGTTTTGG + Intergenic
931525654 2:63149846-63149868 CCACCATGCCTAGCTAATTTTGG - Intronic
931693594 2:64855708-64855730 CCACCATGGCCGGCCACATCTGG - Intergenic
931733918 2:65177367-65177389 CCACCACGCCTGGCCGAGTCTGG + Intergenic
931995029 2:67831564-67831586 CCACCATGCCAGGCTAATTTTGG + Intergenic
932138822 2:69256773-69256795 CCACCATGCCTGGCTAGAGATGG - Intergenic
932151511 2:69377053-69377075 CCATCATGCCTGGCTAATTTTGG - Intronic
932282121 2:70502490-70502512 TCACCATGCCTGGCTAAGACGGG + Intronic
932790452 2:74650260-74650282 CCACCATGCCCGGCTAATTTTGG - Intergenic
932828468 2:74963638-74963660 CCACCACGCCTGGCTAATTTTGG + Intronic
932898200 2:75665439-75665461 CCACCATGCCCGGCCAAATCTGG + Intronic
932901000 2:75699862-75699884 CCACTATGCCTGGCCAAATCTGG + Intronic
933469181 2:82698718-82698740 CCACAATGCCTGGTATGATCTGG + Intergenic
933732115 2:85464936-85464958 CCACCATGCCCGGCTAATTTGGG + Intergenic
934457861 2:94190283-94190305 CCACCATGCCCGGCCCACTCTGG + Intergenic
934555994 2:95287305-95287327 CCCCCATGCCTGGCAACTTGAGG - Intronic
934606986 2:95702984-95703006 CCACCATGCCCGGCCTAATTAGG + Intergenic
934723666 2:96601113-96601135 CCACCATGCCCGGCTACAACAGG - Intronic
935012239 2:99145994-99146016 CCACCGTACCTGGCCACATCTGG - Intronic
935159987 2:100521697-100521719 CCACCATGCCTGGCCTTGTCAGG - Intergenic
935201556 2:100861152-100861174 CCACCATGCCTGGCCCAGCCTGG + Intronic
935235476 2:101134884-101134906 CCACCGTGCCCGGCCAAATATGG - Intronic
935235621 2:101136009-101136031 CCACCACGCCTGGCTAATTTTGG + Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
935408071 2:102730335-102730357 CCACCATGCCTGGCCACCTCTGG + Intronic
935762468 2:106334152-106334174 CCACCATGTCTGGCTAATTAAGG + Intergenic
935779236 2:106496985-106497007 CCACCACGTCTGGCCAAAACTGG - Intergenic
935821518 2:106897500-106897522 CCACCATGCCTGGCTAGGTTTGG + Intergenic
936070648 2:109369055-109369077 CCACCATGCCCGGCCAAGTGTGG - Intronic
936247745 2:110843305-110843327 CCACCATGCCTGGCCAATGTAGG + Intronic
936411805 2:112265506-112265528 CCGCCATGCCTGGCTAATTTTGG + Intergenic
936540388 2:113345144-113345166 CCACCATGCCTGGCCTAATTAGG + Intergenic
936660400 2:114536690-114536712 CCACCATGCTTGGCCAACTTTGG + Intronic
936697210 2:114965287-114965309 CCACCATGCCTGGCTGATTTTGG + Intronic
936824603 2:116566032-116566054 CCACCATGCCTTGCCAAAGAAGG + Intergenic
937176232 2:119938412-119938434 CCACCATGCCTGGCTAATGTGGG + Intronic
937517943 2:122676864-122676886 CCATCATGCCTGGCTAATTTGGG - Intergenic
937598506 2:123699550-123699572 CCACCGTGCCTGGCCAAATGTGG - Intergenic
937821997 2:126320710-126320732 CCACCATGCCTGGCCAAGTGAGG + Intergenic
938035810 2:128034070-128034092 CCACCATGCCTGGCCAAGATTGG - Intergenic
938793916 2:134702490-134702512 CCACCATGCCCGGCTAATTTTGG - Intronic
938798776 2:134740842-134740864 CCACCGTGCCTGGCCTCATCTGG - Intergenic
938800333 2:134757174-134757196 TCACCATGCCTGGCTAATTTTGG - Intergenic
938821018 2:134960320-134960342 CCACCATGCCCGGCTAATTTTGG + Intergenic
938835362 2:135097366-135097388 CCACCATGCCCGGCTAAGTTGGG + Intronic
938870971 2:135475923-135475945 TCACCATGCCTGGCTAATTTTGG - Intronic
939181255 2:138804745-138804767 CCACCATGCCTGGCTAATTTTGG - Intergenic
939203415 2:139068595-139068617 CTATGATGCCTGGCAAAATAAGG + Intergenic
939251058 2:139682119-139682141 CCACCATGCCTGGCCACATAGGG - Intergenic
939295809 2:140263074-140263096 CCACCATGCCTGGTTAATTTTGG + Intronic
939392301 2:141584090-141584112 CCACCATGCCTGGCTAACGTTGG - Intronic
939433767 2:142146458-142146480 CCACCGTGCCCGGCTAATTCTGG - Intergenic
939458333 2:142466605-142466627 CCACCATGCCTGGCCAGCTTTGG + Intergenic
939475953 2:142686615-142686637 CCACCATGCCCGGCAGTCTCTGG + Intergenic
939918565 2:148079702-148079724 CCACCATGCCTGGCTAATTTTGG - Intronic
940006920 2:149016583-149016605 TAACCATGCCAGGGAAAATCGGG + Intronic
940649375 2:156426208-156426230 CCACCACGCCCGGCCAAGTCTGG + Intergenic
940785244 2:157974084-157974106 CCACCATGCCTGGCTAATTTTGG + Intronic
940842330 2:158598478-158598500 CCACCACGCCCGGCAATAACAGG - Intronic
941673307 2:168318271-168318293 CCACCATGCCTGGCTACTTTTGG + Intergenic
941878712 2:170460333-170460355 CCACCACGCCTGGCTAATTTTGG - Intronic
941968958 2:171329136-171329158 CCACCATGCCTGGCTACAGGAGG + Intronic
942235993 2:173905709-173905731 CCACCACGCTTGGCCAAATCTGG - Intergenic
942323470 2:174755746-174755768 CCACTGTACCTGGCAAAGTCTGG - Intronic
942477241 2:176340307-176340329 CCACCATGCCTGACTAATTTGGG + Intergenic
943026919 2:182640865-182640887 CCACCATGTCTGGCTAATTTTGG - Intergenic
943102440 2:183504887-183504909 CCACCATGCCCGGCACATTGAGG + Intergenic
943573871 2:189607659-189607681 CCACCATGCCTGGCTATTTTTGG + Intergenic
943690525 2:190865058-190865080 CCACCATGCCCAGCTAATTCAGG - Intergenic
943747903 2:191481265-191481287 CCTCCATGCCTGGCTAATTTGGG + Intergenic
944082961 2:195810562-195810584 CCACCATGCCTGGCTAATTTTGG + Intronic
944094464 2:195950697-195950719 CCACCACGCCTGGCTAATTTTGG - Intronic
944099731 2:196010433-196010455 CCACCATCCCTGACAAAAAGAGG + Intronic
944151431 2:196562754-196562776 CCACCAACCCTGGCCAAAGCTGG - Intronic
944304510 2:198164339-198164361 CCAGCATGCCTGGCTAATTTTGG - Intronic
944316491 2:198290757-198290779 CCACCATGCTCGGCTAAATTTGG - Intronic
944799625 2:203226871-203226893 CCACCATGCCTGGCCAATGAAGG + Intergenic
944958348 2:204838500-204838522 CCACCATGCCTGGCTGCATCAGG + Intronic
945086217 2:206135169-206135191 CCACCATGCCAAGCAAATTGGGG + Intronic
945750305 2:213773837-213773859 CCACCAAGCCTGGCCTAATTTGG + Intronic
945861772 2:215131211-215131233 TCACCATGCTTATCAAAATCAGG - Intronic
946234434 2:218314521-218314543 CCACCATGCCTGGCTATACTTGG + Intronic
946265122 2:218534199-218534221 CCACCATGCCCGGCCTAATCTGG - Intronic
946270771 2:218591588-218591610 CCACCATGCCTGGCTAATTTTGG - Intronic
946390270 2:219411047-219411069 CCACCACGCCCGGCTTAATCTGG + Intergenic
946749461 2:222879163-222879185 CCACCATGCCCGGCTAATTTTGG - Intronic
947016981 2:225631968-225631990 CCACCATGCCTGGCTAATTTTGG + Intronic
947167226 2:227274784-227274806 CCACCATGCCTGGCCGAAGGAGG + Intronic
947180668 2:227408526-227408548 CCACCGTGCCTAGCAAAAATAGG - Intergenic
947404048 2:229756101-229756123 CCCCCATGCCTGGCCAAAAGTGG + Intergenic
947437403 2:230084415-230084437 CCACCACGCCTGGCTAATTTTGG - Intergenic
947505469 2:230705107-230705129 CCACTGTGCCTGGCAAAGCCTGG + Intergenic
947557012 2:231101966-231101988 CCACCATGCCTGGCTAATTTTGG + Intronic
947761884 2:232609495-232609517 ACACCATGCCTGGCACACTTAGG - Intronic
947770077 2:232663517-232663539 CCACCAGGCCTGGCTAATTTTGG + Intronic
947770818 2:232668784-232668806 CCACCATGCCCGGCTAATTTTGG + Intronic
947852925 2:233303100-233303122 CCACCATGCCTGGCTGAAGAAGG + Intergenic
947931570 2:233969189-233969211 CCACCATGCCTGGCCAAACTTGG - Intronic
948032756 2:234832997-234833019 CCACCACGCCTGGCAATAAAGGG - Intergenic
948991284 2:241555662-241555684 CCACCACGCCTGGCACACTTAGG + Intergenic
1168760136 20:344881-344903 CCACCGTGCCTGGCCTCATCTGG + Intergenic
1169086732 20:2830639-2830661 CCACCATGCCTGGCCCAAGCAGG + Intergenic
1169223263 20:3839599-3839621 CCACCATGCCTGGCCCAGCCAGG - Intergenic
1169246189 20:4027078-4027100 CCACCATGCCTGGCTAATTTTGG + Intergenic
1169438732 20:5616220-5616242 TCACCATGCCTGGCTAATTTGGG + Intergenic
1169493194 20:6088774-6088796 CCACCACGCCTGGCTAATTTTGG + Intronic
1169728946 20:8765964-8765986 CCACCATGCCTGCCCACAACTGG + Intronic
1170233689 20:14078557-14078579 CCACCACGCCTGGCTAATTTTGG + Intronic
1170558200 20:17532250-17532272 CCACCACGCCTGGCTAATTTTGG - Intronic
1170676427 20:18485630-18485652 CCACCATCCCTGGCAAACCCAGG - Intergenic
1170810004 20:19666694-19666716 CCACCATGCCGGGCCAATTTGGG - Intronic
1170847323 20:19973634-19973656 CCACCACGCCTGGCTAATTTTGG - Intronic
1171078391 20:22152161-22152183 CCACCGCGCCTGGCAGAATAAGG + Intergenic
1171561193 20:26127572-26127594 TCACCGTGCCTGGCAAATTATGG + Intergenic
1171814693 20:29775320-29775342 CCACCATGCCTGGCTAATTTTGG + Intergenic
1171945675 20:31375300-31375322 CCACCATGCCTGGCTAATTTTGG + Intergenic
1172019077 20:31900045-31900067 CCACTGTGCCTGGCCGAATCTGG + Intronic
1172054488 20:32144620-32144642 CCACCATGCCTGGCCAACAATGG - Intronic
1172308378 20:33898117-33898139 CCACCACGCCTGGCTAATTTTGG + Intergenic
1172371243 20:34393942-34393964 CCACCATGCCTGGCCCTCTCAGG - Intronic
1172577999 20:36024180-36024202 CCACCACGCCTGGCTAATTTTGG - Intronic
1172597750 20:36161911-36161933 CCACCATGCCCGGCTAATTTGGG + Intronic
1172700857 20:36852767-36852789 CCACCATGCCCGGCCTCATCAGG - Intronic
1172879920 20:38193264-38193286 CCACCACGCCTGGCTAATTTTGG - Intergenic
1172934757 20:38611859-38611881 CCACCGTGCCTGGCCACACCCGG + Intronic
1173035834 20:39409068-39409090 CCACCATACCTGGCATATTTTGG + Intergenic
1173103395 20:40108558-40108580 CCACCATGTCTGGCTAATTTGGG - Intergenic
1173110886 20:40189074-40189096 CCACCACACCTGGCAACATGTGG - Intergenic
1173183192 20:40820050-40820072 CCACCATGCCTGCCTAAACCTGG + Intergenic
1173190270 20:40870660-40870682 CCACCATGCCTAGCTAATTTTGG + Intergenic
1173520482 20:43696391-43696413 CCACCATGCCTGGCTAATTGGGG + Intronic
1173661798 20:44739607-44739629 CCACCGTCCCTGGCCAATTCTGG - Intergenic
1173754534 20:45504013-45504035 CCACCATGCCTGGCTACTTTTGG - Intergenic
1173978336 20:47204168-47204190 CCACCATGCCTGGCCAATGTGGG + Intergenic
1173985215 20:47256190-47256212 CCACCATGCCTGGCCAGCTAGGG - Intronic
1174019109 20:47515313-47515335 CCACCATGCCTGGTTAATTTTGG + Intronic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174347454 20:49940892-49940914 CCACCATGCCTGGCTAATTTTGG + Intronic
1174384665 20:50180027-50180049 CCACCATACCTGGCTAATTTTGG + Intergenic
1174530290 20:51206794-51206816 CCACCACGCCTGGCTAATTTTGG + Intergenic
1174558283 20:51412239-51412261 CCCCCATGACTGGCACACTCTGG + Intronic
1174779844 20:53379092-53379114 CCACCATGCCTGGCTTACTGTGG - Intronic
1174801454 20:53566342-53566364 CCACCATGCCTCGCTAATTTTGG - Intergenic
1174830109 20:53804622-53804644 CCACCATGCCTGGCCTTATCAGG + Intergenic
1175143319 20:56876841-56876863 CCAACATGCCTGGCTAATTTTGG - Intergenic
1175201316 20:57279734-57279756 CCACCATGCCCAGGAAAATTTGG - Intergenic
1175205835 20:57310512-57310534 CCACCATGCCTGGTTAATTTGGG + Intergenic
1175249240 20:57598805-57598827 CCACCAGGACTGGAAAAATCTGG + Intergenic
1175592862 20:60207319-60207341 CCACCATGCCTGGCCGAGACTGG + Intergenic
1175830461 20:61962569-61962591 CCACCATGCCTGGCCTAGGCGGG - Intronic
1175989375 20:62780075-62780097 CCACCATGCCCAGCCAAATGTGG + Intergenic
1176082393 20:63280443-63280465 CCACCATGCCTGGCCAGAAAGGG + Intronic
1176718816 21:10377223-10377245 CCACCATGCCTGGCTAATTTTGG + Intergenic
1176723072 21:10408186-10408208 CCACCACACCTGGCAAATTTTGG + Intergenic
1176796999 21:13378614-13378636 CCACCACACCTGGCAAATTTTGG - Intergenic
1176868163 21:14065844-14065866 CCAGCATGCCTGGCTAACTTTGG + Intergenic
1177018134 21:15816842-15816864 CCATCATGCCTGGCAGATTATGG - Intronic
1177221929 21:18205887-18205909 CCACCATGCCTGGCTAATTTAGG + Intronic
1177383095 21:20371015-20371037 CCACCACACCTGGCAAATTTTGG - Intergenic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1178336699 21:31749818-31749840 CCACCACGCCTGGCTAATTCTGG - Intergenic
1178361822 21:31954933-31954955 CCACCATGCCTGGCTAATTTTGG + Intronic
1178402784 21:32301247-32301269 CCACCACGCCTGGCCCAATTAGG + Intronic
1178536184 21:33412074-33412096 CCACCACGCCCAGCTAAATCTGG + Intronic
1178547129 21:33501613-33501635 CCACCATGCCTGGCCGCATGTGG + Intergenic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1178622950 21:34192425-34192447 CCATCATGCCTGGCTAATTTTGG - Intergenic
1178677736 21:34645487-34645509 CCACCACGCCCGGCCAACTCAGG - Intergenic
1178988877 21:37334869-37334891 CCACCATGCTGGCCAAAATTTGG - Intergenic
1179222258 21:39418785-39418807 CCACCATGCCTGGCCAGAAATGG + Intronic
1179814142 21:43892940-43892962 TCACCATGCCTGGCTAATTTTGG - Intronic
1180213302 21:46309029-46309051 CCACTGCGCCTGGCCAAATCTGG - Intronic
1180217803 21:46337147-46337169 CCACCATGCCTGGCTAATTGGGG + Intronic
1180300039 22:11030118-11030140 CCACCATGCCTTGCTAATTTTGG + Intergenic
1180304232 22:11060922-11060944 CCACCACACCTGGCAAATTTTGG + Intergenic
1180464285 22:15597178-15597200 CCACCATGCCTGGTTAACTTTGG + Intergenic
1180623853 22:17180847-17180869 CCACCATGCCTGGCCTATTCTGG - Exonic
1181035303 22:20167062-20167084 CCACCGTGCCTGGCCCCATCAGG - Intergenic
1181291582 22:21798429-21798451 CCACTGTGCCTGGCCACATCTGG - Intronic
1181293184 22:21813825-21813847 CCACCACGCCTGGCTAACTTTGG - Intronic
1181300823 22:21879898-21879920 CCACCACGCCTGGCTAATTTGGG - Intergenic
1181470943 22:23139331-23139353 CCACCATACCTGGCCAAAGCTGG - Intronic
1181617955 22:24067831-24067853 GCACCATGCCTGGCACTAGCAGG + Intronic
1181802964 22:25359138-25359160 CCACCATGCCTGGCCAGGCCAGG - Intronic
1181841353 22:25664804-25664826 CCACCATGCCCGGCCAACTTTGG + Intronic
1181843428 22:25685931-25685953 CCACCGTGCCCGGCTAGATCTGG - Intronic
1181936179 22:26440482-26440504 CCACCATGCCTGGCTCATTTTGG + Intronic
1182101572 22:27661476-27661498 CCTCCATGCCTGGCGGCATCTGG - Intergenic
1182110792 22:27721748-27721770 CCACCATGCCCAGCCCAATCGGG - Intergenic
1182127071 22:27823799-27823821 CCACCATGCCTGGCTCATTTTGG - Intergenic
1182408743 22:30162853-30162875 CCATCATGCCTGGCTAATTTTGG + Intronic
1182474205 22:30567423-30567445 CCACCACGCCTGGCTAATTTTGG + Intronic
1182637086 22:31736749-31736771 CCACCATGCCTGGCCTCATATGG - Intronic
1182637629 22:31741307-31741329 CCACCACGCCTGGCTAATTTTGG - Intronic
1182888547 22:33797049-33797071 CCACCATGCCTGGCCAGACTTGG + Intronic
1183295708 22:37028243-37028265 CCACCACGCCTGGCCTAATTTGG - Intronic
1183399459 22:37593563-37593585 CCACCATGCCTGGCCTATACTGG + Intergenic
1183566767 22:38621047-38621069 CCACCATGCCCGGCCGACTCAGG - Intronic
1183891691 22:40935086-40935108 CCACCATGCCCGGCCAAGCCCGG - Intergenic
1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG + Intronic
1184028872 22:41879146-41879168 CCACCACGCCTGGCTGAGTCAGG + Intronic
1184207822 22:43016050-43016072 TCACCATGCCTGGCTCTATCTGG - Intergenic
1184272845 22:43394587-43394609 CCACCGGGCCTGGCCAAATCAGG + Intergenic
1184285238 22:43466892-43466914 CCACCATGCCTGGCCAGACAGGG - Intronic
1184365335 22:44047506-44047528 CCACCATGCCCGGCTAATTTTGG - Intronic
1184740228 22:46423817-46423839 CCACCACGCCTGGCTAATTTTGG - Intronic
1184752465 22:46495661-46495683 CCACCATGCCTGGCTAAACAGGG - Intronic
1185114371 22:48923171-48923193 CCACCGCGCCTGGCCACATCTGG + Intergenic
1185155371 22:49190562-49190584 CCACCATGCCCGGCCAAACTGGG + Intergenic
949409464 3:3748255-3748277 CCATCATGCCTGGCTAATTTTGG - Intronic
949974026 3:9437848-9437870 CCACCACGCCTGGCTAATTTTGG - Intronic
951209235 3:19956299-19956321 CCACCACGCCTAGCTAATTCTGG - Intronic
951927062 3:27919821-27919843 CCACCATGCCTGGCTAATTTTGG - Intergenic
952481886 3:33770109-33770131 CCACCATGCCCGGCCACATCTGG + Intergenic
952819646 3:37475125-37475147 CCACCATGCCTGGAGGAATGTGG - Intronic
953398993 3:42596172-42596194 GCACCATGCCTGGCTAATTTTGG + Intronic
953423323 3:42772117-42772139 CCACCATGCCTGGCTAATTTTGG - Intronic
953442466 3:42930134-42930156 CCACCATGCCTGGCCATAAATGG - Intronic
953591889 3:44265402-44265424 CCACCACGCCTGGCTAATTATGG - Intronic
953642870 3:44726103-44726125 CCACCATGCCTGGCCCAGTTTGG - Intergenic
954007716 3:47605482-47605504 CCACCATGCCCGGCCACATCTGG - Intronic
954046470 3:47935647-47935669 CCACCACGCCTGGCCAGCTCAGG - Intronic
954087320 3:48255774-48255796 CCACCATGCCTGGCCAGAGACGG + Intronic
954103496 3:48396316-48396338 CCACCATGCCCGGCTAATTTTGG - Intronic
954212735 3:49107408-49107430 CCACCATGCCTGGCCAAAGAAGG + Intergenic
954257219 3:49415227-49415249 CCACCATGCCTGGCCAACTCAGG - Exonic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954315226 3:49797632-49797654 CCACCACGCCTGGCTAATTTTGG + Intronic
954337410 3:49927746-49927768 CCACCATACCTGGCTAATTAAGG - Intronic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
954556186 3:51519484-51519506 CCACCACGCCTGGCTAATTTTGG + Intergenic
954700667 3:52449179-52449201 CCACCGTGCCCGGCCTAATCTGG - Intergenic
954701561 3:52453362-52453384 CCATCATGCCTGGCAGGCTCAGG - Intronic
954778454 3:53041543-53041565 CCACCATTCCTGGCTAATTTTGG - Intronic
954977437 3:54709635-54709657 CCACCATGCCTGGCAAGTGATGG - Intronic
955012824 3:55036292-55036314 CCATCATGCCCGGCTAATTCTGG - Intronic
956495641 3:69823029-69823051 CCACCACGCCTGGCTAATTTTGG + Intronic
956865562 3:73365631-73365653 CCACCATGCCTGGCCTATTGTGG + Intergenic
957299353 3:78371172-78371194 CCACCACGCCTGGCTAACTTTGG - Intergenic
957453126 3:80405262-80405284 CCTCCATGCCTGGCTAATTTTGG + Intergenic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
958006887 3:87823672-87823694 CCACCATGCCCGGCCAAGGCTGG + Intergenic
958066202 3:88546807-88546829 CCACCATGCCTGGATAATTTTGG + Intergenic
958104400 3:89053830-89053852 CCACCATGCCTGGAAAAGTGGGG + Intergenic
958665236 3:97128666-97128688 CCACCACGCCTGGCTAATTTTGG + Intronic
958792163 3:98664311-98664333 CCACCATACCTGGCTAATTTGGG + Intergenic
958963925 3:100537208-100537230 CCACCATGCCTGGCCAGAATAGG + Intronic
959355715 3:105325340-105325362 CCACCCTGCCTGCCAATATTCGG + Intergenic
959665101 3:108911816-108911838 CCACCATGCCCGGCCAAAAAGGG - Intronic
959765488 3:110022333-110022355 CCATCATGCCTGGCTAAGTTTGG - Intergenic
960296309 3:115948978-115949000 CCATCATGCCTGGCTAATTTTGG - Intronic
960453258 3:117837230-117837252 CCACCATGCCTGGCTCAATCAGG - Intergenic
960602784 3:119474546-119474568 CCACCATGCCCGGCCACATTTGG - Intronic
960666341 3:120112559-120112581 CCACCGCGCCTGGCAACATTAGG - Intergenic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960780076 3:121310754-121310776 CCACCATGCCTGGCTAATTTTGG - Intronic
960813553 3:121649520-121649542 CCACCACGCCTGGCCTAAACAGG + Intronic
960949397 3:122989326-122989348 CAACTAAGCCTGGCAACATCAGG - Intronic
961016307 3:123470896-123470918 CCACCATGCCTGGCTAATCTTGG + Intergenic
961204386 3:125069241-125069263 CCACCATGCTTGGTAAAACAAGG + Intergenic
961540531 3:127596364-127596386 CCACCATGCCTGGCCATCCCAGG + Intronic
961739394 3:129023479-129023501 CCACCATGCCTGGCTAATTTTGG + Intronic
961786578 3:129350820-129350842 CCACCATGCCCGGCTAATTTTGG - Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962370942 3:134820256-134820278 CCTCCATGTCTGGGAAAAGCAGG + Intronic
962529556 3:136266279-136266301 CCACCATGGCTGGCTAATTTTGG + Intronic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963283162 3:143406686-143406708 CCACCATGCCCGGCCTAATTTGG - Intronic
963316541 3:143764862-143764884 CCACCAGGCCTGGCCATGTCTGG + Intronic
963637784 3:147820925-147820947 CCACCATGCCTGGCCTATTTTGG + Intergenic
963649181 3:147956317-147956339 CCACCATGGCTGGCTAATTTTGG - Intergenic
963749234 3:149158498-149158520 CCACCATGCCTAGTCAAATTTGG - Intronic
963968844 3:151406457-151406479 CAGCTATGCCTGGCAAAATTGGG + Intronic
964124728 3:153224251-153224273 CCACCATGCCTGGCTAATTTTGG + Intergenic
964558652 3:157968468-157968490 CCACCATGCCTGGCTAAGTTTGG - Intergenic
964750131 3:160046822-160046844 CCACCATGCCTGGCCAAGTAGGG + Intergenic
965311970 3:167139495-167139517 CCAACATGCCAGGCCAATTCTGG + Intergenic
966110296 3:176392971-176392993 CCACCATGCCTGGCTAGTTTTGG + Intergenic
966172731 3:177100575-177100597 CCACCACGCCTGGCCAATTTTGG + Intronic
966173582 3:177111423-177111445 CCACCATGCCAGGCTAATTTGGG + Intronic
966184504 3:177215863-177215885 CCACCATGCCTGGCCAGCACTGG - Intergenic
966191781 3:177278007-177278029 CCACCACGCCTGGCTATCTCTGG + Intergenic
966663969 3:182449933-182449955 CCACCATGCCCTGCAAATTTTGG + Intergenic
966841347 3:184090725-184090747 CCACCATGCCAGGCCAATTGTGG + Intergenic
966957820 3:184902188-184902210 CCACCATGCCTGGCCAGCTTGGG - Intronic
966984324 3:185165636-185165658 CCACCACGCCTGGAAGAAACAGG + Intergenic
967049686 3:185771150-185771172 CCACCATGCCTGGCCCATTTAGG - Intronic
967310721 3:188103702-188103724 CCACCACGCCTGGCTAATTTTGG + Intergenic
967356695 3:188579815-188579837 CCATCATGCCTGGCTAATCCTGG - Intronic
967909450 3:194529218-194529240 CCAAAATGCCTGACAAAATAAGG - Intergenic
967931332 3:194692662-194692684 CCACCATGCCTGGCAAGGCTGGG + Intergenic
968126216 3:196162447-196162469 CCAACATGCCTGGCTAATTCTGG - Intergenic
968179390 3:196580495-196580517 CCACCATGCCTGGCGAGACGGGG + Intronic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
968242303 3:197101536-197101558 CCACCACGCCTGGCTAATTTTGG + Intronic
968245572 3:197143541-197143563 CCACCGTGCCTGGCAACAGCTGG + Intronic
968401269 4:300173-300195 CCACCATGCCTGGCCACAAATGG - Intronic
968733020 4:2280353-2280375 CCATCATGCCTGGCTAATTTTGG - Intronic
968773815 4:2526707-2526729 CCACCACGCCTGGCGAAATGTGG - Intronic
969035776 4:4252463-4252485 CCACCATGCCCGGCTAATTTCGG + Intergenic
969059302 4:4422412-4422434 CCACCACGCCTGGCTAATTTTGG - Intronic
969420622 4:7092833-7092855 CCACCATGCCTGGCTAATTTTGG + Intergenic
969633027 4:8349493-8349515 CCACCACGCCTGGCCAAGACAGG - Intergenic
970455583 4:16220594-16220616 CCACCATGCCCAGCAAATTTTGG - Intronic
970837762 4:20431435-20431457 GCAGCCTGCCTGGCAAAAGCAGG + Intronic
971045487 4:22801116-22801138 CCACCATGCCTGGCTAATTTTGG + Intergenic
971333463 4:25701480-25701502 CCACCATGCCCGGCCAACACAGG + Intergenic
971344106 4:25796639-25796661 CCACCATGCCTGGCTAATTTTGG - Intronic
971352571 4:25866215-25866237 CCACCATGCCTGGCCCAAAATGG + Intronic
972026252 4:34382272-34382294 CCACCACGCCTGGCCAATTTAGG - Intergenic
972044784 4:34652137-34652159 CCACCGTGCCTGGCCAAATTTGG + Intergenic
972284249 4:37633119-37633141 CCACCGTGCCTGGCCAAACATGG - Intronic
972413166 4:38813208-38813230 TCACCATGCCTGGCTAATTTTGG - Intronic
972434848 4:39023553-39023575 CCACCATGCCTGGCCTGGTCTGG - Intronic
972589320 4:40469584-40469606 TCACCATGCCTGGCTAATTTTGG + Intronic
972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG + Intronic
973318510 4:48786006-48786028 CCACCATGCCCGGCTAATTTTGG + Intergenic
973556208 4:52085754-52085776 CCACCATGCCTGGCTAATTTGGG - Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974065613 4:57074211-57074233 CCACCACGCCTGGCTAATTTTGG + Intronic
974731470 4:65872169-65872191 CCACCATGCCCGGCTAATTTTGG - Intergenic
974861659 4:67529476-67529498 CCACCACGCCTGGCAAATTTTGG + Intronic
975707564 4:77126268-77126290 CCACCACGCCTGGCGAATTTTGG + Intergenic
975864302 4:78710327-78710349 CCACCACGCCTGGCTATTTCTGG + Intergenic
976258365 4:83122246-83122268 CCACCATGCCTGGCTAATTTTGG + Intronic
976278205 4:83299855-83299877 CCACCACGCCTGGCTAATTTTGG + Intronic
976594318 4:86880317-86880339 CCACCACGCCTGGCTAATTTTGG - Intronic
976799442 4:88972452-88972474 CCACCACGCCTGGCTAATTTTGG + Intronic
976800785 4:88989312-88989334 CCACTGTGCCTGGCCAACTCAGG - Intronic
976902968 4:90202353-90202375 TCACCATGCCTGGCTAACTTTGG + Intronic
976945937 4:90767938-90767960 CCACCATGCCTGACCAAACAAGG + Intronic
977412809 4:96689768-96689790 CCACCACGCCTGGCCAAATGTGG - Intergenic
977579889 4:98713679-98713701 CCACCATGCCTGGCCGATTAGGG + Intergenic
977813565 4:101386885-101386907 CCACCATGCCTGGCAGTTGCTGG + Intergenic
977939405 4:102842820-102842842 CCACCACGCCTGGCCAAAACTGG - Intronic
978177001 4:105743944-105743966 CCACCATGCCTCGCCAAAACAGG + Intronic
978298129 4:107233111-107233133 CCACCATGCCTGGCCATCTTTGG - Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978496057 4:109360246-109360268 CCACCATGCCCGGCTAATTTTGG - Intergenic
978529164 4:109697071-109697093 CCACCATGCCCGGCCAACTCAGG + Intronic
978557623 4:109997708-109997730 CCACCATACCTGGCTAACTTTGG - Intronic
978600287 4:110420064-110420086 CCACTATGCCTGGCAAACTTTGG + Intronic
978785551 4:112605446-112605468 TCACCATGCCTGGCCAAAATAGG + Intronic
978845317 4:113266588-113266610 CCACCATGCCTGGCAGAGATAGG - Intronic
979059710 4:116042661-116042683 CCACCATGCCCAGCCAAAGCTGG + Intergenic
979292227 4:118990895-118990917 CCACCATGCCCGGCCTAAGCTGG + Intronic
979646443 4:123075668-123075690 CCACCATGCCCGGCCAGTTCAGG - Intronic
979683282 4:123484245-123484267 CCACCGTGCCTGGCCCCATCTGG + Intergenic
980001102 4:127488991-127489013 CCAAAATGCCTGGAAAAATCAGG + Intergenic
980128448 4:128795797-128795819 CCACCATGCCTGGGTAATTTTGG + Intergenic
980736262 4:136893273-136893295 ACACAGTGCCTGGCAAAAACTGG + Intergenic
980762961 4:137260826-137260848 CCACCATGCCTGGCCGAGTGGGG - Intergenic
980796966 4:137697643-137697665 CCACCATGCCCGGCCAAGACTGG + Intergenic
980911589 4:138999186-138999208 CCACCGTGCCCGGCCAGATCTGG + Intergenic
981206766 4:142050820-142050842 CCACCATGGATAACAAAATCTGG + Intronic
981302638 4:143206535-143206557 CCACCACGCCTGGCTAATTTTGG - Intronic
981327070 4:143461965-143461987 CCACTGTGCCTGGCTAAATTTGG - Intronic
981485115 4:145277743-145277765 CCACCATGCCCGGCTAACTTTGG + Intergenic
981511654 4:145565030-145565052 CCACTATGCCTGGCCAAATTTGG - Intergenic
982125730 4:152182403-152182425 CCACTGTGCCTGGCCAACTCTGG + Intergenic
982270347 4:153579622-153579644 TCACCACGCCTGGCTAATTCTGG + Intronic
982272750 4:153607958-153607980 CCACCATGCCTGGCTACATTTGG - Intronic
982543408 4:156704642-156704664 CCACCATGCCTGGCTAATTTGGG - Intergenic
982643606 4:157994161-157994183 CCACCATGCCTGGCAGTTTAAGG - Intergenic
982664610 4:158245990-158246012 CCACCATGCCTGGCTAGAAGGGG - Intronic
982764176 4:159324313-159324335 CCACCATGCCTGGCACCAATAGG + Intronic
982860986 4:160448753-160448775 CCACCAAGCATGGCAAAAGCAGG + Intergenic
983085038 4:163432737-163432759 TAACAATGTCTGGCAAAATCTGG - Intergenic
983169791 4:164522480-164522502 CCACCATGCCTGGCTCTGTCAGG + Intergenic
983567921 4:169174348-169174370 CCATCATGCCAGGCCAAAACTGG + Intronic
983739164 4:171106199-171106221 CCACCATGCCTGGCCAACATAGG + Intergenic
983943549 4:173561962-173561984 CCACCACGCCCGGCCTAATCTGG - Intergenic
983951747 4:173650142-173650164 CCACTAAGCCTGGCTAAATTTGG - Intergenic
984181887 4:176493816-176493838 CCACCATGCCTGGCTAGTTTTGG - Intergenic
984443326 4:179801060-179801082 CCACCATCTCTGGGTAAATCAGG - Intergenic
984585771 4:181562825-181562847 TCACCATGCCTGGCTAATTTTGG + Intergenic
984588966 4:181595276-181595298 TCACCATGCCTGGCTAATTTTGG - Intergenic
985000007 4:185472973-185472995 CCACCATACCTGGCTAATTTTGG - Intergenic
985280927 4:188284707-188284729 CCACCATGCCCAGCCAAGTCAGG - Intergenic
985510713 5:311970-311992 CCACCATGCCTGGCCAACTATGG + Intronic
986044139 5:4021527-4021549 ACACCATGCCAGGCAAAACGTGG - Intergenic
986219661 5:5756497-5756519 CCTCCATGCCTGGCCAAACACGG + Intergenic
986503746 5:8428816-8428838 CCACAATGCCTGGCTAATTTTGG + Intergenic
986569895 5:9153891-9153913 CCATCATGCCTGGCTAATTTTGG - Intronic
986722453 5:10569441-10569463 CCACCATGCCTGCCTAATTTTGG - Intronic
986723492 5:10577280-10577302 CCACCATGCCTGGCTAATTTTGG + Intronic
986893944 5:12342450-12342472 CCACCATGCCTGGAATAATTAGG + Intergenic
986954013 5:13128481-13128503 CCACCAAGCCTGGCCCAATTTGG - Intergenic
987735518 5:21838270-21838292 CCACCATGCCTGGCCAGCACTGG - Intronic
987882644 5:23769192-23769214 CCACCATGCCCGGCCAAAACAGG + Intergenic
987982072 5:25098375-25098397 CCACCGTGCCCGGCAGAACCAGG + Intergenic
988036647 5:25835493-25835515 CCACCATACCTGGCTAATTTTGG + Intergenic
988404927 5:30811945-30811967 CCACCATACCTGGAAAATTGGGG + Intergenic
988447339 5:31302433-31302455 CCACCATGCCCGGCCAGAACTGG - Intronic
988447495 5:31304397-31304419 CCACGGTGCCTGGCCATATCTGG - Intronic
988462321 5:31451047-31451069 CCACCATGCCTGGCTAATTTTGG - Intronic
988572070 5:32377465-32377487 CCACCGTGCCCGGCAAAATGTGG + Intronic
988596044 5:32591983-32592005 CCACCATGCCTTGCCAAAGTTGG + Intronic
988598363 5:32616356-32616378 CCACCATGCCTGGCTAATTTTGG + Intergenic
988663685 5:33301617-33301639 CCACCGTGCCTGGCCATATTTGG - Intergenic
988806078 5:34741969-34741991 GCACGATGCCTGGCAAAAGTAGG + Intronic
988807144 5:34751002-34751024 CCACCATGCCTGGCTCATTTTGG + Intronic
989037649 5:37192575-37192597 CCACCGTGCCTGGCCAGATGAGG - Intronic
989053911 5:37347751-37347773 CCACCACGCCTCCCAAAATGTGG - Intronic
989309461 5:39997719-39997741 CCACCATGCCTGGCTAATTTTGG - Intergenic
989410945 5:41119848-41119870 CCACCATGCCTGGCCGATTTTGG + Intergenic
989521216 5:42402970-42402992 CCACCATGCATGGCTAATTTTGG - Intergenic
989589316 5:43098673-43098695 CCATCATGCCTGGCTAATTTTGG - Intronic
989632793 5:43504023-43504045 CCACCATGCCTAGCGAATCCAGG - Intronic
989744538 5:44812361-44812383 CCACCATGCATGGCACAAATAGG - Intronic
989987045 5:50713391-50713413 CCACTATGCCTGGCTAATTTTGG + Intronic
990246996 5:53873170-53873192 CCACCATGCCTGGCTAATTTTGG + Intergenic
990303599 5:54473360-54473382 CCACCACGCCTGGCCACACCTGG + Intergenic
990332906 5:54745160-54745182 CCACCATGCCTGGCCAGACTAGG + Intergenic
990471789 5:56122504-56122526 CCACCATGCCTGGCTAATTTTGG - Intronic
990570303 5:57071764-57071786 CCACCATGCCTGGCTAATTTTGG + Intergenic
991222090 5:64228225-64228247 CCACCGTGCCTGACCAAATTTGG - Intronic
991773470 5:70061358-70061380 CCACCATGCCCAGCTAAATTTGG + Intronic
991852764 5:70936782-70936804 CCACCATGCCCAGCTAAATTTGG + Intronic
991953572 5:71970489-71970511 CCACCATGCCTGGCTAATTTTGG + Intergenic
991958410 5:72018249-72018271 CCAGCATGCATGGAAACATCTGG + Intergenic
992026034 5:72669872-72669894 CCACCATGCCTGGCTACTTTTGG - Intergenic
992042946 5:72855146-72855168 CCACCATGCCTGGCTAATTTGGG + Intronic
992254021 5:74903602-74903624 CCACCATGCCAGGCCACATGGGG - Intergenic
992294526 5:75314442-75314464 CCACTGTGCCTGGCCAAATAAGG - Intergenic
992427938 5:76677638-76677660 CCACCATTCCAGTCACAATCTGG - Intronic
992464044 5:76986369-76986391 CCACCATGCCTGGCCATTTTTGG + Intergenic
992657442 5:78924165-78924187 GCACCAGGCCTGGCATAAGCAGG - Intronic
992798346 5:80273290-80273312 CCACCACACCTGGCTACATCAGG - Intergenic
992814135 5:80419363-80419385 CAACCATGCCTGGCCATTTCTGG + Intronic
992882827 5:81127634-81127656 CCACTGTGCCTGGCCAAATAAGG - Intronic
993638814 5:90377922-90377944 CTACCATGCCTGGCCAAGTACGG + Intergenic
993678276 5:90844518-90844540 TCACTATGCCTGGGAAAATCAGG - Intronic
993948938 5:94149902-94149924 CCACCATGCCTGGCTAATTTTGG + Intergenic
994145144 5:96386675-96386697 CCACCATGCCTGGCAAAGTATGG - Intergenic
994370367 5:98960618-98960640 CCACCATGCCCGGCCAAGTTTGG + Intergenic
994688200 5:102983156-102983178 CCACCATGCCTGGCCTTACCGGG - Intronic
994755458 5:103789145-103789167 CCACCATGCCCAGCTGAATCTGG + Intergenic
995166181 5:109044466-109044488 CCACCACGCCTGGCCAAATGAGG + Intronic
995380186 5:111523106-111523128 CCACCATGCCTGGCTGAGACAGG - Intergenic
995517034 5:112964476-112964498 CCACCATGGCTGGCCAAGGCTGG - Intergenic
995582386 5:113615549-113615571 GCACCATCCCAGGCACAATCGGG + Intergenic
995972052 5:117984359-117984381 CCACCATGCCTGGCCATATATGG + Intergenic
996721696 5:126636865-126636887 CCACCACGCCTGGCAGGATTTGG + Intergenic
997140560 5:131375949-131375971 CCACCATGCCTGGCCAAGATGGG - Intronic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997315899 5:132935481-132935503 CCACCATGTCTGGCCACACCCGG - Intronic
997462388 5:134062137-134062159 CCACCATGCCCGGCTAATTTTGG + Intergenic
997487536 5:134244029-134244051 CCACCATGCCTGGCTCCACCAGG + Intergenic
997531381 5:134583571-134583593 CCACCATGCCTGGCTGATTTTGG + Intergenic
997608800 5:135195893-135195915 CCACCGTGCCTGGCTAATTTTGG + Intronic
997681688 5:135760721-135760743 CCACCTTGCTTAGGAAAATCAGG - Intergenic
997768949 5:136534949-136534971 CCACCATGCCCGGCTAATTTTGG + Intergenic
998144987 5:139722391-139722413 CCACCACGCCTGGCTAATTTTGG - Intergenic
998147357 5:139737702-139737724 CCACCACGTCTGGCCAACTCTGG + Intergenic
998153100 5:139768433-139768455 CCACCATGCCTGGCCAAGGAAGG - Intergenic
998248583 5:140532943-140532965 CCACCATGCCTGGCTAAATTCGG - Intronic
998277186 5:140767304-140767326 CCACCACGCCTGGCCCTATCTGG + Intergenic
998288843 5:140892507-140892529 CCACCATGACTGGTAGACTCAGG + Intronic
998469031 5:142368964-142368986 CCACCATGCCTGGCTAATTTTGG + Intergenic
998497366 5:142602327-142602349 CCACCATGCCCGGCTAATTTTGG + Intronic
999057170 5:148590447-148590469 CCACCATGCTTGGCTAATTTTGG + Intronic
999218903 5:149958957-149958979 CCACCATGCCCGGCCAAATTTGG + Intergenic
1001652222 5:173324087-173324109 GCACCCTGCCTGGCAGCATCTGG + Intronic
1001995104 5:176151133-176151155 CCACCATGCCTGGCTAATTTGGG + Intergenic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1002282342 5:178138911-178138933 CCACTGTGCCTGGCAATTTCTGG - Intronic
1002351073 5:178584160-178584182 TCACCATGCCTGGCTAAATTTGG + Intronic
1002392630 5:178927822-178927844 CCACCAAGCCTGGCTGAGTCTGG + Intronic
1002399005 5:178980919-178980941 CCACCATGCCTGGCCAAGGTTGG + Exonic
1002603035 5:180365420-180365442 CCACCACGCCTGGCTAACTTTGG - Intergenic
1002668421 5:180845179-180845201 CCACCATGCCAGGCTAACTTTGG - Intergenic
1002709352 5:181185092-181185114 CCACCACGCCTGGCTAATTTTGG - Intergenic
1002723039 5:181276292-181276314 CCACCACACCTGGCAAATTTTGG + Intergenic
1002981398 6:2142222-2142244 CAACAATACCTGGCAAAAGCGGG + Intronic
1003384012 6:5650762-5650784 CCACCCTGCCTGGCCAAAGTGGG + Intronic
1003517508 6:6829309-6829331 CCACCACGCCTGGCTAATTTTGG - Intergenic
1003637866 6:7850293-7850315 CCACCATGCCTGGCTAATTTTGG + Intronic
1003699776 6:8448957-8448979 CCACCATGCCCGGCTAATTTTGG - Intergenic
1003858367 6:10298778-10298800 CCACCATGCCTGGCTGGTTCTGG + Intergenic
1003918519 6:10809943-10809965 CCACCATGCCCGGCTAATTTTGG - Intronic
1004068896 6:12278602-12278624 CCACCATGCCTGGCCCAAGCTGG - Intergenic
1004217131 6:13712836-13712858 CCTCCCTAGCTGGCAAAATCAGG + Intergenic
1004270170 6:14188216-14188238 CCACCATGCCTGGCTAAGAATGG + Intergenic
1004277752 6:14253471-14253493 TCACCATGCCTGGCAAGGTCAGG - Intergenic
1004392396 6:15220719-15220741 CCACCATGCCTGGCGAAGCTGGG + Intergenic
1004396887 6:15253348-15253370 CCACCGTGCCTGGCCAAATAAGG + Intronic
1004701059 6:18079894-18079916 CCACCATGCCTGGCCTAAGGAGG + Intergenic
1004726823 6:18319003-18319025 CCACCATGCCTGGTTAACTTTGG + Intergenic
1004729670 6:18345535-18345557 TCACCATGCCTGGCTAATTTTGG + Intergenic
1004791432 6:19031037-19031059 CCACCACGCCTGGCTAATTTTGG + Intergenic
1004993379 6:21163797-21163819 CCACCATGCCTGGCTGATTTTGG - Intronic
1005227572 6:23660276-23660298 CCACCATGCCCGGCCATATTAGG - Intergenic
1005271989 6:24176003-24176025 CCACCATGCCCGGCCTAATTAGG - Intronic
1005346744 6:24897910-24897932 CCACCATGCCTGGCTGAGGCAGG + Intronic
1005390016 6:25323454-25323476 CCACCACACCTGGCTAATTCTGG - Intronic
1005628236 6:27683858-27683880 CCACCACGCCTGGCTAATTTTGG - Intergenic
1005991651 6:30906869-30906891 CCACCACGCCCGGCTAATTCTGG - Intergenic
1006057310 6:31394992-31395014 CCACCATGGATGTCAAATTCCGG - Intergenic
1006080928 6:31566023-31566045 CCACCGTGCCTGGCTAATTTTGG - Intergenic
1006142538 6:31938938-31938960 CCACCATGCCCGGCCACACCTGG + Intronic
1006265876 6:32923076-32923098 CCACCATGCCTGGCCTGAACTGG - Intergenic
1006540768 6:34737900-34737922 CCATCATGCCTGGCTAATTTTGG - Intergenic
1006681961 6:35803725-35803747 CCACCATGCCTGGCTATGCCTGG + Intergenic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1006853962 6:37119853-37119875 CCACCACGCCTGGCTAATTTTGG - Intergenic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007516040 6:42412151-42412173 CCACCATGCCTGGCTAATTTTGG + Intronic
1007657927 6:43463596-43463618 CCACCATGCCTGGTTAATTTTGG + Intergenic
1008092087 6:47304138-47304160 CAAGCAGGCCTGGCAAATTCCGG - Intronic
1008277253 6:49555891-49555913 CCACCATGCCTGGCCAAGTGTGG + Intronic
1008435744 6:51473979-51474001 TCACAATGGCTGGAAAAATCAGG - Intergenic
1008546264 6:52586264-52586286 CCACCATGCCCGGCCTAATTTGG + Intergenic
1008790993 6:55233376-55233398 CCACCACGCATGGCCAAAGCTGG + Intronic
1008901994 6:56630933-56630955 CCACCATGCCTGGCTAACTTTGG + Intronic
1008925368 6:56886486-56886508 CCACCATGCCTGGCTGTTTCAGG - Intronic
1009357655 6:62771481-62771503 CCACCATGCCTGGCCTATTATGG - Intergenic
1009460399 6:63905615-63905637 CCACCGCGCCTGGCCAAATAAGG + Intronic
1009692423 6:67053162-67053184 CCACCACGCCTGGCTAATTTTGG - Intergenic
1009692884 6:67059314-67059336 CCACCACGCCTGGCTAATTTTGG + Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010040223 6:71372951-71372973 CCACCATGCCCGGCTAATTTTGG - Intergenic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1010227247 6:73502289-73502311 CCACCACGCCTGGCTAATTTTGG - Intronic
1010236475 6:73579286-73579308 CCACCACGCCTGGCTAATTTTGG + Intergenic
1010433128 6:75801008-75801030 CCACCGTGCCTGGCCACATGGGG + Intronic
1010687525 6:78869954-78869976 CCACCATGCTTGGCTAATTTTGG - Intronic
1011287004 6:85735570-85735592 CCACCATGCCTAGCCAATACTGG + Intergenic
1011485367 6:87835323-87835345 CCACCATGTCTGGCTAATTTTGG + Intergenic
1011496942 6:87946160-87946182 CCACGATGCCTGGCAAAGTGAGG + Intergenic
1011662503 6:89606566-89606588 CCACCATGCCAGGCCAAAAAAGG - Intronic
1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG + Intronic
1011778180 6:90755863-90755885 CCACCATGCCTGGCTAATTTTGG + Intergenic
1012230529 6:96755733-96755755 CCACCATGCCCGGCTAATTTTGG - Intergenic
1013100985 6:106986638-106986660 CCACCATGCCTGGCCACACTTGG - Intergenic
1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG + Intergenic
1013332912 6:109123779-109123801 CCACCATGCCTGGCCAGAAGTGG - Intronic
1013545968 6:111157567-111157589 CCACCGTGCCTGGCCAAACTTGG + Intronic
1013779578 6:113715165-113715187 CCACCACGCCTGGCTTAACCAGG - Intergenic
1014153081 6:118081341-118081363 ACATCATGCCTGGCATGATCAGG - Intronic
1014228514 6:118875481-118875503 CCACCATGCCTGGCTAGTTTTGG - Intronic
1014638377 6:123878071-123878093 CCACCAAGCCTGGCTAATTTTGG - Intronic
1014848200 6:126306416-126306438 CCACCATGCCTGGCCAAAGCTGG - Intergenic
1014995208 6:128134656-128134678 CCACCATGCCTGGCTAATGTTGG - Intronic
1015047521 6:128794179-128794201 CCACCATGCCTGGCTCATCCCGG - Intergenic
1015083340 6:129255251-129255273 CCACCATGTCTGGCTAATTTTGG - Intronic
1015194975 6:130515821-130515843 CCACCATGCCAGGCCAAAAATGG - Intergenic
1015344417 6:132139026-132139048 CCACCATGACTGGCCAATACGGG - Intergenic
1015495268 6:133875121-133875143 CCACCACGCCCGGCTAAATGTGG + Intergenic
1015535409 6:134262557-134262579 CCACCAGGCCTGGCTAATTTTGG - Intronic
1015717885 6:136210870-136210892 CCACCACGCCCGGCCAACTCAGG - Intergenic
1015990916 6:138942029-138942051 TCACCATGCCTGGCTAATTTTGG + Intronic
1016158589 6:140846151-140846173 CCACCATGCCTGGCTAATGTTGG - Intergenic
1016324859 6:142889183-142889205 CCACCATGCATGGCCACATCAGG - Intronic
1016470837 6:144372645-144372667 CCACCATGCCTGGCTAATTTTGG + Intronic
1016761771 6:147745892-147745914 CCACCACGCCTGGCTAATTTTGG + Intergenic
1016782426 6:147974195-147974217 CCACCATTCCTGGCACATTTTGG + Intergenic
1016954069 6:149609515-149609537 CCACCATGCCTGGCCGAGACAGG - Intronic
1017161874 6:151372865-151372887 CCACCACACCCGGCAAGATCAGG - Intronic
1017193051 6:151673593-151673615 CCACCATGCCTGGCTTAATTTGG - Intronic
1017253228 6:152304609-152304631 CCACCATGCCCGGCAATTTGAGG + Intronic
1017425459 6:154316010-154316032 CCACCAGGCCTGGCTAATTTTGG + Intronic
1017494568 6:154972127-154972149 GCACCTTGCCTGGCTAAATAAGG + Intronic
1017509587 6:155102147-155102169 CCACCATGCCTGGCTAATTTTGG + Intronic
1017581776 6:155872705-155872727 CCACCGTGCCTGGCTAATTTTGG + Intergenic
1017849813 6:158295600-158295622 CCACCATGCCTGGCCAATGCTGG - Intronic
1017867254 6:158454756-158454778 CCACCACGCCTGGCTAATTTTGG + Intronic
1017999599 6:159567409-159567431 CCACCATGCCTGGCTGTACCAGG + Intergenic
1018193062 6:161327833-161327855 CCACCATGCCTGGCTAACTTTGG + Intergenic
1018554072 6:165032815-165032837 CCACCATGCCTGGCTGAGGCTGG - Intergenic
1018825710 6:167406642-167406664 CCACCATGCCTGGCCTAGTTTGG + Intergenic
1018861303 6:167712581-167712603 GCACCTGGCCTGGCAGAATCAGG - Intergenic
1019021711 6:168924090-168924112 CCACCATGCCCGGCCAAGACAGG + Intergenic
1019393058 7:800532-800554 CCACCATGCCCGGCAAGGCCAGG + Intergenic
1019765503 7:2846819-2846841 CCACCATGCCTGGCTCATTTTGG - Intergenic
1019766884 7:2857986-2858008 TCACCATGCCTGGCTAATTTGGG - Intergenic
1019785184 7:2972277-2972299 CCACCATGCCCTGCCAGATCTGG + Intronic
1019868544 7:3736557-3736579 CCACCATGCCCGGCCACATTAGG + Intronic
1020062928 7:5166157-5166179 CCACCATGCCTGGCTAATTTTGG + Intergenic
1020072966 7:5239612-5239634 CCACCATGCCCGGCCACACCTGG - Intergenic
1020185410 7:5955459-5955481 CCACCACGCCTGGCCAACCCTGG - Intronic
1020198966 7:6064376-6064398 CCACCATGCCTGGCCGCCTCAGG + Intergenic
1020259377 7:6522060-6522082 CCACCATGCCCGGCAAGCTATGG - Intronic
1020266954 7:6567180-6567202 CCACCATGCCTGGCCATGCCTGG - Intergenic
1020283116 7:6661040-6661062 CCACCATGCCTGGCTAATTTTGG - Intergenic
1020297504 7:6769290-6769312 CCACCACGCCTGGCCAACCCTGG + Intronic
1020371598 7:7438097-7438119 CCACCATGTCTGGCTAATTTTGG - Intronic
1020882478 7:13779190-13779212 CCACCCTGCCAGGCAACTTCAGG + Intergenic
1021063226 7:16140298-16140320 CCACCATGCCAGGCAATGCCAGG + Intronic
1021602686 7:22379947-22379969 CCACCATGCCTGGTTAATTTTGG - Intergenic
1021713245 7:23437328-23437350 CCACCATGCCTGGCTACTTTTGG - Intronic
1021721741 7:23511082-23511104 CCACCGCGCCTGGCCAAATAAGG - Intronic
1021941198 7:25680424-25680446 CCACCACGCCTGGCCACACCTGG + Intergenic
1022123818 7:27336540-27336562 CCACTGTGCCTGGCTAAAGCAGG - Intergenic
1022165989 7:27762797-27762819 CCACCATGCCTGGCTAATTTTGG - Intronic
1022820075 7:33950977-33950999 CCACCAAGCCCTGCAAGATCTGG + Intronic
1023392051 7:39720208-39720230 CCACCACTCCTGGCCAAATAGGG + Intergenic
1023781002 7:43655361-43655383 CCAACATGCCCGGCAATATCTGG - Intronic
1023927450 7:44680057-44680079 CCACCATGCCTGGCTAATTTTGG - Intronic
1024083387 7:45874070-45874092 CCACCATGCCTGGCTAATTTTGG + Intergenic
1024608478 7:51042647-51042669 CCACCATGCCAGGCCAAACGTGG + Intronic
1025100071 7:56127081-56127103 CCACCATGCCTGGCTAATTTTGG - Intergenic
1025188498 7:56879236-56879258 CCACCATGCCTGGCCAGAAAAGG + Intergenic
1025683431 7:63697684-63697706 CCACCATGCCTGGCCAGAAAAGG - Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1025929779 7:65984196-65984218 CCACCATGCCCAGCTAAATATGG - Intergenic
1025958043 7:66197679-66197701 CCACCGTGCCTGGCCCATTCTGG + Intergenic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026125873 7:67579055-67579077 CCATCATGCCCGGCCAAAACTGG - Intergenic
1026313270 7:69206764-69206786 CCACCATGCTTGGCTAATTTTGG - Intergenic
1026326451 7:69314813-69314835 CCACAATGCCTGGCTAATTTTGG + Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026571730 7:71537281-71537303 CCTCCATGCCTGGTATAATATGG + Intronic
1026667202 7:72352234-72352256 CCACCACGCCTGGCTAATTTTGG - Intronic
1026693709 7:72572344-72572366 CCACCACGCCTGGCTAATTTTGG - Intronic
1026743357 7:72992485-72992507 CCACCACGCCTGGCTAATTTTGG - Intergenic
1026781135 7:73268262-73268284 CCACCATGCCTGGCTAACTTTGG + Intergenic
1026782844 7:73281546-73281568 CCACCACGCCTGGCTAATTTTGG - Intergenic
1026863741 7:73810453-73810475 CCACCGCGCCTGGCCACATCTGG + Intronic
1026927044 7:74201672-74201694 CCACCATGCCCGGCTAATTTTGG + Intronic
1026932391 7:74230804-74230826 CCACCATGCCTGGCCCATTTGGG - Intergenic
1026944960 7:74309909-74309931 CCACCATGCCTGGCCCAAAGTGG - Intronic
1027021988 7:74821704-74821726 CCACCATGCCTGGCTAACTTTGG + Intronic
1027066033 7:75124213-75124235 CCACCATGCCTGGCTAACTTTGG - Intronic
1027100378 7:75372593-75372615 CCACCACGCCTGGCTAATTTTGG + Intergenic
1027124788 7:75548749-75548771 CCACTGTGCCTGGCAAATTCTGG + Intronic
1027174293 7:75893493-75893515 CCACCATGCCTGGCTAATTTAGG + Intergenic
1027247122 7:76374831-76374853 CCACCACGCCTGGCTAATTTTGG + Intergenic
1027284508 7:76634268-76634290 CCACCGTGCCTGGCCATCTCTGG - Intergenic
1027372506 7:77521084-77521106 CCACCACGCCTGGCCAAAAATGG + Intergenic
1027680852 7:81219643-81219665 CCACCACGCCTGGCCTAATATGG + Intergenic
1027710565 7:81595490-81595512 CCACCGCGCCTGGCCAAATTTGG + Intergenic
1027775218 7:82456444-82456466 GCACCATGCCTGGCTAATTTTGG + Intergenic
1028203446 7:87989761-87989783 CCACCACCCCTGGAAAATTCTGG - Intronic
1029203945 7:98857410-98857432 CCATCGTGCCTGGCAAAACGTGG - Intronic
1029292889 7:99516128-99516150 CCACCACGCCTGGCCACATCTGG + Intronic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1029455427 7:100668485-100668507 CCACCATGCCTGGCCCCATTAGG - Intergenic
1029472664 7:100764340-100764362 CCACCATGCCTGGCTAATTTTGG - Intronic
1029610004 7:101621871-101621893 CCACCATGCCTGGCCAAGGCAGG + Intronic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1029865035 7:103618963-103618985 CCACCATGCCTGGCTAATTTTGG - Intronic
1030022855 7:105292993-105293015 CCACCACGCCTGGCCAAGCCTGG - Intronic
1030230070 7:107198495-107198517 CCACCGTGCCCAGCCAAATCTGG + Intronic
1030237577 7:107282798-107282820 CCACCATGCCTGGCCACCTGTGG + Intronic
1030308502 7:108044798-108044820 CCACCATGCCTGGCTAATTTTGG - Intronic
1030686475 7:112492389-112492411 CCATAATGGCTGGCAACATCAGG - Intergenic
1030813390 7:114004352-114004374 CCACCATGCCTGGCAGTTTTGGG - Intronic
1030829521 7:114203629-114203651 CCACCATGCCTGGCAGCACCTGG + Intronic
1030990056 7:116288745-116288767 CCACCGCGCCTGGCCAAATCAGG + Intronic
1031049057 7:116926734-116926756 CCACCATGCCTGGATAATTTTGG - Intergenic
1031086833 7:117310431-117310453 CCACCATGCCTGACTAATTTGGG - Intronic
1031505521 7:122577046-122577068 CCACCATACCTGGCCTGATCTGG + Intronic
1031619681 7:123920941-123920963 CCACCATGCCTGGCCTTATTGGG + Intergenic
1031944766 7:127828147-127828169 CCACCATGCCCGGCTAATTTTGG + Intronic
1032040793 7:128558902-128558924 CCACCATGCCTGGCTAATTTTGG + Intergenic
1032220715 7:129992034-129992056 CCACCAAGCCTGGCTAATTTTGG + Intergenic
1032599391 7:133277112-133277134 CCACCACGCCTGGCTATAACTGG + Intronic
1032783796 7:135185020-135185042 CCACCATGCCTGGCTAATTTTGG + Exonic
1032822727 7:135539471-135539493 CCACCACGCCTGGCTAATTTTGG - Intergenic
1033073632 7:138227816-138227838 CCACCATGCCTGGCTAAGAAAGG - Intergenic
1033128858 7:138728377-138728399 TCACCATGCCTGGCTAATTTTGG + Intronic
1033130002 7:138737732-138737754 CTACCATGCCTGGCTAATTTTGG + Intronic
1033160009 7:138987127-138987149 CCACCACGCCTGGCCAAAAAAGG - Intergenic
1033170253 7:139077529-139077551 CCACCATGCCTGGCATTTTATGG + Intronic
1033192055 7:139290219-139290241 CCACCGTGCCTTGCCAACTCTGG + Intronic
1033380631 7:140814375-140814397 CCACCATGTCTGGCCAACTATGG - Intronic
1033434360 7:141319688-141319710 CCACCATGCCTGGCTAATTTTGG + Intronic
1033920551 7:146386539-146386561 CCACCATGCCTGGCTAATTTTGG + Intronic
1034145428 7:148867037-148867059 CCACCACGCCTGGCCAAGACTGG - Intronic
1034572473 7:151968006-151968028 CCACCATGCCTGGCAAAACTAGG - Intronic
1034631409 7:152533212-152533234 CCATCATGCCCGGCGAAGTCAGG + Intergenic
1034701446 7:153099634-153099656 CCACCTTGCCTTTCAAAATGAGG + Intergenic
1034865942 7:154642303-154642325 CCACCATGCCAGGCCAAAGTGGG - Intronic
1034884127 7:154784664-154784686 CCACCATGCCCGTCACAATCAGG + Intronic
1034904286 7:154930192-154930214 CCACCATGCCTGGCTGAAATTGG + Intronic
1034947873 7:155275426-155275448 CCACCATACCTGGCACAAAAAGG - Intergenic
1035422053 7:158737977-158737999 CCACCATGACTGGCCTAATCAGG - Intronic
1035960287 8:4128921-4128943 CCACCATGCCCGGCTAAAACAGG - Intronic
1036065835 8:5380476-5380498 CCACCATGCCTGCCATCAACAGG - Intergenic
1036399484 8:8395511-8395533 CCACCATGCCTGGCCATGTCTGG - Intergenic
1036415112 8:8539711-8539733 CCAACATGCCTGGCTAACTTTGG - Intergenic
1036439578 8:8768615-8768637 CCACCATGCCTGGCCTATTCTGG + Intergenic
1036522292 8:9502798-9502820 CCACCATGCCTGGCTATCTGTGG + Intergenic
1036759865 8:11500666-11500688 CCACCACGCCTGGCTAATTTTGG + Intronic
1036978620 8:13443370-13443392 CCACCATGCCTGGCCTCATTTGG - Intronic
1037017650 8:13928570-13928592 CCACCATGTCTGGCTGATTCTGG - Intergenic
1037327638 8:17709719-17709741 CCACCACGCCTGGCAAATTAAGG - Intronic
1037574884 8:20192514-20192536 CCACCATGCCTGGCTGTGTCAGG - Intergenic
1037680997 8:21097287-21097309 CCACCATGCTGGGCAACACCTGG - Intergenic
1037728714 8:21505771-21505793 CCACCATGCCTGGCTAATTTTGG - Intergenic
1037794365 8:21979330-21979352 CCACCACACCTGGCCAAAGCTGG + Intronic
1038009023 8:23459033-23459055 CCACCATGCCCGGCCTAGTCTGG - Intergenic
1038199320 8:25396931-25396953 TCACCGTGCCTGGCCAAGTCAGG - Intronic
1038336004 8:26646016-26646038 CCACCATGCCCGGCTAATTTTGG + Intronic
1038355036 8:26821175-26821197 CCACCACGCCTGGCCACATTAGG + Intronic
1038508230 8:28105092-28105114 CCACCATGTCTGGCCAAGCCTGG - Intronic
1038636915 8:29294852-29294874 CCACCACGCCTGGCTAATTTTGG + Intergenic
1038700230 8:29842937-29842959 CCACCACGCCTGGCTAATTTTGG - Intergenic
1038714249 8:29977603-29977625 CCACCATGCCTGGCTAATTTTGG - Intergenic
1038726377 8:30085928-30085950 CCACTGTGCCTGGCCACATCTGG - Intergenic
1038784050 8:30594408-30594430 CCACCACGCCTGGCTAATTTTGG + Intronic
1038801907 8:30757031-30757053 CCACCATGCCCGGCCTATTCTGG - Intronic
1038827634 8:31022121-31022143 CCACCATGCCTGGCTAATTTTGG + Intronic
1039043695 8:33431257-33431279 CCACCGTGCCTGGCCAACTAGGG - Intronic
1039339104 8:36627224-36627246 CCACCATGCCTGGAAACAGCTGG + Intergenic
1039545820 8:38410484-38410506 CCACCATGCCTGGCCACTTTAGG + Intergenic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039856852 8:41422440-41422462 CCACCACGCCTGGCTAATTTTGG - Intergenic
1039872269 8:41556500-41556522 CCACCATGCCTGACCCATTCAGG + Intergenic
1039911637 8:41831358-41831380 CCACCATGCCCGGCAAACATGGG - Intronic
1039925439 8:41927497-41927519 CCACCATGCCTGGCCATGTCTGG - Intergenic
1040025772 8:42780751-42780773 CCACCATGCCTGGCTAATTTTGG + Intronic
1040464708 8:47683837-47683859 CCACCATGCCCGGCCAAATTGGG - Intronic
1040650571 8:49444857-49444879 CCACCATGCCTAGTACAATGTGG - Intergenic
1040692677 8:49958571-49958593 CCACCACGCCTGGCTAATTTTGG + Intronic
1041707845 8:60865330-60865352 CCGCCATTCCTGGCAGCATCAGG - Exonic
1041922562 8:63198552-63198574 CCACCGTGCCTGGCCAAGTTGGG + Intronic
1042134980 8:65624209-65624231 CCACCATGCCTAGCAAAAAAAGG - Intronic
1042140243 8:65670980-65671002 CCACTGTGCCTGGCAGAATATGG + Intronic
1042548797 8:69974951-69974973 CCACCATGTCTGGCTAATTTTGG + Intergenic
1042900279 8:73719114-73719136 CCACCACACCTGGCCAAAACTGG - Intronic
1042993583 8:74667940-74667962 CCTACATGCCTGACAACATCTGG - Intronic
1043469823 8:80551141-80551163 CCACCATGCCCGGCTAATTTTGG + Intergenic
1043596855 8:81897554-81897576 CCACCATGCCTGGCTAATTTTGG - Intergenic
1043793861 8:84510521-84510543 CCACCGTGCCTGGCTGAAGCTGG - Intronic
1044112313 8:88290263-88290285 CCACCGTGCCTGGCCCAATAAGG - Intronic
1044139630 8:88634767-88634789 CCACCATGCCTGGCGTGATGTGG - Intergenic
1044354857 8:91209137-91209159 CCACCACGCCTGGCCCCATCAGG - Intronic
1044384413 8:91570450-91570472 CCACCATGCCTGGCCCCTTCAGG + Intergenic
1044659642 8:94582484-94582506 CCACCACGCCTGGCCACACCTGG + Intergenic
1044778853 8:95722859-95722881 CCAACATGCCTGGCTAATTTTGG - Intergenic
1045031989 8:98145751-98145773 CCACCATGCCTGGCTAATTTTGG - Intronic
1045095636 8:98794912-98794934 CCACCACGCCTGGCTAACTTGGG - Intronic
1045171002 8:99668201-99668223 TCACCATGCCTGGTTAATTCAGG - Intronic
1045213912 8:100127933-100127955 CCACCATGCCTGGCCTAAGCCGG + Intronic
1045230756 8:100304247-100304269 TCACCATGCCTGACAAAAGTTGG + Intronic
1045517810 8:102876178-102876200 CCACCACACCTGGCAAAATTAGG + Intronic
1045520793 8:102901259-102901281 CCACCATGCCTGGCCATGTCTGG - Intronic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1045657040 8:104398196-104398218 CCAACTTGCCAGGCAAAGTCTGG - Intronic
1046095368 8:109552806-109552828 CTACCATGCCTAGCCAAGTCTGG - Intronic
1046523976 8:115360339-115360361 CCACAAGGCCTGGCACAATGTGG + Intergenic
1046537909 8:115539703-115539725 CCACCATGCCTGGCTAATTTTGG - Intronic
1046560203 8:115827000-115827022 CCACCATGCCTGGCTAATTTGGG + Intergenic
1046937819 8:119902624-119902646 CCACCATGTCTGGCAGATTTAGG + Intronic
1047209193 8:122827170-122827192 CCACCATGCCTAGCTAATTTTGG + Intronic
1047424681 8:124734438-124734460 CCACCATGCCCGGCCACACCTGG - Intergenic
1048131944 8:131707520-131707542 CCACAATGCCTGGCACACTATGG - Intergenic
1048854272 8:138673360-138673382 CCACCATGCCTGGCTAACTTTGG + Intronic
1049523185 8:143105434-143105456 CCACCATGCCTGGCCAGGCCAGG + Intergenic
1049689371 8:143952007-143952029 CCACCAAGCCCGGCAAACCCGGG + Intronic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050245863 9:3689196-3689218 CCACCACGCCTGGCTAATTTTGG + Intergenic
1050452420 9:5797360-5797382 CCACCACGCCCGGCCAAAGCTGG - Intronic
1050557907 9:6806205-6806227 CCACCATGCCTGGCCAATTTGGG - Intronic
1050765571 9:9129235-9129257 CTACCATGCCTGGCTAATTTTGG - Intronic
1050958357 9:11693872-11693894 CCACCATGCCTGGCTAATTTTGG + Intergenic
1051275524 9:15394583-15394605 CCACCGTGCCTGGCCATATTGGG - Intergenic
1051504617 9:17813589-17813611 CCACCATGCCTGGCCAGGACAGG - Intergenic
1051617339 9:19018820-19018842 CCACCATGCCCGGCATAAGAAGG - Intronic
1051640447 9:19220039-19220061 CCACCATGCCTGGCTAATTTTGG - Intergenic
1051684148 9:19639506-19639528 CCACCATGCCAGCCATCATCTGG + Intronic
1051970597 9:22882083-22882105 CCACCATCCCTGGCCCAAACTGG + Intergenic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052421293 9:28246269-28246291 CCACCATGCCCGGCTAATTTTGG - Intronic
1052660333 9:31420590-31420612 CCACCATGCCTGGCTAATTTTGG - Intergenic
1052805584 9:33010430-33010452 CCACCACGCCTGGCGAACGCAGG - Intronic
1053020849 9:34692937-34692959 CCATCATGCCCGGCTAAATTTGG + Intergenic
1053051947 9:34969352-34969374 CCACCGTGCCTGGCGAAAGAGGG - Intronic
1053061352 9:35034696-35034718 CCACCGTGCCTGGCAACACCTGG - Intergenic
1053326125 9:37153321-37153343 CCACCATGCCTGGCTAATTTTGG + Intronic
1053688370 9:40566080-40566102 CCACCATGCCCGGCCCACTCTGG + Intergenic
1053882432 9:42609768-42609790 CCACCGTGCCTGGCCAAGTGAGG - Intergenic
1053890237 9:42684534-42684556 CCACCGTGCCTGGCCAAGTGAGG + Intergenic
1053939734 9:43221556-43221578 CCACCATGCCCGGCCCACTCTGG + Intergenic
1054221457 9:62417236-62417258 CCACCGTGCCTGGCCAAGTGAGG - Intergenic
1054229257 9:62491937-62491959 CCACCGTGCCTGGCCAAGTGAGG + Intergenic
1054275660 9:63064970-63064992 CCACCATGCCCGGCCCACTCTGG - Intergenic
1054299611 9:63366991-63367013 CCACCATGCCCGGCCCACTCTGG + Intergenic
1054399173 9:64699959-64699981 CCACCATGCCCGGCCCACTCTGG + Intergenic
1054432751 9:65184225-65184247 CCACCATGCCCGGCCCACTCTGG + Intergenic
1054497634 9:65837451-65837473 CCACCATGCCCGGCCCACTCTGG - Intergenic
1054745962 9:68853966-68853988 CCAGCTTGCCTGGCACAAGCCGG - Intronic
1054781780 9:69172858-69172880 CCACCGTGCCTGGCCAGATTTGG + Intronic
1055053797 9:72005119-72005141 CCACCACGACTGGCCAAATGGGG - Intergenic
1055383673 9:75737570-75737592 CCACCATGCCAGGCCAAGACTGG + Intergenic
1055652562 9:78420914-78420936 TCACCATGCCTGGCTAATTTTGG + Intergenic
1055710064 9:79050951-79050973 CCACCATGCCTGGCTAATTTTGG + Intergenic
1055892753 9:81141056-81141078 CCACCATGCCTGGCCATGCCTGG - Intergenic
1055943341 9:81671013-81671035 CCACCATGCCTAGCTAATTTTGG - Intronic
1056167351 9:83952269-83952291 CCACCATGCCTGGCCCATTTTGG + Intronic
1056557364 9:87700786-87700808 CCACCATGCCTGGCCAATTTTGG + Intronic
1056593122 9:87980592-87980614 CCACCATGCCCGGCACAGTATGG - Intergenic
1056805636 9:89726673-89726695 CCACCACGCCTGGCAAGAATAGG + Intergenic
1056983188 9:91336342-91336364 CCACCATGCCTGGCCAATCCAGG - Intronic
1057089131 9:92240414-92240436 CCACCATGCCTGGCTAATTTTGG + Intronic
1057149767 9:92785908-92785930 CCACCATGCCTGGCCTTCTCTGG + Intergenic
1057454436 9:95194910-95194932 CCACCAAGCCTGGCCAAACTAGG - Intronic
1057890845 9:98868582-98868604 CCACCATGCCTGGCCAGTTGTGG + Intergenic
1058037047 9:100264328-100264350 CCAACATGCCTGGCCAATTAAGG - Intronic
1058065277 9:100541661-100541683 CCACCACGCCTGGCCAGATTTGG + Intronic
1058255662 9:102759651-102759673 CCACCATGCCTGGCCCAATGTGG - Intergenic
1058453883 9:105121298-105121320 CCACCATGCCCGGCTAATTTTGG - Intergenic
1058697123 9:107568809-107568831 CCACCATGCCTGGCCAAGTCTGG + Intergenic
1058710787 9:107677321-107677343 CCACCACAGCTGGCCAAATCAGG + Intergenic
1058959984 9:109983710-109983732 CCATCATGCCTGGCTAATTTTGG - Intronic
1059475455 9:114543188-114543210 CCACCATGCCCGGCTAATTTTGG - Intergenic
1059494222 9:114696468-114696490 CCACCACACCTGGCTAAATTTGG + Intergenic
1059536256 9:115083890-115083912 CCACCATGCCCGGCCAAATGAGG + Intronic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1060076712 9:120597201-120597223 CCACCACGCCTGGCTAATTTTGG + Intergenic
1060096720 9:120797351-120797373 CCACCACGCCTGGCTAATTTTGG - Intergenic
1060129648 9:121082815-121082837 CCACCACGCCTGGCTAATTTTGG - Intronic
1060190029 9:121586665-121586687 CCACCTTGCCTGGCTAATTTTGG - Intronic
1060343319 9:122795843-122795865 CCACCTTGCCTCCCAAAGTCAGG - Intergenic
1060463581 9:123882207-123882229 CCACCATGCCTGGCCCAGTGGGG - Intronic
1060592223 9:124824713-124824735 CCACCATGCCCGGCTAATTTTGG - Intergenic
1060664521 9:125424775-125424797 CCACCATGCCCGGCAAAGACAGG + Intergenic
1060707344 9:125816137-125816159 CCACCACGCCTGGCTAATTTTGG + Intronic
1060837877 9:126770724-126770746 CCACCCTGCCCGGCCAAAGCTGG + Intergenic
1060944945 9:127564718-127564740 CCACCATGCCCGGCTAATTTTGG - Intronic
1060946964 9:127575378-127575400 CCACCACGCCTGGCTAATTTTGG + Intronic
1060947017 9:127575680-127575702 CCACTATGCCTGGTTAATTCTGG + Intronic
1061154604 9:128850171-128850193 CCACCATGCCTGGCCAGCCCAGG + Intronic
1061285921 9:129622338-129622360 ACACCATGCATGGCAAATTTTGG - Intronic
1061331809 9:129899363-129899385 CCACCATGCCCGGCCAGATCTGG + Intronic
1061346078 9:130026339-130026361 CCACCCTGCCTGGCTAATTTTGG - Intronic
1061381020 9:130257691-130257713 CCACTGTGCCTGGCCAAAGCAGG - Intergenic
1061407678 9:130401608-130401630 CCACCATGCCTGGCCTAACATGG + Intronic
1061686575 9:132285457-132285479 CCACCATGCCTGGCCAGCTATGG - Intronic
1061862617 9:133475739-133475761 CCACCCTGCCTGGGGCAATCAGG - Intronic
1061910934 9:133723473-133723495 CCACCATGCCTGGCAGAAGAAGG - Intronic
1061966351 9:134015927-134015949 CCACCATGCCCGGCTAATTTTGG - Intergenic
1061990619 9:134156817-134156839 CCAGCATGCCTGGCAGAACAGGG - Intronic
1062072343 9:134563388-134563410 CCACCATGCCTGGCTACACTGGG + Intergenic
1062472134 9:136710910-136710932 CCACCGTGCCTGGCCACACCAGG - Intergenic
1062738014 9:138149230-138149252 CCACCATGCATGGCTAATTTTGG - Intergenic
1185495734 X:553591-553613 CCACCATGCCTGGGTAATTTTGG + Intergenic
1185541769 X:907971-907993 CCACCACGCCTGGCTAATTTTGG - Intergenic
1185560486 X:1056841-1056863 CCACCACGCCTGGCCAAGTCTGG + Intergenic
1185714971 X:2334315-2334337 CCACCATGCCTGGCTAATATTGG + Intronic
1185739807 X:2522615-2522637 CCACCATGCCCGGCTAATTTTGG - Intergenic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1185864925 X:3615169-3615191 CCACCACGCCTGGCTAATTTTGG + Intronic
1186323720 X:8456522-8456544 CCACCATGCCCGGCTAATTTTGG + Intergenic
1186361727 X:8849472-8849494 CCACCATGTCTGGCTTAATGTGG + Intergenic
1187019240 X:15362704-15362726 CCACCATGCCTGGCCATCTTTGG + Intronic
1187410314 X:19045458-19045480 CCACCACGCCTGGCTAATTTTGG + Intronic
1188249145 X:27870510-27870532 CCACCATGCCCGGCAACATAGGG + Intergenic
1188301473 X:28509121-28509143 CCACCACGCCTGGCTAATTTTGG + Intergenic
1188592615 X:31857089-31857111 CCACCATGCCTGGCCAAGATTGG - Intronic
1188968073 X:36579503-36579525 CAACCATGCCTGTCAAAATACGG - Intergenic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1189541564 X:41996668-41996690 CCACCATGCCTGGCTAATTTTGG + Intergenic
1189618474 X:42810412-42810434 CCACCATGCCCGGCCCCATCTGG - Intergenic
1189809686 X:44769927-44769949 CCACCAAGCCTGGCTAATTTTGG + Intergenic
1189827414 X:44933728-44933750 CCACCATGCCTGGCTAATTCTGG + Intronic
1189903768 X:45736165-45736187 CCACCATGCCTGGCCGAGTCAGG - Intergenic
1190104634 X:47550712-47550734 CCACCACGCCTGGCTAATTTTGG - Intergenic
1190168323 X:48091730-48091752 CCACCATGCCTGGCCCAAGATGG - Intergenic
1190168920 X:48095955-48095977 CCACCATGCCTGGCCCAAGATGG + Intergenic
1190692817 X:52926053-52926075 CCACCACGCCTGGCAAAACCTGG + Intergenic
1191247568 X:58240018-58240040 CCACCATGCCCGGCAAACTCAGG + Intergenic
1191967154 X:66771679-66771701 GCACCATGCCTGGCTAATTTTGG + Intergenic
1192137794 X:68620557-68620579 CCACCACGCCCGGCTAAATTTGG + Intergenic
1192235163 X:69290935-69290957 CCACCTTGCCTGGAAAATTCTGG - Intergenic
1192259736 X:69498076-69498098 CCACCATGCCTGGCCCACACTGG - Intergenic
1192431577 X:71115994-71116016 CCACCATGCCTGGCCCACTCTGG + Intergenic
1192467711 X:71369135-71369157 CCACCACGCCCGGCCACATCTGG + Intronic
1193031532 X:76903893-76903915 CCACCATGCCTGTCTAATTTTGG - Intergenic
1193186847 X:78523430-78523452 CCACCACGCCCGGCACAAACAGG - Intergenic
1193387187 X:80885651-80885673 CCACCATGCCTGGCAATCTGAGG + Intergenic
1193472039 X:81917981-81918003 ACACCATGCCTGGCTAATTTGGG - Intergenic
1194213634 X:91100060-91100082 CCACCGTGCCTGGCCATATTTGG + Intergenic
1194296102 X:92128548-92128570 CCACCACGCCTGGCTAATTTTGG + Intronic
1194454361 X:94083604-94083626 ACACCATGCCTGGCTAATTTTGG + Intergenic
1194671991 X:96745157-96745179 CCACCATGCCTGGCTAATTTTGG + Intronic
1194760270 X:97788221-97788243 CCACCATGCCTGGCAAATTTTGG - Intergenic
1195264117 X:103163800-103163822 CCACCGCGCCTGGCCGAATCTGG - Intergenic
1195602382 X:106763794-106763816 CCACCACGCCCGGCCAATTCAGG + Intronic
1196604621 X:117642652-117642674 CCACCACGCCTGGCTAATTTTGG - Intergenic
1196740809 X:119024259-119024281 CCACCACGCCTGGCCCACTCTGG + Intergenic
1196742287 X:119035833-119035855 CCACCATGCCTGGCTAATTTTGG - Intergenic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1197200896 X:123747665-123747687 CCACCATGCCTGGCCATAAAAGG + Intergenic
1197371147 X:125627640-125627662 CCTCCATCCCTGACAGAATCTGG + Intergenic
1197741845 X:129900989-129901011 CCACCACGCCTGGCTAATTTTGG + Intergenic
1197787045 X:130208846-130208868 CCACCATGCCCGGCTAATTTTGG + Intronic
1197834238 X:130677797-130677819 CCATCATGCCTGGCAAAACTGGG - Intronic
1197974808 X:132155467-132155489 CCACCATGCCTGGCCAATTTAGG + Intergenic
1198098722 X:133405259-133405281 CCACCACGCCTGGCTAATTTTGG + Intronic
1198117742 X:133560449-133560471 CCACCATGCCCGGCCAAAATAGG - Intronic
1198227654 X:134660391-134660413 CCACCATGCCTGGCCGAAAGAGG + Intronic
1198257589 X:134938017-134938039 CCACCATGCCCGGCTAATTCGGG + Intergenic
1198473885 X:136976765-136976787 CCACCGTGCCTGGCCAACGCAGG + Intergenic
1198532403 X:137559573-137559595 CCACCATGCCTGGCCCACCCTGG + Intergenic
1198617926 X:138479103-138479125 CCACCATGCCTGGCTAATTTTGG + Intergenic
1198744339 X:139874345-139874367 CCACCGCGCCTGGCACAATCAGG + Intronic
1199405507 X:147454074-147454096 CCACCATGCCTCGCTAATTTTGG - Intergenic
1199828384 X:151523536-151523558 CCACCCTGCCTGGCAAACAAGGG - Intergenic
1200017497 X:153178409-153178431 CTTTCATGCCTGGCAGAATCTGG - Intergenic
1200613607 Y:5353153-5353175 CCACCACGCCTGGCTAATTTTGG + Intronic
1200987706 Y:9321322-9321344 CCACCATGCCCGGCATGATTGGG + Intergenic
1201294313 Y:12450658-12450680 CCACCATGCCCGGCCAAAAGTGG + Intergenic
1201450786 Y:14111651-14111673 CCACCATGCCTGGCAAATTTTGG + Intergenic
1201459301 Y:14204769-14204791 CCACCATGCCTGGCCCATTTGGG - Intergenic
1201721430 Y:17102089-17102111 CCACCATGCCTAGCTAATTTTGG - Intergenic
1201901744 Y:19050568-19050590 CCACCATGCTTGGCCAAGTCTGG + Intergenic
1202120320 Y:21514876-21514898 CCACCATGCCCGGCATGATTGGG - Intronic
1202122771 Y:21538417-21538439 CCACCATGCCCGGCATGATTGGG - Intronic
1202156234 Y:21890964-21890986 CCACCATGCCCGGCATGATTGGG + Intronic
1202158682 Y:21914505-21914527 CCACCATGCCCGGCATGATTGGG + Intronic
1202185134 Y:22179430-22179452 CCACCATGCCCGGCATGATTGGG + Intronic
1202206226 Y:22406967-22406989 CCACCATGCCCGGCATGATTGGG - Intronic