ID: 1161627238

View in Genome Browser
Species Human (GRCh38)
Location 19:5334378-5334400
Sequence GTGTAAGCACAGATTCAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161627238_1161627242 19 Left 1161627238 19:5334378-5334400 CCGTTCTGAATCTGTGCTTACAC 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1161627242 19:5334420-5334442 TCCTAACAATCCCTCAAGGTGGG 0: 2
1: 0
2: 3
3: 36
4: 187
1161627238_1161627239 15 Left 1161627238 19:5334378-5334400 CCGTTCTGAATCTGTGCTTACAC 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1161627239 19:5334416-5334438 TTCCTCCTAACAATCCCTCAAGG 0: 1
1: 0
2: 2
3: 21
4: 197
1161627238_1161627241 18 Left 1161627238 19:5334378-5334400 CCGTTCTGAATCTGTGCTTACAC 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1161627241 19:5334419-5334441 CTCCTAACAATCCCTCAAGGTGG 0: 1
1: 1
2: 3
3: 16
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161627238 Original CRISPR GTGTAAGCACAGATTCAGAA CGG (reversed) Intronic
903491062 1:23728959-23728981 ATGTAAGCACGGCTTGAGAAGGG - Intergenic
905608663 1:39328531-39328553 GTTTAAGCACAAATGCACAAAGG + Intronic
909116317 1:71541625-71541647 GGGTAAGGACAGATTCAACATGG + Intronic
910087428 1:83420038-83420060 GTGTTAGGAAAGACTCAGAATGG + Intergenic
910544876 1:88403873-88403895 GTGTAATCATAGAGTCAGAATGG - Intergenic
911391019 1:97243428-97243450 GTGTAAACTGAGATTCAGCAGGG + Intronic
914514040 1:148358469-148358491 GTGAAAGAACAGATTTGGAAGGG - Intergenic
915255923 1:154628471-154628493 GTGTAAACACAAATTCAGGATGG - Intergenic
915658985 1:157385975-157385997 GTATATTCACAGATGCAGAAAGG + Intergenic
915867182 1:159515195-159515217 GTATAAGCACTGATGCAGGAAGG + Intergenic
917851255 1:179066310-179066332 GTATAAGTACAGATTCAAATTGG - Intronic
920613224 1:207463164-207463186 GTGTAATCACAGAGTCCTAAAGG - Intronic
923021085 1:230164410-230164432 GAGAAAGCAAAGATTCAGTAGGG + Intronic
924664373 1:246055519-246055541 CTGAAAGCACAGATTCAAATAGG + Intronic
1063915239 10:10875376-10875398 GTGTAATCACATTTTCAGAGGGG + Intergenic
1064486195 10:15793296-15793318 GTTTAATCTCAGATTCAGAAAGG - Intronic
1068100322 10:52544725-52544747 GAATATGCAAAGATTCAGAAAGG + Intergenic
1068799011 10:61118285-61118307 GTGCAAGCAGAGATTGTGAATGG - Intergenic
1072563812 10:96600883-96600905 GTGTGTCCACAGATGCAGAAAGG - Intronic
1073986125 10:109211194-109211216 GTGAGAGCACAGATTAGGAATGG + Intergenic
1076605214 10:131685057-131685079 GTGTTATCACAGACGCAGAAGGG + Intergenic
1076991643 11:279009-279031 GTGGAAGGACAGAAGCAGAAAGG + Intronic
1078388216 11:10911839-10911861 GTGTAAAGACAGAAACAGAAAGG + Intergenic
1085717762 11:78888381-78888403 GTCTAAGCCAATATTCAGAAGGG + Intronic
1085775527 11:79362745-79362767 GTGAAAGAACAGGTTCAGAGAGG - Intronic
1085976587 11:81662014-81662036 GTGTGAGCCCAGATTAAAAATGG + Intergenic
1091511445 12:1131297-1131319 GTGTGATCACAGAGTTAGAAAGG + Intronic
1092562837 12:9634393-9634415 GTGTAAGGACAGAAAAAGAAAGG - Intergenic
1093907058 12:24705431-24705453 GTATAACCACAGAGTTAGAAAGG - Intergenic
1097769046 12:63559113-63559135 GTGTAAGCACAGGATAAAAAAGG - Exonic
1098581240 12:72102017-72102039 CTTTAAGCAAAGATTCAGACAGG - Intronic
1100477288 12:94946197-94946219 GCGTAAGCACAGACACAGAGAGG - Intronic
1100507054 12:95232472-95232494 GAATAAGCACAGATTCATATAGG + Intronic
1100912339 12:99379295-99379317 GTGCAAGCCCTGAATCAGAATGG + Intronic
1104835874 12:131790027-131790049 GTGTAAGAACTGATTCAGGCAGG - Intronic
1106308623 13:28534290-28534312 GTGAAAGCAGGGGTTCAGAATGG + Intergenic
1107530876 13:41281125-41281147 GTGTGAGCACACACTCAGGAAGG + Intergenic
1109862592 13:68219907-68219929 AAGTAATCACAGATTTAGAAGGG + Intergenic
1110965228 13:81686324-81686346 ATGTAGGCACAGAGACAGAAGGG - Intergenic
1111202465 13:84957673-84957695 CTTAAAGCAGAGATTCAGAAAGG - Intergenic
1115933378 14:38523560-38523582 TTGCAAGCACAGATTCATAATGG + Intergenic
1116542876 14:46120492-46120514 GTGTATGCAGATATTCATAATGG + Intergenic
1119090543 14:71776928-71776950 GTGATGGCGCAGATTCAGAAAGG + Intergenic
1120029908 14:79629602-79629624 GTGAAATCACAGATTCCAAAAGG + Intronic
1120039327 14:79734856-79734878 GTGCAAGCATTTATTCAGAAAGG - Intronic
1121085199 14:91140730-91140752 GTGGCAGCACAGATTACGAATGG - Intronic
1121228247 14:92337430-92337452 GTGGAAGCACAGCTTCTCAATGG - Intronic
1121831828 14:97059365-97059387 GTGGAACCAATGATTCAGAAAGG - Intergenic
1130435451 15:83894153-83894175 GTGTCAGGAAAGCTTCAGAAAGG + Intronic
1131337863 15:91567059-91567081 GTGAAAACACAGATTCTGGAAGG + Intergenic
1131592108 15:93761032-93761054 GAGTATGCACAGATTCAATATGG - Intergenic
1133382917 16:5346020-5346042 GTCTCAGCACAGATACTGAAAGG - Intergenic
1134600756 16:15531778-15531800 GTGGCAGCAGAGATTGAGAAGGG + Intronic
1134865904 16:17606877-17606899 AAGGAGGCACAGATTCAGAAAGG + Intergenic
1138857848 16:60716194-60716216 CTGTAAACACAGATTTTGAAAGG - Intergenic
1138872250 16:60905301-60905323 GAGTATGCACAGATTCACACGGG + Intergenic
1140972036 16:80022834-80022856 GTGTAAGAAAAGATACTGAATGG + Intergenic
1147056348 17:37838355-37838377 AAGTGAGCACAGATTCAGGAGGG - Intergenic
1148559731 17:48598969-48598991 GTCTAGCCACAGAGTCAGAAGGG - Intronic
1149185123 17:53988894-53988916 GTGTAAGCACAGACTCATTCAGG + Intergenic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1149747392 17:59112458-59112480 ATGTAATCACAGATTTAGAAAGG + Intronic
1154261924 18:12842524-12842546 ATGTAAGCACAGATGTGGAAGGG + Intronic
1156037008 18:32775517-32775539 GTTTATGCACAGATTATGAAGGG - Intergenic
1158614648 18:58975432-58975454 CCGTAAGCACAGAAACAGAAAGG + Intronic
1160278912 18:77468388-77468410 ATATAAGCACAGATTTGGAAGGG + Intergenic
1161627238 19:5334378-5334400 GTGTAAGCACAGATTCAGAACGG - Intronic
1165640082 19:37377326-37377348 GTATGAGTACAGATACAGAAGGG + Intronic
1165700782 19:37935839-37935861 GAGTCAGCCCAGATTCAGTATGG + Intronic
925507352 2:4583346-4583368 GAGGAAGCACAGAACCAGAAAGG + Intergenic
925751255 2:7091810-7091832 GTGTTATCACAGAACCAGAAAGG - Intergenic
927450728 2:23207194-23207216 GTGGAAGCAGGGATTCAGAGCGG - Intergenic
928186828 2:29117728-29117750 ATGAAAGCACAGATTCAAGAGGG - Intronic
928207987 2:29300768-29300790 TTGTAAGCATAGACACAGAAAGG - Intronic
928216277 2:29364050-29364072 CTATAAACACAGATTCAAAATGG + Intronic
928393045 2:30923948-30923970 GTGTAAGCACAGTGGCAGAGTGG + Intronic
929653262 2:43703561-43703583 GTGTAATCAATGATTGAGAATGG + Intronic
930275952 2:49311331-49311353 GTGTAAGCTTAGATGGAGAAAGG + Intergenic
931355092 2:61529891-61529913 TTGTAACCACAGACTCACAATGG - Intronic
931935982 2:67196705-67196727 GGGTAAGTCCAGAATCAGAATGG + Intergenic
935902621 2:107808726-107808748 ATGTAAACACAGACTCAAAAGGG - Intergenic
936646881 2:114382605-114382627 GCATAATCACAGATACAGAAGGG - Intergenic
940235233 2:151504514-151504536 GTATAAGCAGAGAGTGAGAAGGG + Intronic
941461430 2:165776911-165776933 GTTTAAACACAAATTGAGAAGGG + Intronic
944373947 2:199018065-199018087 GTGGATGCACAGATTCTGGATGG + Intergenic
944497506 2:200323529-200323551 GTCTAAGCAAAGAGTTAGAAGGG - Intronic
945155383 2:206832343-206832365 GAGAAAGGACAGAATCAGAAGGG + Intergenic
945775024 2:214095591-214095613 ATGAAAACACATATTCAGAAAGG - Intronic
946049901 2:216853834-216853856 AAGTAAGCTCAGATTCAGATAGG + Intergenic
946057254 2:216913140-216913162 GTGTAGGCACTAATTCAGACAGG - Intergenic
946222380 2:218239346-218239368 GGATAAGTACAGAATCAGAATGG - Intronic
947579066 2:231300782-231300804 ATGTGATCACAGATTCATAAAGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169341156 20:4797488-4797510 GAGTAAGCTCAGTTTCAGGATGG + Intronic
1169939808 20:10924778-10924800 GTGAAAGCTCAGAGTCAGGAGGG - Intergenic
1173351561 20:42250241-42250263 ATGTTAGCACAGATTCTGACTGG + Intronic
1173567868 20:44054763-44054785 GGGGAAGCAGAGGTTCAGAATGG - Intronic
1174358697 20:50014985-50015007 GTGTGAGCACACATGCAGCAGGG + Intergenic
1181584758 22:23847054-23847076 GTGGAAGGAGAGGTTCAGAAAGG + Intergenic
954726052 3:52611709-52611731 GTGGAAGGACTGCTTCAGAAGGG + Intronic
955747341 3:62153258-62153280 GTGTAAGCCCAGATTTATCAAGG - Intronic
959284208 3:104386830-104386852 TGGTAAGCAAAGATTCAGGATGG + Intergenic
959555249 3:107709943-107709965 TTGTAAGCACAGATTTAACATGG + Intronic
959614014 3:108326920-108326942 GTGGAAGCTCAAATTCAGGAAGG - Intronic
959741815 3:109729461-109729483 GAGTAGGCAACGATTCAGAATGG - Intergenic
959768214 3:110059166-110059188 GTGTAATTATAGATTCAGAGAGG - Intergenic
959859360 3:111199349-111199371 CTGTAAACACAGCTACAGAATGG - Intronic
960131508 3:114061180-114061202 ATGCAAGCATAGAATCAGAATGG - Intronic
960313801 3:116151049-116151071 CTATAAGCACAAGTTCAGAATGG - Intronic
960978305 3:123198117-123198139 GTATAATCAGAGACTCAGAAAGG - Intronic
963543234 3:146621950-146621972 ATGAAATCACAGCTTCAGAAAGG - Intergenic
965158426 3:165096624-165096646 GTGTGAGGACAGATTAATAAAGG + Intergenic
970136889 4:12935143-12935165 GTGGAAGCACAGATCATGAATGG + Intergenic
974065214 4:57071410-57071432 TTGTCAGCACAGATAAAGAAAGG - Intronic
977768472 4:100828927-100828949 GTCCAAGCAAAGATGCAGAAAGG + Intronic
978815718 4:112902612-112902634 GTCTTAGTACAAATTCAGAAAGG - Intronic
979947995 4:126858863-126858885 ATGTATGCTCAGATTCAGATTGG - Intergenic
980926693 4:139144815-139144837 GTGTAAGCACAGATCCATGTTGG - Intronic
981144961 4:141313263-141313285 GAGTGAGCACAGATAGAGAAAGG - Intergenic
983661011 4:170130933-170130955 TTGGAAGCACAAATTCAGCAGGG - Intergenic
984602598 4:181745606-181745628 AAGTAAGCACAAATGCAGAAAGG + Intergenic
986297827 5:6454381-6454403 GTGTAAGAACACAGTCAGATTGG + Intronic
988947951 5:36225541-36225563 GGGTAAACACTGATCCAGAACGG - Exonic
992315405 5:75547818-75547840 GTGTTGGCACAGTTTCAGTATGG - Intronic
993490544 5:88541477-88541499 GTTTCAGCAAAGTTTCAGAAGGG + Intergenic
994602111 5:101919460-101919482 TTGTAAGAAATGATTCAGAAAGG - Intergenic
995333556 5:110973623-110973645 GGATAGGCACAGATTCAGACTGG - Intergenic
996372741 5:122770465-122770487 GGGCAAGCACAGGATCAGAATGG - Intergenic
999756919 5:154671338-154671360 GTGGAAGCCGAGGTTCAGAAAGG - Intergenic
1001226322 5:169947466-169947488 GTGAAAGCACAGGCTCAGAGAGG + Intronic
1002817155 6:692186-692208 GTTTACTCACAGATTCATAAAGG + Intronic
1005435073 6:25801148-25801170 GTGTCACCACAGAGTCAGAAAGG + Intronic
1006391071 6:33759017-33759039 GTGTAAGTACAGAGGCAGGATGG + Intergenic
1008671232 6:53771271-53771293 GAGTATGCTAAGATTCAGAAGGG - Intergenic
1008950917 6:57158077-57158099 AAGGAAGCACAGGTTCAGAAAGG + Intronic
1010192761 6:73210388-73210410 GTGTAAGAACTGATTCAGGCAGG + Intronic
1011249511 6:85356214-85356236 GTGTCATCATAGAGTCAGAATGG - Intergenic
1011502789 6:88009286-88009308 GAGGAAGCTCAGATTCAGAGAGG - Intergenic
1012754056 6:103201961-103201983 GTGTAAGAAGAGATGCATAAAGG + Intergenic
1013845973 6:114452152-114452174 ATGCATGCACAGATTCAGACAGG + Intergenic
1014812764 6:125904683-125904705 GTGTGAGCACAGAGCCAGAATGG + Intronic
1015449021 6:133342431-133342453 AAGGAAGCACAGATTCAGATCGG + Intronic
1018983644 6:168618704-168618726 GGGTGAGCACAGATGCAGACAGG + Intronic
1019528671 7:1493042-1493064 GTAGGTGCACAGATTCAGAACGG + Exonic
1020739359 7:11993860-11993882 GTGCAGGCACAAATTCATAAAGG - Intergenic
1021559657 7:21957280-21957302 GTGTAAGCACAGACTAATAGAGG - Intergenic
1022928325 7:35080186-35080208 GTGTAAGCACAGGATAAAAAAGG - Intergenic
1026118062 7:67512986-67513008 GTTTAATCACAGACACAGAATGG + Intergenic
1027304310 7:76876519-76876541 GTGTTAGGAAAGATTCAGAATGG + Intergenic
1028373955 7:90125378-90125400 GTGTAAGCACAGGATAAAAAAGG + Intergenic
1029999807 7:105047647-105047669 GTGAAAACAAAGTTTCAGAAGGG + Intronic
1032588781 7:133173189-133173211 GTGGAAGGAGATATTCAGAAGGG - Intergenic
1033517279 7:142120242-142120264 GTGTAATCACAGCTCCAGGAAGG - Intronic
1035717819 8:1767229-1767251 GTTTGAGCAAAGAATCAGAATGG + Intronic
1036034418 8:5003723-5003745 GTGAAAGCTCAGATTCACACAGG - Intergenic
1036111017 8:5902530-5902552 TTGTAAGCTCATCTTCAGAATGG - Intergenic
1040334214 8:46407914-46407936 GTGAAAACAGAGATGCAGAATGG + Intergenic
1040497274 8:47977362-47977384 GTGTATGCACAGATGCAGTCTGG + Exonic
1040619474 8:49074280-49074302 TTGAAAGCACAGGTTCAGAATGG - Exonic
1045980119 8:108175226-108175248 ATGTAAACAAAGATTTAGAAAGG - Intergenic
1049663335 8:143830321-143830343 GTGAAAGCACAGCTACAGAAAGG + Intergenic
1050621537 9:7457494-7457516 ATGTAAGCACAGATTTAGACAGG - Intergenic
1050718722 9:8560896-8560918 GTGTAAATAAAGATGCAGAAAGG + Intronic
1051320306 9:15896697-15896719 GTGTATACACAGATACTGAAGGG - Intronic
1054989439 9:71305683-71305705 CTGTAAGCAAAGATTCACAGTGG + Intronic
1055797171 9:79987682-79987704 GTGGCATCTCAGATTCAGAATGG - Intergenic
1055933295 9:81581567-81581589 GTGCAAGCCCAGCTACAGAAGGG - Intergenic
1057743957 9:97736804-97736826 GTGTGAGGACAGATCCAGCATGG + Intergenic
1059599622 9:115762614-115762636 GTGAAAGCAGAGAATCAGAGGGG + Intergenic
1060070366 9:120541851-120541873 GTGTTAGCCCAGATTCTGCAAGG - Intronic
1203564379 Un_KI270744v1:79565-79587 GTGCAAGCGCAGGTACAGAAGGG - Intergenic
1186987666 X:15034254-15034276 GTGTGAGGACAGATGGAGAATGG + Intergenic
1188929332 X:36087115-36087137 GTGTAAGCCCAAATCCAGCATGG + Intronic
1189554836 X:42131405-42131427 GTGTAGGCAGATATTCAGACTGG + Intergenic
1190632815 X:52405038-52405060 GTGTAAGTTGAAATTCAGAAAGG + Intergenic
1191105578 X:56770178-56770200 GTGGAAGCACAGATGAAGACAGG - Intergenic
1191106571 X:56775580-56775602 GTGGAAGCACAGATGAAGACAGG - Intergenic
1194786486 X:98090876-98090898 GTGAAAGCAAAGATGGAGAAGGG + Intergenic
1195754005 X:108183071-108183093 TTGTAAGCAGAGGTTCAAAATGG + Intronic
1195767989 X:108317042-108317064 GGGCAAGCACAGAAGCAGAAAGG + Intronic
1195959948 X:110376035-110376057 GTGGAAACTGAGATTCAGAAAGG + Intronic
1197067425 X:122250451-122250473 GAGTCAGCCCATATTCAGAAAGG + Intergenic
1197237725 X:124087159-124087181 GTGGAACAACAGATTCAGAGAGG + Intronic
1198183194 X:134230027-134230049 GTGTATGCACAAATTAAGGAGGG - Intergenic
1199427025 X:147714455-147714477 GTGTAAGCAGAGAAACAGAAGGG - Intergenic