ID: 1161627515

View in Genome Browser
Species Human (GRCh38)
Location 19:5335882-5335904
Sequence CGCAGAGGGTGCCTTGATTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161627509_1161627515 -4 Left 1161627509 19:5335863-5335885 CCCCTCGGCCTCTGCGGGGCGCA 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1161627515 19:5335882-5335904 CGCAGAGGGTGCCTTGATTCCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1161627511_1161627515 -6 Left 1161627511 19:5335865-5335887 CCTCGGCCTCTGCGGGGCGCAGA 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1161627515 19:5335882-5335904 CGCAGAGGGTGCCTTGATTCCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1161627510_1161627515 -5 Left 1161627510 19:5335864-5335886 CCCTCGGCCTCTGCGGGGCGCAG 0: 1
1: 0
2: 1
3: 9
4: 111
Right 1161627515 19:5335882-5335904 CGCAGAGGGTGCCTTGATTCCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1161627503_1161627515 24 Left 1161627503 19:5335835-5335857 CCTGGGTTTATTTTCAGATGTGG 0: 1
1: 0
2: 3
3: 21
4: 208
Right 1161627515 19:5335882-5335904 CGCAGAGGGTGCCTTGATTCCGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161627515 Original CRISPR CGCAGAGGGTGCCTTGATTC CGG Intronic
900926600 1:5710003-5710025 CACAGAGGGGGCCTTGGTCCTGG - Intergenic
901143864 1:7052484-7052506 CACCGAGGGTCCCTGGATTCTGG - Intronic
905867334 1:41383133-41383155 CGCAGAGGGTTGCTGGCTTCGGG - Exonic
907732718 1:57083274-57083296 CACAGAGGCTGCCTAGAGTCTGG - Intronic
908553608 1:65234550-65234572 GGCAAAAGGTGCCTTGATTGTGG - Intergenic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
921585823 1:216945145-216945167 AGCAGAGGGTGCTTTCATTTGGG - Intronic
923120693 1:230987597-230987619 AGCCAAGGGAGCCTTGATTCTGG + Intronic
1066504381 10:36026259-36026281 AGCAGAGGGTGACTCGATTCAGG - Intergenic
1070641182 10:78171275-78171297 GGTAGATAGTGCCTTGATTCAGG + Intergenic
1078446581 11:11409366-11409388 AGCAGAGGCGGCTTTGATTCTGG - Intronic
1089712953 11:120330065-120330087 GTCTGAGGGTGCCTTGATGCTGG + Exonic
1090888051 11:130896936-130896958 CACAGAAAGCGCCTTGATTCTGG + Intronic
1101428546 12:104607536-104607558 CGCAGTGGGGGCCTTTATACAGG + Intronic
1103380619 12:120491417-120491439 CCCACAGGGTGCCTTCTTTCTGG + Intronic
1111196260 13:84877275-84877297 CACAGTGGGTACCTTGAGTCTGG - Intergenic
1115910709 14:38254579-38254601 AGCAGAGGGTGCCTTGCTGGCGG - Exonic
1118285304 14:64465498-64465520 TGCAGAGGGCGCCTTGCTCCGGG + Exonic
1121323695 14:93007530-93007552 CGCAAACTGTGCCCTGATTCTGG - Intronic
1124400307 15:29342109-29342131 GGCAGAAGGTGCCCTGATTCTGG + Intronic
1127784021 15:62340302-62340324 AGCAGAGGGTTCCTTGATCTAGG - Intergenic
1135497866 16:22968394-22968416 AGCAGAGGGTACGTTGATGCTGG - Intergenic
1138559032 16:57789032-57789054 CACAGAGGCTGGCTTGCTTCCGG + Intronic
1141537058 16:84689226-84689248 CACAGAGGGAGCCATAATTCAGG + Intergenic
1142794964 17:2300543-2300565 CCCAGGGGGTTCCTTGATTTTGG + Exonic
1143030295 17:3963933-3963955 CGCAGAGGGTGCCAGGCGTCCGG + Intronic
1143276950 17:5718738-5718760 CACAGAGAGAGCCTTGATTCTGG + Intergenic
1146928712 17:36763155-36763177 GGCAGAGGTTGCCTTGAGCCAGG - Intergenic
1147206997 17:38844532-38844554 GGCAGAGGTTGCAGTGATTCCGG - Intergenic
1151675713 17:75596385-75596407 CCCAGAGGCTTCCTTCATTCTGG - Intergenic
1151693311 17:75700733-75700755 CACGGAGGGTGACGTGATTCTGG - Intronic
1152034828 17:77865642-77865664 AGCAGAGGGTGCTTCGACTCTGG + Intergenic
1154341334 18:13504948-13504970 TGGAGAGGGTGGCTTGAGTCTGG + Intronic
1155169238 18:23254956-23254978 GGCAGAGGGAGCCTTGATTGTGG + Intronic
1155359958 18:24990044-24990066 AGCAGAGGGAGATTTGATTCCGG - Intergenic
1160162423 18:76483789-76483811 CGCAGTGGGTGCCAGGATACAGG - Intronic
1161129358 19:2579109-2579131 AGCAGAGGGTCCCGTGATTTGGG + Intronic
1161627515 19:5335882-5335904 CGCAGAGGGTGCCTTGATTCCGG + Intronic
1164000473 19:21093725-21093747 TGAAGAGGGTGCCTTGAGCCTGG - Intronic
1167725171 19:51207046-51207068 CTCAGAAGATACCTTGATTCTGG + Intergenic
925287270 2:2724031-2724053 CATAGATGGTGCCTTGTTTCTGG + Intergenic
933709903 2:85317228-85317250 CCCTGAAGGTGCCTTGATGCTGG - Intergenic
934060099 2:88284823-88284845 GGCAGTGGGTGCCTTCCTTCTGG - Intergenic
934082595 2:88482002-88482024 CCCAGAAGGAGCCTTGAGTCAGG - Intergenic
938091872 2:128439798-128439820 CTCAGAGGGCACCTTGATTTTGG + Intergenic
939056958 2:137377693-137377715 GGCAGAGGTTGCCGTGAATCAGG - Intronic
948928060 2:241112169-241112191 CCCTGAGGGTGGCTTGATTTTGG - Intronic
1168972616 20:1941253-1941275 CGCAGAAGGCTCCTTGGTTCAGG - Intergenic
1174193848 20:48758906-48758928 CGCAGATGCAGCCTGGATTCAGG - Intronic
1175906178 20:62380694-62380716 GGCAGAGTGGGCCTTGCTTCTGG + Intergenic
1178026740 21:28477151-28477173 AGCAAAGGGTGTCTTGAATCTGG - Intergenic
1179195738 21:39160836-39160858 CACAGAGGATGCCATGGTTCTGG - Intergenic
1179410805 21:41161740-41161762 CTCAGAGGGTGCCATGACTGTGG - Intergenic
1183928906 22:41225032-41225054 CGCAGATGTTGCCCAGATTCAGG - Exonic
1183933025 22:41246888-41246910 GGCTGAGGGGGCCTTCATTCTGG - Intronic
950914362 3:16628824-16628846 TGGAGAGGGTGCCTGGATTAGGG - Intronic
955072649 3:55584681-55584703 TGCTGAGGCTGCCTTGTTTCAGG + Intronic
957578008 3:82034017-82034039 AGAAGAGGGTGCCTTAGTTCAGG + Intergenic
966257444 3:177933420-177933442 CGCAAATTGTGCCCTGATTCTGG - Intergenic
968425816 4:522548-522570 TGCAGTGGGTCCCTTGATCCTGG - Intronic
969021198 4:4141642-4141664 GGCAGCGGGTGCCTGGATACTGG - Intergenic
973324052 4:48839365-48839387 GGCAGAGGTTGCATTGAGTCAGG + Intronic
975133216 4:70848707-70848729 CTCAGAGGATCCCTTGAGTCAGG - Intergenic
976405863 4:84659736-84659758 GGCAGAGGGTGCCTTGCTCAAGG + Intergenic
998517063 5:142766047-142766069 CCCAGAGGCTGCCTTGAAGCTGG + Intergenic
1001278035 5:170365230-170365252 CGCAGAGCTGGCCTTGAATCTGG + Intronic
1013235590 6:108195367-108195389 CGCAGAGGGTGCATTGCATCAGG - Intergenic
1019088488 6:169503093-169503115 GGCAGAGGGTGTCTTGCTTGAGG - Intronic
1023998348 7:45175579-45175601 GGAAGAAGGTGCCTTGAGTCTGG + Intronic
1026107034 7:67429511-67429533 CCCAGGGGGTGCCTTGCTGCTGG - Intergenic
1026281888 7:68929401-68929423 TGCAGTGGGTGCCTAGATACTGG + Intergenic
1027632265 7:80621330-80621352 TGCAGAGGATGCCTATATTCTGG + Intronic
1035374303 7:158397329-158397351 CGCTGAGGGTGTCTGGATGCAGG - Intronic
1039108279 8:34013354-34013376 CTCAGAGGGTGCCCAGTTTCAGG - Intergenic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1049153882 8:141055477-141055499 GGCAGAGGGTGCCTGGACTGCGG + Intergenic
1049995710 9:1031993-1032015 GGGAGAGGGTTCCTTGCTTCTGG + Intergenic
1056006313 9:82275207-82275229 GGAACAGGGTGCCTTGATCCTGG + Intergenic
1061609260 9:131735462-131735484 CACAGAGGATGCCTGTATTCAGG + Intronic
1062268197 9:135696923-135696945 GGCAGAGGCTGGCTTGATGCTGG - Intronic
1187326441 X:18294999-18295021 CGCAGAGGTGGCCTTGCTTCTGG - Intronic