ID: 1161629367

View in Genome Browser
Species Human (GRCh38)
Location 19:5344554-5344576
Sequence CAGTGCAAAGGCTCTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161629367_1161629374 23 Left 1161629367 19:5344554-5344576 CCTGCCACAGAGCCTTTGCACTG No data
Right 1161629374 19:5344600-5344622 TGTTCCTCCTGCTTTTCTCAAGG No data
1161629367_1161629370 -4 Left 1161629367 19:5344554-5344576 CCTGCCACAGAGCCTTTGCACTG No data
Right 1161629370 19:5344573-5344595 ACTGTCTGTTCCCTCTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161629367 Original CRISPR CAGTGCAAAGGCTCTGTGGC AGG (reversed) Intergenic
No off target data available for this crispr