ID: 1161633933

View in Genome Browser
Species Human (GRCh38)
Location 19:5375195-5375217
Sequence TGTGCTCTACGGAGTCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161633928_1161633933 22 Left 1161633928 19:5375150-5375172 CCCAGAGAAGATCTACATGCGTG No data
Right 1161633933 19:5375195-5375217 TGTGCTCTACGGAGTCATGGTGG No data
1161633929_1161633933 21 Left 1161633929 19:5375151-5375173 CCAGAGAAGATCTACATGCGTGT No data
Right 1161633933 19:5375195-5375217 TGTGCTCTACGGAGTCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161633933 Original CRISPR TGTGCTCTACGGAGTCATGG TGG Intergenic
No off target data available for this crispr