ID: 1161640292

View in Genome Browser
Species Human (GRCh38)
Location 19:5418488-5418510
Sequence ACCCACCCCCGCAGAACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161640292_1161640300 -9 Left 1161640292 19:5418488-5418510 CCCCCAGTTCTGCGGGGGTGGGT No data
Right 1161640300 19:5418502-5418524 GGGGTGGGTGGGTGTGTGGGTGG No data
1161640292_1161640301 -8 Left 1161640292 19:5418488-5418510 CCCCCAGTTCTGCGGGGGTGGGT No data
Right 1161640301 19:5418503-5418525 GGGTGGGTGGGTGTGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161640292 Original CRISPR ACCCACCCCCGCAGAACTGG GGG (reversed) Intergenic