ID: 1161641558

View in Genome Browser
Species Human (GRCh38)
Location 19:5426877-5426899
Sequence GTACATCTCCCCCACTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161641558_1161641570 24 Left 1161641558 19:5426877-5426899 CCCTCCCAGTGGGGGAGATGTAC No data
Right 1161641570 19:5426924-5426946 AACCATGATGGGGGAGATTCAGG No data
1161641558_1161641568 14 Left 1161641558 19:5426877-5426899 CCCTCCCAGTGGGGGAGATGTAC No data
Right 1161641568 19:5426914-5426936 CCACAATCAGAACCATGATGGGG No data
1161641558_1161641563 -10 Left 1161641558 19:5426877-5426899 CCCTCCCAGTGGGGGAGATGTAC No data
Right 1161641563 19:5426890-5426912 GGAGATGTACAGGTCACTTGTGG No data
1161641558_1161641566 13 Left 1161641558 19:5426877-5426899 CCCTCCCAGTGGGGGAGATGTAC No data
Right 1161641566 19:5426913-5426935 CCCACAATCAGAACCATGATGGG No data
1161641558_1161641569 15 Left 1161641558 19:5426877-5426899 CCCTCCCAGTGGGGGAGATGTAC No data
Right 1161641569 19:5426915-5426937 CACAATCAGAACCATGATGGGGG No data
1161641558_1161641564 12 Left 1161641558 19:5426877-5426899 CCCTCCCAGTGGGGGAGATGTAC No data
Right 1161641564 19:5426912-5426934 GCCCACAATCAGAACCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161641558 Original CRISPR GTACATCTCCCCCACTGGGA GGG (reversed) Intergenic
No off target data available for this crispr