ID: 1161642950

View in Genome Browser
Species Human (GRCh38)
Location 19:5435715-5435737
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1858
Summary {0: 10, 1: 32, 2: 118, 3: 371, 4: 1327}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161642950_1161642958 20 Left 1161642950 19:5435715-5435737 CCCTCCTCACTCTGCTCCAGCCA 0: 10
1: 32
2: 118
3: 371
4: 1327
Right 1161642958 19:5435758-5435780 TGTCAGACTTAGCGCTGCCTCGG No data
1161642950_1161642959 21 Left 1161642950 19:5435715-5435737 CCCTCCTCACTCTGCTCCAGCCA 0: 10
1: 32
2: 118
3: 371
4: 1327
Right 1161642959 19:5435759-5435781 GTCAGACTTAGCGCTGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161642950 Original CRISPR TGGCTGGAGCAGAGTGAGGA GGG (reversed) Intergenic
900495306 1:2973414-2973436 GTGCTGGGGCAGAGGGAGGAGGG + Intergenic
900627742 1:3617048-3617070 TGGCGGGAGCAGGGTGTAGAGGG - Intergenic
900684745 1:3940890-3940912 TGTCCCGAGCAGAGTGAGGTGGG - Intergenic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
901046473 1:6399154-6399176 TGGCTGGAGCTAAGTGAGCCAGG - Intergenic
901124111 1:6917251-6917273 TGGCTGGTGCAGGATGAGGGTGG + Intronic
901138999 1:7015890-7015912 TGGCTGGAGCAGGAGGAAGAGGG + Intronic
901165232 1:7216134-7216156 TGGCTGGAGCAGGAGGAAGAGGG + Intronic
901195226 1:7436557-7436579 TGGGAGGAGCAGGGTGAGGTCGG + Intronic
901256708 1:7834981-7835003 TGGCAGGAGGAAGGTGAGGAGGG + Intronic
901369471 1:8784111-8784133 TGGTGGGAGCAGAATGAGCAGGG - Intronic
901422767 1:9162215-9162237 TGGTGGGAGCAGAGAGGGGAGGG - Intergenic
901583260 1:10263879-10263901 TGGGTGGAGCAGAGTAAACAGGG - Intronic
901690099 1:10967259-10967281 TGTTTGGAGCAGAGGGAGGGAGG - Intronic
901753981 1:11429732-11429754 TGGCTGCAGTAGAGGGAGGGTGG - Intergenic
901814310 1:11785198-11785220 CGGCCGGAGCTGGGTGAGGATGG - Exonic
902098994 1:13969558-13969580 TGGCTGAAGCAGAGTGACTAGGG - Intergenic
902124350 1:14196148-14196170 TGGTTGGAGGAGGGTGAGCAAGG + Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902288166 1:15419861-15419883 GGGTTGGAGAAAAGTGAGGAAGG - Intronic
902315793 1:15617570-15617592 TGGCTGGTGCTGCGGGAGGACGG - Exonic
902531618 1:17094298-17094320 TGGGTGGGGCAGAGTGAGCGAGG - Intronic
902551390 1:17221729-17221751 TGGCTGGAGCTAAGTGAGCGAGG + Intronic
902596735 1:17514846-17514868 TGGCTGGAGGTGGGGGAGGAGGG + Intergenic
902608786 1:17584795-17584817 TGGCTGGAGTGGAGGGAGCAAGG + Intronic
902620187 1:17646288-17646310 GGGCTGGACATGAGTGAGGAAGG - Intronic
902667028 1:17946680-17946702 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
902708487 1:18222697-18222719 TGGGTGGAGAAGAGCCAGGAAGG + Intronic
902907076 1:19566279-19566301 TGCCTGTAGCAAAGTGAGCAAGG + Intergenic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903029565 1:20453241-20453263 GGGCTGGAGGAGGGTGAGGGTGG - Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903121439 1:21219139-21219161 TGGCTATAGCAGAATGAGGTCGG - Intronic
903169091 1:21541142-21541164 GGGCTGGAGCAGAGAACGGATGG - Intronic
903290599 1:22311697-22311719 TGGTCGGAGCAGAGTGAGGGAGG + Intergenic
903293503 1:22329298-22329320 TGGCTGGAGTAGAGTGGGCAAGG - Intergenic
903296045 1:22343675-22343697 TGGCTGCAGCAGAGTGGGCAAGG + Intergenic
903320561 1:22540663-22540685 TGGCTGGAGCAGAGTGGGCATGG + Intergenic
903598066 1:24511921-24511943 TGACTAGAGCAGAGGGAGCACGG + Intronic
903655123 1:24944258-24944280 TGGCTGGAGCAGGGTGAGGGAGG - Intronic
903681821 1:25102556-25102578 TGGCTGGAGCAGAGTGAATGGGG - Intergenic
903743943 1:25574196-25574218 AGGCTGGAGAGGAGGGAGGAAGG + Intergenic
904314012 1:29648352-29648374 TGGCTGGAGCGTAGTAAGGTGGG + Intergenic
904395591 1:30219361-30219383 TGGCCGGAGCAAAGGGAGCAGGG + Intergenic
904421608 1:30398054-30398076 AGGCTGCAGCAGGATGAGGAGGG + Intergenic
904431617 1:30468168-30468190 TGGCAGAAGCAGAGCGTGGAAGG - Intergenic
904451688 1:30617027-30617049 TGGCTGGGGCAGAGTAAAGAGGG + Intergenic
904461645 1:30684361-30684383 TGGATGGAGCAGAGATGGGAGGG - Intergenic
904706981 1:32398582-32398604 TGTCTGGAGCAGAGTGACTAAGG - Intergenic
904876901 1:33662347-33662369 TGGCTGAAGCACAGGGAGCAAGG - Intronic
904914048 1:33956960-33956982 TGGCTGGAGCATGGTGAGGAAGG - Intronic
905004079 1:34696309-34696331 TGACTGGAGCAGTGTGAGCCGGG - Intergenic
905395561 1:37664216-37664238 TGGCTGGAGCAGGGGGAGCCTGG - Intergenic
905518929 1:38582592-38582614 TGGCTGTAGCACAGTGAGTGGGG - Intergenic
905534787 1:38712753-38712775 TGGCTGGGGCTCAGTGAGTAAGG - Intergenic
906079553 1:43075735-43075757 TGGGTGGAGGAGTGGGAGGAGGG - Intergenic
906263012 1:44407333-44407355 TGGGGGGAGCAGAGTGGGCAGGG + Intronic
906283253 1:44568277-44568299 TGGCTGGAGCAGAGTGAGGTGGG - Intronic
906288973 1:44607399-44607421 TGGCTGGAGCACAGAGAGTGAGG - Intronic
906668753 1:47639841-47639863 TGGCTGGAGTTGAGTCTGGAAGG - Intergenic
906697973 1:47837511-47837533 TGGCGGGAGCAGAGGCAGGGAGG - Intronic
906889064 1:49687290-49687312 TGGCTGTAGCAGAGATAGAAAGG + Intronic
906920009 1:50054057-50054079 TGGCTTGAGAGGAGTGAGCAAGG + Intronic
907038596 1:51237480-51237502 TGGGTGGAGCAAAAAGAGGAGGG - Intronic
907078244 1:51597145-51597167 TGGCTTAAGCACAGTGAGGAAGG + Intronic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907298691 1:53471665-53471687 AGGATGGAGCAAGGTGAGGAGGG + Intergenic
907328675 1:53657469-53657491 CGGATGGAGCAGAATGTGGAAGG + Intronic
907347624 1:53795964-53795986 TGGCTGGAGCAGAGTGAGTGAGG - Intronic
907472564 1:54683500-54683522 GGGCAGGAGCAGAATCAGGAAGG - Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907508649 1:54941952-54941974 TGGCTGGAGCATGGAGAGAAAGG - Intergenic
907534740 1:55140720-55140742 GGGCAGCAGCAGAGTGAGGTAGG + Intronic
907550865 1:55303668-55303690 GGGCTGTTGCAGACTGAGGAAGG + Intergenic
907561845 1:55398269-55398291 TGGCTGGAGCAGAATGAGTGAGG + Intergenic
907615750 1:55924556-55924578 TGGCTGGAGCAGAATGAACATGG + Intergenic
907898971 1:58720071-58720093 TGGCTGGAGTGGAGTAAGCAAGG - Intergenic
907937645 1:59057199-59057221 TGGGAGGTGCAGAGTGAAGAGGG + Intergenic
908121686 1:60991803-60991825 TGGCTGGAGGAGACTGGGCAAGG - Intronic
908342197 1:63193085-63193107 TAGCTGGAGCACAGTGAACAAGG + Intergenic
908641396 1:66228025-66228047 TGGCTGGAGCAAAGTGAGTGAGG - Intronic
908647053 1:66289545-66289567 TGGCTGGAACAGAGTGAGCTAGG + Intronic
908701802 1:66910388-66910410 TGGCTGAAGCAGAGTAAACAAGG - Intronic
909122734 1:71624824-71624846 TGGATGGAGAACAGTAAGGATGG - Intronic
909584820 1:77278409-77278431 TAGCAGGAACAGGGTGAGGAAGG - Intergenic
909679063 1:78270993-78271015 TGGTTGGAACAGAGCGAGCAAGG - Intergenic
909692391 1:78423417-78423439 AAGCTTGAGCAAAGTGAGGAAGG - Intronic
909818487 1:80027681-80027703 TGGCTGGGGCAGTCAGAGGAGGG + Intergenic
909980944 1:82100186-82100208 TCTGTGGAGTAGAGTGAGGAAGG - Intergenic
910002173 1:82354242-82354264 TGGCTATAGCAGAGTGGGCAAGG - Intergenic
910104397 1:83615680-83615702 TGGCTGGGGCACAGTGAGTAAGG + Intergenic
910178322 1:84454799-84454821 TGGGTGGTGCAGCCTGAGGAGGG + Intergenic
910458900 1:87427059-87427081 TGACTGGAGCAGAGAGAGAGAGG - Intergenic
910669298 1:89757096-89757118 TGGCTGCAGTGGGGTGAGGATGG - Intronic
910758115 1:90712227-90712249 GGCCTGGAGCAGGGAGAGGACGG + Exonic
910851960 1:91657310-91657332 TGGCTGGAGAAGTGTGAGATGGG - Intergenic
910864431 1:91775345-91775367 TGGCTGGAGTGGAGTTAGCAAGG - Intronic
910894441 1:92053331-92053353 TGGCTGGAGCACAGAAAGTAAGG + Intronic
910963717 1:92786847-92786869 TGGCTGGAGCACAGACAGCAGGG - Intronic
911090961 1:94016484-94016506 CAGCTGGAGCAGGGAGAGGACGG + Intronic
911161795 1:94688854-94688876 AGGCGGGAGGAGAGTGAGGTTGG - Intergenic
911162368 1:94694099-94694121 TGGCTAGAGTAGAGTGAACAAGG + Intergenic
911279079 1:95900668-95900690 TGCCTGCAGCAGGGTGGGGAAGG + Intergenic
911297854 1:96139336-96139358 TGGCTGGAGAAGAATGAAGAGGG + Intergenic
911389218 1:97217766-97217788 GGGCTGGACCAGAGTGCTGATGG + Intronic
911646845 1:100346262-100346284 TGGCTGGAGAAGAGTGGTGTGGG + Intergenic
911758468 1:101588593-101588615 TCCATGGAGCAGAGTGGGGAGGG - Intergenic
911878728 1:103204870-103204892 TGGATGGAGCAGAATGAGGGAGG - Intergenic
912111956 1:106354251-106354273 TGGTTTGAGCAGAGTAAGCAAGG + Intergenic
912245811 1:107960638-107960660 TGGTTGGAGGAGAGTGAGTGTGG - Intronic
912447936 1:109751736-109751758 TGGCTGGTGAAGAATGAGGCGGG - Exonic
912797551 1:112701991-112702013 TGACTGGAAGAGAGTGAGGATGG - Intronic
912855769 1:113167692-113167714 TGGCTGGCGCTCAGTGAGAAAGG + Intergenic
912864961 1:113248538-113248560 TGGCAGGGGCAGAGGGAGAAAGG - Intergenic
912956440 1:114156897-114156919 AGGCTGGGGCAAAGGGAGGAGGG + Intergenic
912967834 1:114251713-114251735 GGGTAGGAGCAGAGTGATGAGGG - Intergenic
913106065 1:115615152-115615174 TGGAGTGAGCAGAGAGAGGATGG - Intergenic
913223801 1:116680893-116680915 GGGCTGGAGCTCAGTGAGGGAGG + Intergenic
913275118 1:117130148-117130170 TGGCTGGAGAAGGGCCAGGATGG - Intergenic
913314190 1:117536276-117536298 AGGCTGGAGCAGAATGAGCTAGG + Intergenic
913408802 1:118527347-118527369 TGTTTGGAGAAGAGTGAGCAAGG + Intergenic
913457689 1:119050129-119050151 TGGCTGGAGAAGAGGGACAAAGG - Intronic
913971835 1:143422463-143422485 TGTAGGGAGCAGAGTCAGGACGG - Intergenic
914066214 1:144248076-144248098 TGTAGGGAGCAGAGTCAGGACGG - Intergenic
914112939 1:144718278-144718300 TGTAGGGAGCAGAGTCAGGACGG + Intergenic
914447903 1:147765660-147765682 AGGCAGGAGCAGATTGTGGAGGG + Intronic
914667763 1:149845598-149845620 TGGCTGAAGCACAGTGACCAAGG + Intronic
914697230 1:150095741-150095763 TGGCTGGAGCATAGTGAATAAGG + Intronic
914786628 1:150838770-150838792 TGGCTAGACTTGAGTGAGGATGG - Intronic
914829563 1:151160765-151160787 TGGCTGGAGTGGAGGGAGGCAGG + Exonic
914922617 1:151857810-151857832 TGGCTGGAGGAGAGTGAAGGAGG + Intergenic
914976504 1:152368648-152368670 TGGCTAGAGCAGAGAGAGTAAGG - Intergenic
915040070 1:152960904-152960926 TTCCTGGGTCAGAGTGAGGAAGG + Intergenic
915104556 1:153525486-153525508 TGGATGGAGCTCAGAGAGGAAGG + Intergenic
915349045 1:155213217-155213239 GGGCTGGAGCAGAGAGAGAAGGG - Exonic
915352232 1:155233844-155233866 GGGCTGGAGCAGAGAGAGAAGGG - Intergenic
915456335 1:156043316-156043338 TGGCTGGAGCTGGGGCAGGAGGG + Intronic
915989569 1:160500344-160500366 GGGCTGGAGCAAAGTGAACAAGG - Intronic
916143358 1:161719122-161719144 TGGCTAGATCAGAGTGAGTGAGG + Intergenic
916362323 1:163984512-163984534 TGGCAGGAGCAGAGAGAAGGAGG + Intergenic
916667834 1:166982799-166982821 TGGCTGGAGTAAAGTGAGTGAGG - Intronic
916676163 1:167065876-167065898 GGACTGGAGCAGTGTGGGGAGGG + Intronic
916932426 1:169592571-169592593 TGTCTGGAGAAGATTGAGAAAGG + Intronic
917048331 1:170888972-170888994 AGGCTGTAGCATAGTGAGGATGG - Intergenic
917127112 1:171696760-171696782 TGGCTGCAGCACAGCAAGGAAGG + Intergenic
917137236 1:171799520-171799542 TGGCTACAGCTGAGTGGGGATGG + Intronic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
917322564 1:173798636-173798658 TGGCTAGAGCATAGTGAATAAGG - Intergenic
917432823 1:174988208-174988230 TGCCTGTAGTAGACTGAGGAAGG - Intronic
917486122 1:175456093-175456115 TGGCTGGACTAGGGTGAGCACGG - Intronic
917490505 1:175494157-175494179 TGTGTGGAGCAGAGAGAGGCCGG - Intronic
917526098 1:175789797-175789819 TGGCTGGAGCACATGGTGGAGGG - Intergenic
917994734 1:180424469-180424491 TGGTTGGAACAGAGTGAAAAAGG + Intronic
918237207 1:182592201-182592223 AGGCTGGAGCAGAGTGAGGGAGG + Intergenic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
918843906 1:189583692-189583714 TGGCCAGAGCAAAGTGAGCAGGG - Intergenic
918905726 1:190490338-190490360 TGGCTAGAGGAGAGTGACTAAGG - Intergenic
919494171 1:198243013-198243035 TGGCTGGAGTACGGTGAGCAAGG - Intronic
919673860 1:200362165-200362187 TGGCTGAAACAGAGTGAGTGAGG - Intergenic
919860037 1:201733794-201733816 TGGCTGAAGCAGAGTTAGCAAGG + Intronic
919941266 1:202288082-202288104 TGCCTGGACTAGATTGAGGAGGG - Intronic
920010318 1:202862162-202862184 TGGCCAAAGCAGACTGAGGAGGG + Intergenic
920076203 1:203338778-203338800 TGGCTGCAGCACAGAGAGAAAGG - Intergenic
920109242 1:203575474-203575496 TGGCATGGGCAGAGTGAGGGTGG - Intergenic
920460603 1:206136673-206136695 TTGCTGGTGCAGAGTGGGGATGG + Intergenic
920646231 1:207806338-207806360 AGGGTGGAGCAGAGGGAGCATGG + Intergenic
921077025 1:211707906-211707928 TGGCTGTGGCAGGGTGGGGAAGG - Intergenic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921190532 1:212704200-212704222 TGGCTGGAGTGGAGTGAGGAAGG + Intergenic
921353278 1:214259844-214259866 TGGCTAGAGCTGAGTGAGCAAGG - Intergenic
921451214 1:215308011-215308033 TGTCTTGAGCAGTCTGAGGAAGG + Intergenic
921670147 1:217916073-217916095 TGGCCAGAGCAGAGTGAGAAAGG - Intergenic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
921819750 1:219603956-219603978 TGACTGTAGCAGAATGAGAAGGG + Intergenic
922348709 1:224718386-224718408 TGGCTGGAGTGGAGTGAGCAGGG + Intronic
922503128 1:226110889-226110911 TGGCTGGAGCAAGGTCAGCAAGG - Intergenic
922564583 1:226593408-226593430 TGGGAGGAGAAGGGTGAGGATGG - Intronic
922627113 1:227059919-227059941 TGGCTGAAGTTGAGTCAGGATGG - Intronic
922655438 1:227378461-227378483 TGGCTGGAGCAGAATGAATGAGG + Intergenic
922656473 1:227388825-227388847 TGGTTGGAGCACAGGCAGGAAGG + Intergenic
922899098 1:229122620-229122642 TGTCTGGGGCAGGGAGAGGACGG + Intergenic
922927330 1:229360835-229360857 TGGCGGGAGCAGGGTGGGGAGGG + Intergenic
923167169 1:231376910-231376932 TGGCTGGAACACAGCGAGCACGG + Intronic
923234759 1:232021791-232021813 GGGGTGGGGCACAGTGAGGAGGG + Intronic
923402177 1:233625870-233625892 TGGCTGGAGCTGAGTAAGAGGGG + Intronic
923750607 1:236742917-236742939 AGGCTGGAGCAGGCTGAGAAGGG + Exonic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063875964 10:10478985-10479007 TGCCAGGAGAAGAGTGGGGATGG - Intergenic
1064240264 10:13621231-13621253 TGGAGGGAACACAGTGAGGAAGG - Intronic
1064618568 10:17191139-17191161 AGCCTGGAGTAGAGTGAGCAAGG + Intronic
1065068695 10:22000486-22000508 TGGCTGGAGCAGAGTGATCAAGG - Intronic
1065071662 10:22031218-22031240 TGGCTGGGGCTGAGGGAGCAAGG - Intergenic
1065342024 10:24716519-24716541 TGGCTAGCACAGAGTGAGGCGGG + Intronic
1065449810 10:25845138-25845160 GGGCTGGAGGAGAAAGAGGATGG - Intergenic
1065797620 10:29321785-29321807 GGGCTGGGACAGAGTGAGCAGGG - Intergenic
1066113643 10:32220206-32220228 GGGAGGGAGAAGAGTGAGGATGG + Intergenic
1066132861 10:32410845-32410867 TGGCTGGAGTGGGGTGAGAAAGG + Intergenic
1066139554 10:32489718-32489740 AGGCTGGTGCAGAGTGAGCATGG + Intronic
1067092360 10:43274469-43274491 TGGCTGGAGAAGAGTAAGTGTGG + Intergenic
1067271649 10:44796756-44796778 TGGCTGAAGCAAAGTGTGCAAGG - Intergenic
1067545966 10:47192968-47192990 GGGCTGGAGCAGAGAGGAGATGG + Intergenic
1067666483 10:48283852-48283874 TGGCTGAGGTAGAGTGAGGAAGG - Intergenic
1067690361 10:48497802-48497824 GGGATGGAGCAGAGTGAGAGGGG - Intronic
1067947804 10:50701404-50701426 GGGCTGGCGCTGGGTGAGGATGG + Intergenic
1068373124 10:56144862-56144884 GGGGTGGAGCAGGGGGAGGAGGG + Intergenic
1068492633 10:57743162-57743184 TGGCTGGAACAGAGTGAGCAAGG - Intergenic
1068597699 10:58921124-58921146 TGGCTGGAAGAGAATGAAGAAGG - Intergenic
1068897858 10:62227496-62227518 TGACTGGAGTATAGTGAGGGAGG + Intronic
1069160202 10:65083755-65083777 GGGCTGTAGCAGAGTGAGCAGGG + Intergenic
1069333258 10:67318588-67318610 TAGCTGGAGCAGAGTGAACATGG - Intronic
1069643762 10:69975689-69975711 TGGCTTTTGAAGAGTGAGGATGG + Intergenic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1069720627 10:70547464-70547486 TGGCTGGGGCAGGGTGGGGTGGG - Intronic
1069936250 10:71919252-71919274 TGCCTGCAGCAGGGTGGGGAAGG + Intergenic
1070282461 10:75059662-75059684 TGGGAGGTGCAGTGTGAGGAGGG + Intergenic
1070309832 10:75265161-75265183 TGGCTGGAGCAGAATAAACAAGG + Intergenic
1070873964 10:79783946-79783968 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1070883121 10:79866397-79866419 GGGCTGGCGCTGGGTGAGGATGG + Intergenic
1071172930 10:82888951-82888973 TGACTGGAGCGGAATGAGCAAGG + Intronic
1071505329 10:86228383-86228405 TGGGTGGTGTGGAGTGAGGATGG - Intronic
1071571609 10:86700344-86700366 TGGTTGCAGCAGGGTGTGGAAGG - Intronic
1071572636 10:86706431-86706453 TGGCTGCAGCAGAGGCAGGCTGG - Intronic
1071640896 10:87306085-87306107 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071649689 10:87382712-87382734 GGGCTGGCGCTGGGTGAGGATGG + Intergenic
1071654340 10:87431851-87431873 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1071712980 10:88067862-88067884 TGGCTGGAGCACCATCAGGAAGG + Intergenic
1071757675 10:88562463-88562485 TGGTTGGAACAAAGTGTGGAAGG + Intronic
1071961856 10:90814901-90814923 TGCCTGGGGCATAGTGAGGCAGG + Intronic
1072694934 10:97596129-97596151 TGGCTGGAGAAGAGGGAGTGTGG - Intronic
1072893337 10:99344503-99344525 GGGCTGGATCAGAGAGAGAAAGG - Intronic
1073081959 10:100865960-100865982 TGGGTGAAGAAGTGTGAGGAAGG + Intergenic
1073172025 10:101518663-101518685 TGGCTGGAACAGAGTGAGCAAGG - Intronic
1073478248 10:103768449-103768471 TGGCTGGAGTGGAGTGAGCCAGG + Intronic
1073563860 10:104519085-104519107 TGGAAGGAGCAGAGGGAAGAGGG - Intergenic
1073682114 10:105716078-105716100 TGGCTGGAGCCCAGTGAAGAGGG - Intergenic
1073805554 10:107093840-107093862 GAGCTGGAGCAGAGTGAAGGAGG - Intronic
1073949037 10:108785412-108785434 TGTCTGGGTCAGAGTGAGGGTGG - Intergenic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074068295 10:110039174-110039196 TGGAAGGAGAAGAGTTAGGAAGG - Intronic
1074436961 10:113442397-113442419 TGGCTGGGGGAGAGGGAGGAGGG - Intergenic
1074525354 10:114258417-114258439 TGACTGGGGCAGAGTGATTATGG + Intronic
1075031529 10:119027869-119027891 TGCATGGTCCAGAGTGAGGAAGG + Intergenic
1075282459 10:121151664-121151686 TGGCTGGAACAGAGTAAACAAGG - Intergenic
1075876761 10:125813928-125813950 TACCTGGAGCAGAGTGGGCATGG - Intronic
1075970840 10:126650855-126650877 AGGCTGGACCAGGGTCAGGAGGG - Intronic
1076076559 10:127538058-127538080 TGGCTGGAAGAGAGTGGGGGTGG + Intergenic
1076428114 10:130381716-130381738 TGGCAGGGGCTGAGGGAGGAGGG - Intergenic
1076648760 10:131972711-131972733 TGGCTGCAGCCTAGAGAGGAGGG - Intronic
1076676609 10:132150199-132150221 GCCCTGGAGCAGTGTGAGGAAGG - Intronic
1076870343 10:133189823-133189845 GGGCTGGGGCAGGGTGGGGAGGG - Intronic
1076873938 10:133206830-133206852 TGGGTGGAGCAGAGTGGGTGGGG - Intronic
1076885437 10:133260044-133260066 TGGCTGGAGCTGGGGGAGGCAGG + Intergenic
1077211685 11:1374035-1374057 TAACCGGAGCGGAGTGAGGAGGG - Intergenic
1077544224 11:3162153-3162175 TGGCTGGAGAAGGGCTAGGAAGG + Intronic
1077581597 11:3420818-3420840 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1077966988 11:7145453-7145475 AGGCTGGAACAGAGTGAGTGGGG + Intergenic
1078043706 11:7893528-7893550 TGGTTGGAGGAGAGAGTGGATGG - Intergenic
1078043737 11:7893703-7893725 TTGTTGGAGCAGAGAGTGGATGG + Intergenic
1078087247 11:8241514-8241536 TGGCTGGAGCACAGTGTGGGAGG - Intronic
1078099285 11:8320257-8320279 TGGCTGGGCCAGGGTGACGAAGG + Intergenic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078357958 11:10646951-10646973 TGACTGAAGGAGAATGAGGAAGG + Intronic
1078567185 11:12426375-12426397 TGGCTGGAGCATGGTGAGTAAGG + Intronic
1078740276 11:14059697-14059719 TGGCTGGGGAAGAGTGTGGGAGG + Intronic
1078797714 11:14609716-14609738 TGGCTGGAGTGCAGTGAGCAAGG + Intronic
1079003221 11:16774745-16774767 AGGTTGGAGCAGGGTGAGGAAGG - Intergenic
1079122134 11:17693740-17693762 TGGTTGGAGTAGACTGAAGAAGG + Intergenic
1079340013 11:19604018-19604040 TGGCTGGGGGAGAGGGAGCAAGG + Intronic
1079340841 11:19610747-19610769 TGGATGGAGCAGTGGGTGGATGG + Intronic
1079360351 11:19765654-19765676 AGGCTAGAGCACAGTGAGCAAGG - Intronic
1079445681 11:20554441-20554463 TGGCTGAAGCAAAGGAAGGAAGG - Intergenic
1079546080 11:21633455-21633477 TGGCTGGAGCAGAATAAACAGGG - Intergenic
1079559019 11:21798730-21798752 TGGATAGAGCAGAGTGAATAAGG - Intergenic
1079582947 11:22088735-22088757 TGGCTGGCACAGAGTGAGTTGGG - Intergenic
1080165784 11:29234553-29234575 TGGCAAGAGCAGAGTGAGAGAGG - Intergenic
1080305242 11:30828131-30828153 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1080635646 11:34121030-34121052 GGGCTGAAGCAGGGTGAGTAGGG + Intronic
1080762199 11:35262452-35262474 TGGTTGGAGCAGAGAGAAGTGGG - Intronic
1081390384 11:42522374-42522396 TGGCTGGAGATTAGTGAGAACGG - Intergenic
1081468328 11:43345898-43345920 TGGCTGCAGCAGAGTGATCAAGG - Intergenic
1081528084 11:43940721-43940743 TGGCTAAAGCAGAGTGAGAGAGG - Intronic
1081552754 11:44129403-44129425 TGGCTGGAGCAGAGTAAAGAAGG - Intronic
1081633460 11:44704982-44705004 TGGCTGGAAAGGAGTGAGCAAGG - Intergenic
1081659551 11:44879638-44879660 TGGCTGGAACAGGGTGAGGAGGG + Intronic
1082768408 11:57186696-57186718 TGGCTAGAGCAGGGTAAGTAAGG + Intronic
1082896675 11:58199014-58199036 TGGCTAGAGCAGAGTGAGTGAGG - Intergenic
1083001641 11:59297720-59297742 TGCCTGCAGCAGAGTGGGAAAGG + Intergenic
1083271923 11:61577061-61577083 GGGCTGGGGCATAGTGGGGAGGG - Intronic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083488927 11:63000649-63000671 CGGGTGGAGCAGAGTAGGGAAGG + Intronic
1083582725 11:63835413-63835435 AGCCTGGAGCAGAGTGAGTGAGG - Intergenic
1083613049 11:64013490-64013512 TGGCCGGAGCAAAGTGGAGAGGG + Intronic
1083763919 11:64833200-64833222 TGGCTGGAGCATAGTGGGTGGGG + Intronic
1083798961 11:65035238-65035260 TGGAGGGTGCAGAGTGGGGAGGG + Intronic
1083853900 11:65382727-65382749 TGGCTGCAGCAGAGAAAGCAAGG - Intronic
1083855904 11:65392986-65393008 TGGCAGGAGCAGAGTGGGAGAGG + Intronic
1083948740 11:65941861-65941883 TGGTTGGATCGGAGTGAGAAGGG + Intergenic
1084033131 11:66492645-66492667 TGGCTGGAGTAGGGTGAAGTGGG + Intronic
1084238510 11:67803641-67803663 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1084461848 11:69300592-69300614 TGGCTGGAGAGGAGGGAGTAGGG + Intronic
1084468148 11:69339350-69339372 TGGCTGCTGCAGAGTTAGGGAGG - Intronic
1084489156 11:69468953-69468975 TGGCTGGAGCCCGGTGGGGAAGG + Intergenic
1084647141 11:70465106-70465128 TGGCTGGAGCCAGGTGAGCAGGG + Intergenic
1084776611 11:71380811-71380833 TGGATGGAGGAGAGGGTGGATGG + Intergenic
1084833907 11:71789192-71789214 TGGCTGGAGTGGAGTGAGCAGGG + Intronic
1085413090 11:76303086-76303108 AGGCTGGAGTAGAGGGAGGCTGG - Intergenic
1085448342 11:76615904-76615926 GGGCTGAAGCAGGGTGGGGATGG + Intergenic
1085862107 11:80246256-80246278 TGGCTGGAGCAGGATGAGCAGGG + Intergenic
1085929124 11:81059473-81059495 TGGCTGGAGCAGAGGGAGGTAGG - Intergenic
1086600703 11:88629960-88629982 TGGCTGGAGCAAAGTAAGTTGGG - Intronic
1086910107 11:92462304-92462326 GGGTGGGAGGAGAGTGAGGATGG - Intronic
1086913860 11:92505092-92505114 TGGATGGAGCAGTGAGTGGAGGG + Intronic
1086934788 11:92733055-92733077 TGACTGGAGCCTAGAGAGGAGGG + Intronic
1086980743 11:93195699-93195721 TGGCTGAAGCAGAGTGATGGAGG - Intronic
1087227163 11:95614219-95614241 TGCCTGTGGCAGAGTGGGGAAGG + Intergenic
1087311913 11:96554519-96554541 TGGCTGAAGAATAGTGAGCATGG + Intergenic
1087743056 11:101911802-101911824 TTGCTGGAATAGAGTGAGGTAGG - Intronic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1088345297 11:108817294-108817316 TGACTGGACTAGAGTGAGCAGGG - Intronic
1088406792 11:109490224-109490246 TGGCTGGATCAGAGAGAGTGTGG + Intergenic
1088689177 11:112310859-112310881 GGGCTTGAACAGACTGAGGAGGG + Intergenic
1089294826 11:117461261-117461283 GGGCCGGGGGAGAGTGAGGAAGG - Intronic
1089454487 11:118618117-118618139 TGGCTGGAGAAGAGTCGGGAAGG - Intronic
1089572655 11:119420553-119420575 AGGCTCAAGCAGAGTGGGGAGGG - Intronic
1089598479 11:119598061-119598083 TGGCTGGAGGAGAGAGATGGAGG + Intergenic
1089611656 11:119672720-119672742 TGGCTGGAGCAGAGTGGGCAGGG - Intronic
1089800905 11:121025740-121025762 TGGCCGGGGGAGAGGGAGGAGGG + Intronic
1090003067 11:122978622-122978644 TGGTCGGAGAGGAGTGAGGAAGG + Intronic
1090014820 11:123076653-123076675 GGTCTGGAGCATAGTGAGCAAGG + Intronic
1090214871 11:124953193-124953215 TGACTGGAGCAGAGGGAGAGTGG - Intergenic
1090285301 11:125495129-125495151 TGAATGGAGCAGCGGGAGGAGGG - Intronic
1090420291 11:126570646-126570668 TGGCTGGAGCAGGCTGGAGAAGG - Intronic
1090846819 11:130536454-130536476 GGGCTGGAGCGGAGTCAGGAGGG + Intergenic
1090940876 11:131387347-131387369 GCGATGGAGCAGAGTGAAGAGGG - Intronic
1090968644 11:131620531-131620553 TAGCTGGGGCTGAGTGAGCAAGG - Intronic
1091122229 11:133065862-133065884 TGGGTGGAGCCGGGAGAGGAGGG - Intronic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091705962 12:2693551-2693573 AGGCTGCTCCAGAGTGAGGAAGG - Intronic
1091777524 12:3194229-3194251 TGACTGGAGCAGAGGCAGGTGGG + Intronic
1091922198 12:4314082-4314104 CGGCTGGAGCTGGATGAGGAGGG + Intergenic
1091938253 12:4450651-4450673 TGGCTGGAGCATAGTAAGGAGGG - Intergenic
1091968336 12:4764347-4764369 TGGCGGGAGCAGTGGGAGGAGGG - Intronic
1092090557 12:5800240-5800262 TGGCTGGGGCAGAGTGAGCACGG + Intronic
1092155113 12:6277124-6277146 TGGCAGGAGCAGAGCAAGCAAGG + Intergenic
1092221960 12:6720103-6720125 TGGCTGGACCTGATTGAGAAAGG - Intergenic
1092298195 12:7219320-7219342 TGGGTGGGGGGGAGTGAGGATGG - Intergenic
1092409198 12:8241266-8241288 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1092762240 12:11820651-11820673 TGGCTGGAGCAGAATGAAGGAGG + Intronic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1094100213 12:26753549-26753571 TGCCTGAAGCAGGGTGGGGAAGG - Intronic
1094178015 12:27561661-27561683 TGGCTGGAGCAAACTGAACAAGG - Intronic
1094435467 12:30416281-30416303 AGGCTGGAACATAGTGAGAAAGG - Intergenic
1094480521 12:30877690-30877712 TGGCTGGAGCAGACCCAGCAAGG - Intergenic
1095357885 12:41297694-41297716 TGGCTGGAGAAGGAAGAGGAAGG - Intronic
1095450057 12:42320954-42320976 TGACTGGAGATGAGTGAGTAAGG - Intronic
1095781558 12:46065778-46065800 TGGCTGGAGTGGAGTGATCAAGG - Intergenic
1095991706 12:48039238-48039260 TGGCTGAGGCAGAGTGGGCAGGG + Intergenic
1096194710 12:49642481-49642503 GGGCTGGGGCAGAGAAAGGAAGG - Exonic
1096235494 12:49923456-49923478 TGGCTGGAGCGGAGTGGCCAAGG + Intergenic
1097626434 12:62007107-62007129 TGGCTGGAGCAGAAGGAGCATGG - Intronic
1097695061 12:62767617-62767639 AGTCTGGAGAAGAGTGAGGATGG + Intronic
1097723029 12:63044365-63044387 TGGCTGGAGTGGAGTGGGCAAGG - Intergenic
1098032612 12:66269767-66269789 GGGCTGGAGGAGAGGGAGGTAGG - Intergenic
1098158938 12:67629295-67629317 TGGCTGAAGCGAAGTGAGCAAGG + Intergenic
1098228287 12:68347144-68347166 TTGGTAGAGAAGAGTGAGGAGGG - Intergenic
1098249158 12:68550842-68550864 TGGCTGGAGCACAGTGAGGAAGG - Intergenic
1098287167 12:68919009-68919031 TGGCTGGAGCCCAGTGAGCAAGG - Intronic
1098339235 12:69434649-69434671 TGGCTAGAGCAGAGGGAGGGAGG + Intergenic
1098445739 12:70564019-70564041 TGGCTGGAACAGAGTGAGCGAGG - Intronic
1098498544 12:71165065-71165087 TGGCTGCAGCAGCATGAGTAAGG - Intronic
1098855622 12:75650225-75650247 TGGATGGAGTAGAGTGAATAAGG - Intergenic
1098871570 12:75822686-75822708 TGTAAGGAGCAGACTGAGGAAGG + Intergenic
1099016369 12:77348382-77348404 TGGCTGGAGCAGAGGGAAGGGGG + Intergenic
1099366675 12:81773506-81773528 TGGCTATAGCAGAGTGGTGAGGG + Intergenic
1099541034 12:83907907-83907929 TGGCTGGAGCAGAGTGAGGTGGG + Intergenic
1099853437 12:88134259-88134281 TTGTTGGAGGAGAGGGAGGATGG - Intronic
1100169700 12:91960136-91960158 TTACTGGGGCAGAGTGAGGGAGG - Intergenic
1100255144 12:92875787-92875809 TAGCTGTAGCATAGTGAGCAAGG - Intronic
1100442215 12:94627550-94627572 TGGCTGGGGCAGTGTGAGCAGGG - Intronic
1100554519 12:95679858-95679880 TGGCTGGAACAGAGTAAGCTGGG - Intronic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101285553 12:103308556-103308578 TGGAGGGAGCAGAATGAGGAAGG + Intronic
1101563156 12:105879435-105879457 TGGCTGGGGCAGAGTGACCCAGG + Intergenic
1101699223 12:107155984-107156006 TGGCTGGGGTAGAGTGAGCCAGG + Intergenic
1101709223 12:107249315-107249337 TGGCTGGAGCGGAATGAGGCAGG - Intergenic
1101714855 12:107301804-107301826 TGGATGCAGCAAAGTGAGCAAGG - Intergenic
1101878001 12:108608145-108608167 TAGCTGGAACAGAGTGAGTTAGG + Intergenic
1102031432 12:109742064-109742086 AGGCTGGGGCAGGGTGAGGGAGG + Intronic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102158140 12:110746791-110746813 TGGCTAGAGCACAGTGTGAAAGG + Intergenic
1102247945 12:111367087-111367109 TGGCTGGAGCTGAGTGAACAAGG - Intronic
1102260240 12:111438881-111438903 TGGCTGGATCAGAGCGAGGGAGG + Intronic
1102330041 12:112021196-112021218 TGGCTGGAGCTGGGTGAGAAAGG - Intronic
1102416639 12:112768413-112768435 TGGCTGGAGCAGAGAGGACAAGG - Intronic
1102620613 12:114191684-114191706 GGGCGGGAGGAGAGAGAGGATGG + Intergenic
1102764678 12:115422479-115422501 TGGCTGGAGCAGAGAAAGCAGGG - Intergenic
1102781717 12:115571288-115571310 TGGCTGGAGCAATGTAAGCAAGG + Intergenic
1102807463 12:115794536-115794558 TGGCTGGAGAAGAGTGACCAAGG + Intergenic
1102951482 12:117034418-117034440 TGGGTGGAGAAGACTGAGCAGGG - Intergenic
1103007954 12:117436769-117436791 TGGATGAGGCAGCGTGAGGAAGG - Intronic
1103158842 12:118710563-118710585 TGGGTGCAGCAGAGAGAGAAAGG - Intergenic
1103213399 12:119182928-119182950 TGGCTGGTTCTGAGTCAGGATGG + Intronic
1103238902 12:119397786-119397808 TGGGTGGGGCAGGGTGGGGAAGG + Intronic
1103243471 12:119434772-119434794 TGGCCAGAGCAGAGTGAGAGAGG + Intronic
1103361022 12:120353713-120353735 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103799593 12:123529020-123529042 TGGCTGGAGCAGAGCAAGTGAGG - Intronic
1103865424 12:124047989-124048011 TGGCTGGAGCATAGTGAGAGAGG - Intronic
1103911449 12:124354680-124354702 TGGCTGGAACATGGTGGGGAGGG - Intronic
1103932562 12:124458306-124458328 GGGCTGCAGCAGAGAGAGGAGGG + Intronic
1103995851 12:124829547-124829569 TGGCTGGAGCAGAGTGAGCGAGG - Intronic
1104002423 12:124868716-124868738 TGGCTGGAGCAGAGTGGGCAAGG - Intronic
1104078946 12:125413500-125413522 GGACTGGGGAAGAGTGAGGATGG - Intronic
1104121590 12:125805171-125805193 TGGCTGTAGAGGAGTGAGCAAGG + Intergenic
1104169007 12:126261639-126261661 CCGCTGGAGCAGAGTGAGCCAGG + Intergenic
1104385790 12:128350583-128350605 TGGCTGGAGCAGAGTGAGTGTGG + Intronic
1104386265 12:128354258-128354280 TGGCCGGATCAGAGAGGGGAAGG - Intronic
1104417480 12:128607249-128607271 GGGCTGGAGGAGAATGAGCAAGG + Intronic
1104642045 12:130473572-130473594 TAGATGGAGCAGAGTGAGGGAGG + Intronic
1104644484 12:130487085-130487107 TGGCAAAAGCACAGTGAGGAAGG - Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1105306064 13:19169943-19169965 GGGCTGGAGAAGAGTGTGGGGGG + Intergenic
1105346016 13:19573414-19573436 TGGCTAGAACACAGTGGGGAAGG - Intergenic
1105665583 13:22552344-22552366 TGGCTGGAGCAGAGTGGGACAGG + Intergenic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1106481880 13:30143092-30143114 TGGCTGGAGCAGAGCTTGGCGGG + Intergenic
1106657264 13:31759547-31759569 TGGCTCAAGCAGAGTGAACAGGG + Intronic
1107035877 13:35901913-35901935 TGTGTGGAGAATAGTGAGGAAGG + Intronic
1107131394 13:36900094-36900116 TGGCAGGAGTAGAGAGAGCAAGG - Intronic
1107200817 13:37714646-37714668 TGGCTGGAGCACAGAGAGCAAGG - Intronic
1107451529 13:40514553-40514575 GGGCTGGAACAGAGAGAAGAAGG + Intergenic
1107497851 13:40946401-40946423 TGGATTGGGCAGGGTGAGGAAGG - Intronic
1107707640 13:43123159-43123181 GGGCTGGAGCAGAGTGGGAGAGG - Intergenic
1107798454 13:44079690-44079712 TGGCTGAAGCAGAGCGAGCAAGG + Intergenic
1107799200 13:44088298-44088320 TGGCTGAAGCAGAGCGAGCAAGG - Intergenic
1107845517 13:44508751-44508773 TGGCTGGAGCATGGGGAGCAAGG - Intronic
1108038303 13:46315432-46315454 TGGCTGGAACAAAGTAAGCAGGG + Intergenic
1108132972 13:47323279-47323301 TGGCTGGAGGACATGGAGGAAGG - Intergenic
1108224055 13:48269551-48269573 TGGCTGTAGAGGAGTGAGAAAGG - Exonic
1108243691 13:48493589-48493611 TGGAGGGAGCACAGTGGGGAGGG - Intronic
1108621376 13:52187706-52187728 TGGCTGGAACACAGTGGGGAAGG - Intergenic
1108665264 13:52623839-52623861 TGGCTGGAACACAGCGGGGAAGG + Intergenic
1108697808 13:52918154-52918176 TGACTGGAGCTGAGAGAGTAAGG + Intergenic
1109075734 13:57832414-57832436 TGGCTGGGGCAGTTGGAGGAGGG + Intergenic
1109242029 13:59901303-59901325 TGGCTGTGGCAGAGTGAAGGTGG - Intronic
1110428071 13:75391790-75391812 TGGCTGGAGTGGACTGAGTAAGG - Intronic
1110467141 13:75814916-75814938 TGGCTGGAGCAGAGGGAGTGGGG + Intronic
1110469441 13:75842265-75842287 GGGCTGGAACAGAGTGAGTAAGG - Intronic
1110684768 13:78358960-78358982 TGGATGGAGCACTGTGGGGAAGG - Intergenic
1110972168 13:81778000-81778022 GGGTTGGAGGAGGGTGAGGATGG - Intergenic
1111162751 13:84417366-84417388 TAACTGGAGCTGAGTGAGGAAGG + Intergenic
1111254920 13:85654004-85654026 TGGCTGGAGCAAAATGAAAAAGG - Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1111934581 13:94546315-94546337 GGGCTTCAGCAGAGTCAGGAAGG - Intergenic
1112117698 13:96375030-96375052 TGGCTACAGCACAGTGAGTAGGG - Intronic
1112118333 13:96382164-96382186 TCAATGGAGCAGAGTGGGGAGGG + Intronic
1112131398 13:96527762-96527784 TGGCTGGAGCAGAGGGAGGCAGG + Intronic
1112138507 13:96611784-96611806 TGGCTCAGGCAGAGTGAGCATGG + Intronic
1112202083 13:97286673-97286695 TGGCTGGAGCACAGTGTGGGGGG - Intronic
1112204799 13:97314139-97314161 TGGCTAGAGCAGAGTGAGTGAGG - Intronic
1112373941 13:98821260-98821282 GGGCAGGAGGAGAGTGAGGTGGG + Intronic
1112423078 13:99271411-99271433 CAGCTGGAGCAGAGTGATGGGGG + Intronic
1112494289 13:99893449-99893471 TGGCAGGGGCAGAGTGAGAGAGG - Exonic
1112503116 13:99957220-99957242 TGGCGGGGGTGGAGTGAGGAGGG - Intergenic
1112574922 13:100627175-100627197 TGGCTGGAGCACAGAGAGCAGGG + Intronic
1112609936 13:100946177-100946199 TGGCTGGAGTAGCCTGAGCAAGG - Intergenic
1112725823 13:102303070-102303092 TGGGTGGAGCAGAGTGAGTCGGG - Intronic
1112783322 13:102925833-102925855 GGGCTGGAGCAGGGTGGGCAAGG + Intergenic
1113062553 13:106338781-106338803 TGTATGGAGTAGAGAGAGGAGGG - Intergenic
1113281742 13:108796059-108796081 TGGCTGAAGCAGTGTCAGCAGGG + Intronic
1113356474 13:109585518-109585540 TGCCTGGAGCCGGGTGAGGCTGG - Intergenic
1113666142 13:112143223-112143245 TGGGTGCAGATGAGTGAGGAGGG - Intergenic
1114406784 14:22464184-22464206 TGGCTGAAAAAGAGTGAAGAGGG - Intergenic
1114456325 14:22856411-22856433 TGGCTGGAACAGAATGATCAAGG + Intergenic
1114846887 14:26333188-26333210 TGGCTGGAGCAGAGTGTGCAAGG - Intergenic
1115053962 14:29099629-29099651 TGCCTGGAGAATAGGGAGGAAGG - Intergenic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1115919170 14:38353928-38353950 TGGCTGGAGAGCAGTGAGCATGG - Intergenic
1115995119 14:39188087-39188109 TGGCTGGAGCAGTGTATGCAAGG + Intergenic
1116770818 14:49125110-49125132 TGGCTGTAACAGAGGGAGGCTGG - Intergenic
1116986734 14:51227854-51227876 TGGATGGAGCAGAGTGAGGAAGG + Intergenic
1116997556 14:51339688-51339710 TGGCCGGAGCAGAGTGGATAAGG - Intergenic
1117308765 14:54501623-54501645 TGACTGGAGCAGAATGAGCTGGG + Intergenic
1117602421 14:57389938-57389960 TGCGAGGAGCAGAGTAAGGAGGG + Intergenic
1117684181 14:58236618-58236640 TGGCTTGTGTAGAGTGAGTAAGG + Intronic
1117766222 14:59086052-59086074 TGGGTAGACCTGAGTGAGGAAGG - Intergenic
1118041053 14:61917439-61917461 TGGGGGGAGCATATTGAGGAAGG + Intergenic
1118142925 14:63104489-63104511 TGTCTGGAGCATAGTGAGTAAGG - Intergenic
1118589375 14:67389982-67390004 TGACTGAAGCTCAGTGAGGAAGG + Intronic
1118816303 14:69316667-69316689 TGGCTGGAGCAGAGCAAGTAAGG + Intronic
1118832855 14:69451158-69451180 TTGCTGGCGCAGAGTGATTAGGG + Intronic
1119020601 14:71108873-71108895 TGGCTGGAGCTGCTGGAGGAAGG - Exonic
1119430740 14:74566821-74566843 TGCCTGGAGCTGACTGATGAGGG - Intronic
1119600190 14:75970669-75970691 TGGCTGGAGCATGGTGAGCTGGG - Intronic
1119621053 14:76132070-76132092 TGGCTGTAGCAGAGTGCTGGGGG + Intergenic
1119674223 14:76541815-76541837 GGGCTGAAGCAAAGAGAGGAGGG + Intergenic
1119897254 14:78230717-78230739 TGGCTGGGGCACAGTGAACAAGG + Intergenic
1119935126 14:78585331-78585353 TGGCTAGTACAGAGGGAGGAAGG + Intronic
1119939924 14:78629418-78629440 TGGTTGAAGCAGAGTTAGGAGGG + Intronic
1119975134 14:79016780-79016802 TGGCTGGAGCAGGGAGAGCTTGG - Intronic
1120296592 14:82649059-82649081 AGGCTGGAGGAGGATGAGGAAGG + Intergenic
1120703373 14:87723131-87723153 TGGCTGGAGAAGAGTGGGCAAGG + Intergenic
1120708595 14:87770735-87770757 TGGGTGGTGCAGAGAGTGGAAGG - Intergenic
1120782072 14:88494286-88494308 TGGCTGGAACAGAGCAAGCAGGG + Intronic
1121307856 14:92918106-92918128 TGGCTGGGAGAGAGTGAGGCCGG - Intergenic
1121529084 14:94640119-94640141 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121792506 14:96709646-96709668 TGGGTGGAGGGGAGTGAGGGTGG + Intergenic
1121813605 14:96912678-96912700 GGGCTGGGGCAGAGTGAACAGGG + Intronic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1122144253 14:99679793-99679815 TGTCTGCGACAGAGTGAGGAGGG + Exonic
1122297697 14:100714514-100714536 GGGGTGGAGTGGAGTGAGGAGGG - Intergenic
1122306190 14:100768293-100768315 TGGCTGGTGGAGAGTGTGGCAGG + Intergenic
1122408330 14:101513350-101513372 AGCCTGGATCACAGTGAGGAGGG + Intergenic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122735740 14:103839744-103839766 TGGCTGGAGCAGAGTGAGTAAGG - Intronic
1122764270 14:104054715-104054737 CGGCTGGCACAGAGTGTGGAGGG + Intergenic
1122778232 14:104132432-104132454 GGGCTGGAGCAGAATGCGTAGGG + Intergenic
1122822230 14:104353394-104353416 GGGCAGGAGGGGAGTGAGGATGG + Intergenic
1122838172 14:104441491-104441513 TCGCTGGGGCAGAGACAGGAAGG + Intergenic
1122880232 14:104687596-104687618 AGGCCGGAGCAGGGTGAAGAAGG - Intergenic
1122976578 14:105173342-105173364 TGGAGGGAGCAGAGTGGAGAGGG - Intronic
1123737184 15:23196650-23196672 TAGCTGGAGTAGAATGAGAAGGG + Intergenic
1123779267 15:23609249-23609271 TGGCTGGAAAAAAATGAGGAGGG - Intronic
1124040181 15:26094768-26094790 TGCCTGCAGCAGGGTGGGGAAGG + Intergenic
1124288400 15:28425312-28425334 TAGCTGGAGTAGAATGAGAAGGG + Intergenic
1124294824 15:28492002-28492024 TAGCTGGAGTAGAATGAGAAGGG - Intergenic
1124781135 15:32635156-32635178 AGACTGGAGCAGAGTGAGCAAGG - Intronic
1125294514 15:38187885-38187907 AGGCTGGAGCAGACTGTGAAGGG + Intergenic
1125372864 15:38997140-38997162 TGGTTGGAGCATACTGAAGAAGG + Intergenic
1125753169 15:42044419-42044441 TGTCTGGGGCACGGTGAGGAAGG + Intronic
1125769348 15:42154538-42154560 GGGAAGGAGCAGAGTGGGGAGGG + Intronic
1125802896 15:42465994-42466016 TGGGTGGATCTGAGTGATGATGG - Intronic
1125837263 15:42763756-42763778 TGGATGGGGAAGAGTGGGGAAGG + Intronic
1125880466 15:43189596-43189618 TGGGTGGAGGAAAGTAAGGATGG - Intronic
1125935671 15:43633444-43633466 TGACTGGAGTAGAGTGAGCAGGG - Intronic
1125948442 15:43729908-43729930 TGACTGGAGTAGAGTGAGCAGGG - Intergenic
1126131738 15:45348467-45348489 AGGCTGGAGTGAAGTGAGGAAGG + Intergenic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1126334464 15:47571074-47571096 AGGCAGGAGAAGAGTGGGGAGGG - Intronic
1126591355 15:50343333-50343355 TGGCTAGAGCACAGTGACTAAGG - Intronic
1126657712 15:50997640-50997662 AGGCTGCAGTAGATTGAGGAGGG - Exonic
1127674773 15:61228830-61228852 TTGCGGGAGCAGAGTGGGGCGGG - Intronic
1127682271 15:61309485-61309507 GGGCTGGATCAGACTGAGGCAGG + Intergenic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1127931983 15:63602842-63602864 TGGCTGGAGCAGAGTGAATGAGG + Intergenic
1128072169 15:64804559-64804581 TGGATGAAGGAGAGTGAGGTGGG + Intergenic
1128072786 15:64807852-64807874 GGGAAGGTGCAGAGTGAGGATGG - Intergenic
1128523068 15:68388220-68388242 TGGCTGGAGTAGAGTGAGCTAGG - Intronic
1128586277 15:68853002-68853024 GAGCCCGAGCAGAGTGAGGAGGG + Intronic
1129108268 15:73323300-73323322 TGGCTGCAGCGGGGTGAGCAGGG + Exonic
1129113462 15:73351843-73351865 TGTCTGCAGCAGAGTGTGCAAGG - Intronic
1129240697 15:74250374-74250396 TGGCTGGAGCAAAGAGAGGGAGG - Intronic
1129262694 15:74377505-74377527 TGGCAGGTGCTCAGTGAGGAAGG - Intergenic
1129409674 15:75342588-75342610 AGGCTGGAGGAGAGAGAGGGTGG + Intronic
1129449460 15:75642343-75642365 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
1129523270 15:76198917-76198939 GGTCTGGAGCAGAGGGAGTAGGG + Intronic
1129557572 15:76528850-76528872 TGGCTGGAGCATAGCTAGGTTGG - Intronic
1129658372 15:77539638-77539660 TTTCTGGAGAAGAGTGAGGGAGG + Intergenic
1129701654 15:77771854-77771876 TGCCAGGACCAGAGTCAGGAAGG - Intronic
1129795842 15:78375196-78375218 TGGCTAGAGCACAGGGAGGTTGG + Intergenic
1130123115 15:81069370-81069392 TGGCTGGAGTGGAGCGAGGGGGG + Intronic
1130195525 15:81777150-81777172 TGGCTGGGGCATGGTCAGGACGG - Intergenic
1130415899 15:83694356-83694378 AGGCTGGCGGAGAGTGAGGTAGG + Intronic
1130801035 15:87263493-87263515 TGGCTGGACCAGAGTGATTGAGG - Intergenic
1130890695 15:88131535-88131557 TGACTGGGGCAGGGGGAGGATGG + Intronic
1130905070 15:88234503-88234525 AGGAGGGAGCAGCGTGAGGAGGG - Intronic
1130919080 15:88329036-88329058 TGGCTGGAGCAGAAGGACCAAGG + Intergenic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1131680357 15:94715477-94715499 TGGCTGGAGCAAAATAATGAAGG + Intergenic
1131934611 15:97489685-97489707 TAGCTGGAGTGGAGTGAGCAAGG - Intergenic
1131998334 15:98154966-98154988 TGGCTGTAGCACAATGAGGAGGG + Intergenic
1132530950 16:449146-449168 TGTCAGGAGCAGAGTGAGCAGGG - Intronic
1132744316 16:1430395-1430417 TGGCTGCAGCTGAGGAAGGAAGG + Intergenic
1133073423 16:3262029-3262051 TGGCTGGAGCAGAGGCACGGAGG + Intergenic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133350167 16:5096069-5096091 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1133643537 16:7741032-7741054 GGGATGGGGCAGAGGGAGGAGGG - Intergenic
1133755341 16:8758449-8758471 TGGCTGGAGCAGAGAGAGTGGGG + Intronic
1133757672 16:8774866-8774888 TGGCCGGAGAAGAGAGAGGAGGG - Intronic
1134075797 16:11290485-11290507 TGGCTGGAGCAGAGAGAGGTGGG + Intronic
1134226189 16:12392428-12392450 TGGCTGGAGCAGGGAAAGGGTGG - Intronic
1134334668 16:13287224-13287246 TTGATGGAGAAGAGTGTGGATGG + Intergenic
1134363820 16:13557831-13557853 TGGCTGGAGAGGAGTGAGCCAGG - Intergenic
1134447257 16:14340201-14340223 TGGCTGCAGCAGAGCGAGTCGGG + Intergenic
1134595365 16:15491617-15491639 TGGGTGGAGCAAAATGAGGAAGG - Intronic
1134638243 16:15809007-15809029 GGGCTGGAGCAGAGAGAAGGGGG - Intronic
1134692724 16:16201499-16201521 TGGCTGGAGGAGAGTGAGCATGG + Intronic
1134905362 16:17975312-17975334 TTGCTGGATAAGGGTGAGGAGGG - Intergenic
1134979121 16:18593182-18593204 TGGCTGGAGGAGAGTGAGCATGG - Intergenic
1135038464 16:19098200-19098222 TGGCTGGAGCTGAGTGATCTAGG - Intergenic
1135053125 16:19208452-19208474 TGGCAGCAGGAGAGTGAGGGGGG + Intronic
1135165956 16:20139352-20139374 TGGCTGGAGTGCAGTGAGCAAGG - Intergenic
1135195067 16:20387467-20387489 GGTCTGGAGCAGAGTGAGCTGGG + Intronic
1135197647 16:20407993-20408015 TGGCTGGAGCAGACTGAGACAGG + Intergenic
1135266065 16:21026755-21026777 AGGGTGGAGGAGGGTGAGGATGG + Intronic
1135363785 16:21835939-21835961 AGGGTGGAGCTGAGTGTGGAAGG + Intronic
1135425890 16:22335729-22335751 GGGCTGGACCAGGGTGGGGAGGG - Intergenic
1135651491 16:24210270-24210292 TGGCCAGAGCAGAGTGACCAAGG - Intronic
1135812234 16:25598754-25598776 TGGCCGAAGCAGAGTGAGTGAGG + Intergenic
1135883775 16:26285066-26285088 TGGCTGGAACAGAATGAGAGAGG - Intergenic
1135930338 16:26730974-26730996 TGGCTGGAACTTAGTGAGGGAGG - Intergenic
1136020394 16:27436412-27436434 TGGCTGGAGTGGAGTGAGGCAGG + Intronic
1136044188 16:27602397-27602419 TGGCTGGAACAGACTGAACAAGG - Intronic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1136368415 16:29820632-29820654 TGTCTGAATCAGAGTGGGGAAGG + Intronic
1136390016 16:29958089-29958111 TTGCTTGAGCATGGTGAGGAGGG + Intronic
1136532861 16:30881678-30881700 TGACTGGAGCGGAGGGAGGGAGG - Intronic
1136632845 16:31499143-31499165 TGGCTGGAGGAGGGTCAGAAAGG + Intronic
1136684933 16:31988542-31988564 TGGCTGCATGAGAGGGAGGAAGG + Intergenic
1136785548 16:32932077-32932099 TGGCTGCATGAGAGGGAGGAAGG + Intergenic
1137036503 16:35573986-35574008 TGGCTGGAGCTCCGTGAGGGAGG + Intergenic
1137757218 16:50912300-50912322 GGGCTGGAGCACAGTGGTGAGGG - Intergenic
1137816556 16:51403611-51403633 TGGCTGGAGCACAGAGAACAAGG - Intergenic
1137833872 16:51571890-51571912 TGGCTGGAGAAGAAAGATGAGGG - Intergenic
1137851596 16:51751353-51751375 TGCCTGGAACAGAGTGAGACTGG - Intergenic
1138197209 16:55060496-55060518 TGGCTGGAGCAGAGTGGGTGAGG - Intergenic
1138413813 16:56859774-56859796 TGGCTGGAGCAGAGGGACCAAGG - Intergenic
1138487804 16:57358000-57358022 TGGCTGCTGCAGGGTGGGGATGG + Intergenic
1138495109 16:57404100-57404122 TGGCTGGGGCAGAGTGAACCAGG + Intergenic
1138550271 16:57744001-57744023 TGCCTGGGGCAGAGTGAAGATGG + Intronic
1138653276 16:58473975-58473997 TGGCTGGAGCAGAGTGAGCCAGG - Intronic
1139466591 16:67157235-67157257 TGGATTGAGAAGAGGGAGGAGGG - Intronic
1139521924 16:67488033-67488055 ATGCTGCAGAAGAGTGAGGATGG + Intergenic
1139531554 16:67545079-67545101 TGGCTGGCGCAGGGAGAGGCGGG - Exonic
1139796133 16:69484502-69484524 TGGCCAGCGCAGAGTGAGGCCGG + Intergenic
1140130618 16:72157537-72157559 TGGCTGGAGCAGAGACAGTAAGG + Intronic
1140278698 16:73534163-73534185 TGGCTGGAGCTGAATGGGCAAGG - Intergenic
1141033742 16:80610997-80611019 TGGCTGGGGCCTGGTGAGGATGG - Intronic
1141313590 16:82939039-82939061 TGTCTGGAGCACAGTGAAGTGGG + Intronic
1141339270 16:83188028-83188050 TGGCTGAAGCAGAGGGAGCAAGG + Intronic
1141598890 16:85113580-85113602 TCACTGGAGAAGCGTGAGGAGGG - Intergenic
1141615667 16:85208077-85208099 TGGTTGGAGCAGCATTAGGAGGG + Intergenic
1141658612 16:85429641-85429663 GGGCTGGAGCAGAGCCAGCAAGG - Intergenic
1141676133 16:85518305-85518327 TGGATGGGGCAGATTGTGGAAGG + Intergenic
1141823338 16:86462754-86462776 TGGCTGGATCTCCGTGAGGAAGG + Intergenic
1141927193 16:87177603-87177625 TGGCGTGTGCAGAGTGAAGACGG + Intronic
1141976378 16:87518975-87518997 TGGCCGCAGCAAAGAGAGGAGGG - Intergenic
1141999025 16:87653403-87653425 TGCCTGGAGCTGAGGGTGGAGGG + Intronic
1142223460 16:88866247-88866269 TGGCTGCAGCTGACTTAGGAGGG - Intronic
1142249021 16:88982719-88982741 GGGTTGGGGCAGAGTGTGGAGGG - Intergenic
1142286121 16:89172204-89172226 TGAGTGGAGCAGAGAGAGGGGGG + Intronic
1142586203 17:975524-975546 TGGCTGGAGCAGGCTGACCAGGG + Intronic
1142644919 17:1305366-1305388 GGCCAGGAGCACAGTGAGGATGG - Intergenic
1142672281 17:1492711-1492733 TGGTTGGAGCAGGAAGAGGAGGG + Exonic
1142792857 17:2281827-2281849 TGGCTGGGGGAGAGAGAGCACGG - Intronic
1143096481 17:4481030-4481052 AGCTTGGAGCAGGGTGAGGAGGG + Intronic
1143195845 17:5075853-5075875 AGTTTTGAGCAGAGTGAGGAAGG + Intergenic
1143211583 17:5191912-5191934 TGGCTGGAGCCGACGGGGGACGG - Intergenic
1143363205 17:6388047-6388069 AGGGTGGAGCAGAGTGAGAAGGG + Intergenic
1143365049 17:6401964-6401986 TGGCTGGAGCAGGAGGAGGAGGG + Intronic
1143564778 17:7715015-7715037 TGGCTGGGGCTGATTGATGAGGG - Intergenic
1143621972 17:8085988-8086010 AGGATGGAGCAGGGTGATGAGGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1143934836 17:10472940-10472962 TGGCAGGAGATGAGTTAGGAAGG + Intergenic
1143948086 17:10611681-10611703 TGTCTGGAGGAAAGTGTGGAAGG + Intergenic
1144133305 17:12268438-12268460 TGCCAGAAGCAGAGTGAAGATGG - Intergenic
1144330839 17:14222797-14222819 TGGCTGGAGCAGTGTGGGGGCGG - Intergenic
1144346501 17:14354463-14354485 TGGCTGGAGCAGGGGGACCAAGG - Intergenic
1144426413 17:15146595-15146617 TGCCTGCAGCAGGGTGGGGAAGG - Intergenic
1144713791 17:17420587-17420609 TGACGGGAGCAGAGAGTGGAGGG + Intergenic
1144785164 17:17827402-17827424 TGGAGGCAGCAGGGTGAGGATGG + Intronic
1144826984 17:18110794-18110816 TGGCTGGAGCAGAGTGATTGAGG - Intronic
1144961136 17:19044809-19044831 TGTCTGGAGCTGAGGGAGGGAGG + Intronic
1144974025 17:19129715-19129737 TGTCTGGAGCTGAGGGAGGGAGG - Intronic
1145013933 17:19384901-19384923 TGCCTGGAGCAGGGCCAGGATGG + Intronic
1145240296 17:21237006-21237028 TGGCTGGGGTGGAGTGAGAAAGG + Intergenic
1145900002 17:28484455-28484477 TGGCCAGAGCAGAGAGAGTAAGG + Intronic
1145963220 17:28899634-28899656 TGGCTGGAACAGAGTGAGGGGGG - Intronic
1146434701 17:32833633-32833655 TGGGTGGATCAGGGTCAGGAAGG - Intronic
1146605095 17:34251166-34251188 TGGCCTGAGCAGTGTGATGAGGG - Intergenic
1146675383 17:34769771-34769793 TGGCTGGAGCACAGTGAACGTGG - Intergenic
1146693254 17:34891040-34891062 TGGCTGGAGCAAGGGGAGGGTGG - Intergenic
1147242108 17:39097200-39097222 TGCCTGGGGCAGTGTGAGGAGGG - Intronic
1147374349 17:40015190-40015212 TGGGTGGGGCAGCGGGAGGAAGG + Intergenic
1147584694 17:41647587-41647609 TGGATGAGGCAGGGTGAGGAAGG + Intergenic
1148108063 17:45129967-45129989 TGGCAGGGGCAGAGCGAGGCGGG + Intronic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1148717421 17:49725682-49725704 TGGCTGGAGCAGAGTGTGTCAGG + Intronic
1148770425 17:50063103-50063125 TGGCTGGAGCAGAAAGAGGCAGG - Intronic
1148785213 17:50142907-50142929 TGGCTGGGGCATAGAGAGCAGGG - Intronic
1149313555 17:55419439-55419461 TGGATGGAGGAGCATGAGGAGGG - Intronic
1149468491 17:56897889-56897911 TGCCTGGTGCAGATGGAGGAGGG - Intronic
1150293062 17:63992969-63992991 TGGCAGGGGCAGAGTCAGGAGGG + Intergenic
1150379066 17:64706488-64706510 TGGCTGGAATGGAGTGAGGACGG - Intergenic
1150486363 17:65546470-65546492 TGCTTGCAGCAGAGTGGGGAGGG + Intronic
1150578499 17:66451679-66451701 TGGGTGGAGCAGAGGGAGTGGGG + Intronic
1151174295 17:72274394-72274416 TGGTGGGGGCAGGGTGAGGAGGG + Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151291695 17:73155461-73155483 TGGCTGCTGGAGAGTGAGGTGGG + Intergenic
1151335582 17:73437857-73437879 TGGCTGGATCAAAGCGAGCATGG - Intronic
1151382401 17:73734902-73734924 TGGCTGGAGCAGCAGGTGGAAGG - Intergenic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1151889039 17:76941366-76941388 GGGCTGGGTGAGAGTGAGGAGGG + Intronic
1151893157 17:76963086-76963108 TGGGTGGAGCAGAGCAGGGAGGG + Intergenic
1152094215 17:78263707-78263729 TGGCTGCAGAAGTGGGAGGAGGG - Intergenic
1152268367 17:79309428-79309450 TGGGTGGGGCAGAGGGAGCAAGG - Intronic
1152303480 17:79508493-79508515 TGCGGGGAGCAGAGAGAGGAGGG - Intronic
1152549901 17:81024043-81024065 TGGCTGCAGCAGAGTGGTGGGGG + Intergenic
1152551211 17:81031249-81031271 TGTCTGGGGCAGAGCCAGGAGGG - Intergenic
1152971885 18:169943-169965 AGGCTCGAGAAGAGGGAGGAGGG - Intronic
1153192165 18:2553243-2553265 AGGTTGGAGGAGAGTTAGGAGGG - Intronic
1153478052 18:5518241-5518263 TGGTTGGAGCAGAGAGAGGGAGG - Intronic
1153827906 18:8893667-8893689 TGGCTGGAGGAGAGGAGGGAAGG + Intergenic
1154138626 18:11802920-11802942 TGTCTGGAGAAGAGTGAGCCAGG + Intronic
1154502893 18:15005352-15005374 TGGCTGGAGCAGATGAGGGAAGG - Intergenic
1155185797 18:23385615-23385637 TGGGTGGAACATAATGAGGAAGG + Intronic
1155718027 18:28970803-28970825 TGGGTGGAGAAGGGAGAGGATGG + Intergenic
1155825648 18:30439361-30439383 TGTCTAGAGCAGAGGGAGGCAGG - Intergenic
1155827673 18:30468547-30468569 TAGCTGGAGTGGAGTGAGGAAGG + Intergenic
1156189514 18:34702091-34702113 TGGCTGGAGCACTGTGCAGATGG - Intronic
1156774184 18:40767070-40767092 TGGTTTGTGCAGAGTGAGGAAGG + Intergenic
1157446950 18:47753304-47753326 TGGCTGGAACAAAATGAGCAGGG - Intergenic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157702247 18:49769187-49769209 CAGCTGGAGCAGAGTGAGTGGGG - Intergenic
1157714823 18:49876847-49876869 ATGCTGGAGCAGAGGGTGGAGGG - Intronic
1158038945 18:53069490-53069512 TGGATGGAGCTGAGCTAGGAGGG + Intronic
1158662454 18:59400922-59400944 TGGCTGGAGCAGAGCTGGGATGG + Intergenic
1158910979 18:62062180-62062202 TGGGGGGAGCAGGGTCAGGATGG - Intronic
1159133268 18:64306025-64306047 TAGCTGGAGCTGAGTGAGAGGGG + Intergenic
1159146813 18:64465199-64465221 AGGCTGGAGTGGAGTGAGGGAGG + Intergenic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1159677491 18:71303977-71303999 TGGCTGGAGCAGGAGGAAGAGGG - Intergenic
1159807543 18:72974352-72974374 TGGCTGGAACAGAATGAGCAGGG - Intergenic
1160106453 18:75982726-75982748 TGTCTGGTGCAGCGTGAGGCAGG + Intergenic
1160408960 18:78661689-78661711 TGGGTGGAGCAGGAAGAGGAGGG + Intergenic
1160676319 19:393277-393299 TGGCTGCAGCAGACTGAGTAAGG + Intergenic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1160695974 19:484728-484750 TGGCTGCCGCAGGGTGAGGAGGG + Intergenic
1160699545 19:499146-499168 TGGCTGCAGCAGAATGAGGAGGG - Intronic
1160751762 19:737766-737788 TGGCTGGAGCAGCGTGAGGAGGG + Intronic
1160758793 19:772136-772158 TGGCTGGAGCAGAGGAAGGGGGG - Intergenic
1160916839 19:1500804-1500826 TGGCTGGAGCAGAGAAGGGGAGG + Intergenic
1160988422 19:1850863-1850885 TGGCTGGACCAGGGTGAGGAGGG + Intergenic
1161208177 19:3053209-3053231 TGGGAGGAGCAGGGTGAGGGTGG - Exonic
1161222859 19:3126037-3126059 TGGTTGGAGCGGAGGGAGGGGGG + Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161238815 19:3210713-3210735 TGGCTCGAGCAGAGGGAGTGAGG + Intergenic
1161239336 19:3213344-3213366 TGGCTGGAGCAGAGTGAGCTGGG + Intergenic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161243336 19:3235072-3235094 TGGCTGGAACAGAGGGAGCGAGG - Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161267901 19:3373442-3373464 TGGCTGGAGCAGAATGAGCAAGG - Intronic
1161273395 19:3402857-3402879 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1161274291 19:3406976-3406998 TGGCTGGAGCAGAGTGAGCGAGG + Intronic
1161274904 19:3410509-3410531 TGGCTAGAGCAGAGTGAGGAAGG + Intronic
1161283376 19:3457268-3457290 CGGCTGCAGCTGAGTGAGCATGG + Intronic
1161289397 19:3484998-3485020 TGGCTGGAGCAGAGTGAGCCGGG + Intergenic
1161301605 19:3545398-3545420 TGGCTGGAGTAGAGGGAGGAGGG - Intronic
1161302981 19:3551839-3551861 TGGCTGGAGCAGAGAGAGAAGGG - Intronic
1161345446 19:3766859-3766881 TGGCTGGAGCACAGTGAGGAGGG + Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161414742 19:4139698-4139720 TAGCTATAGCAGAGTGAGCAAGG + Intergenic
1161422021 19:4181171-4181193 TGGCTGGAGCAGAGTGAGGCAGG - Intronic
1161427280 19:4210476-4210498 TGGCTGCAGCAGGGTGGGGAGGG - Intronic
1161431290 19:4233705-4233727 TGGCCACAGCAGAGTGAGCAAGG - Intronic
1161451750 19:4350237-4350259 TGGCTGGAGCCGAGTGAGTAAGG + Intronic
1161477677 19:4495542-4495564 GGGCTGGAGTGGAGGGAGGAGGG + Intronic
1161480139 19:4506234-4506256 AGGCTGGAGCCGAGTGAGGAGGG - Intronic
1161488310 19:4547815-4547837 TGGCTGGAGCACAGTGAGCAAGG - Intronic
1161493730 19:4576337-4576359 TGGCTGCAGCAGAGTGTGGAGGG - Intergenic
1161501039 19:4615833-4615855 TGGCTGGGGCAGAGTGAACGAGG - Intergenic
1161503813 19:4633203-4633225 TGGCTGGAATAGAGTGAGCTAGG + Intergenic
1161515469 19:4693836-4693858 TGGCTGGAGCACAGGGAGGAGGG - Intronic
1161533854 19:4806651-4806673 TGGCTGGAGCAGAGTGACAAAGG + Intergenic
1161596647 19:5154164-5154186 TGGCTGGAGCAGAGGGAGGCAGG + Intergenic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161629354 19:5344490-5344512 TGGCGGGAGCAGAGTGAGCGAGG - Intergenic
1161633273 19:5370219-5370241 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161636582 19:5393074-5393096 TGGCTGGAACAGAGTTAGTGAGG - Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161650361 19:5480546-5480568 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161760584 19:6168176-6168198 TGGCTAGAACAGAGTGAGCAAGG - Intronic
1161765033 19:6202799-6202821 TGGCTGGAGCAGAGTGAGGGAGG + Intergenic
1161815691 19:6498543-6498565 CGGCTGAAGCAGAGTGAGGGAGG - Intronic
1161857043 19:6772138-6772160 TGGCTGGAGCACAGTGAAGAGGG + Intergenic
1161857106 19:6772396-6772418 GGGCTGGACCAGACAGAGGAGGG + Intergenic
1161860753 19:6796446-6796468 TGCCTGGAGCAGAGTAAGCGAGG - Intronic
1161979658 19:7623957-7623979 GGGCTGGAGCGGAGTGAGGGTGG - Intronic
1162080392 19:8214512-8214534 TGGCTGGAGCAAACTAAGCAAGG + Intronic
1162087846 19:8259367-8259389 TGGCTGGAGCAGAGTGGGTGAGG + Intronic
1162110352 19:8396690-8396712 TGGCTGGAGCAGAGTGAGCCGGG + Intronic
1162156382 19:8680923-8680945 TGGCTGGAGTGGAGTGAGTAAGG + Intergenic
1162185148 19:8898877-8898899 TGGTCAGGGCAGAGTGAGGAGGG + Intronic
1162185574 19:8902063-8902085 GGGGTGGGGCGGAGTGAGGAGGG + Intronic
1162304437 19:9863223-9863245 TGGCTGGAGCAGATTGAGTAAGG + Intronic
1162370201 19:10274099-10274121 TGGCTGGAGCTGAGTGAGCAAGG - Intronic
1162400720 19:10445013-10445035 TGGCTGGAGCAGAATGAGTGAGG + Intronic
1162418142 19:10550587-10550609 TGGCTGCAGCAGAGTGTGGGAGG - Intronic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1162844455 19:13381678-13381700 TGGCTGGAACAGAGTGAGTGAGG - Intronic
1162844470 19:13381799-13381821 TGGCTGAAGCAGAGCGAGCAAGG + Intronic
1162875282 19:13616830-13616852 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1163017786 19:14467418-14467440 TGGCTGGAGGAGAGTGAGTGAGG + Intronic
1163032933 19:14556149-14556171 TGGCCTGAGCAGAGTGAGTCAGG - Intronic
1163113505 19:15175858-15175880 TGGCTGGAACAGAGTGAGTGAGG + Intronic
1163262876 19:16201819-16201841 AGGCTGGAGCAGAGTGAACCAGG + Intronic
1163377423 19:16942021-16942043 TGGCTGGAGCAGGAGGAGGAGGG - Intronic
1163445876 19:17346240-17346262 TGGCTGGAGCAGAGGAAAGGAGG + Intergenic
1163447173 19:17353505-17353527 TGGCTGGAGTGGAGTGATGGAGG - Intronic
1163462303 19:17446486-17446508 TGGTGGGAGCTGAGTGAGGATGG - Intronic
1163704353 19:18803711-18803733 TGACTGGAGCAGAGTGAGGGAGG + Intergenic
1163733255 19:18962351-18962373 TGGCTGGAGTACAGTGAATAAGG - Intergenic
1163779612 19:19239576-19239598 TGGGAGGAGGAGAGGGAGGAGGG - Intronic
1163798773 19:19352693-19352715 TGCCTGGAGCAGGGCAAGGAGGG + Intronic
1163810802 19:19430229-19430251 TGGCTGGAGAAGAATTAGCAGGG - Intronic
1164324129 19:24177873-24177895 TCCCTGGCCCAGAGTGAGGATGG - Intergenic
1164470149 19:28523230-28523252 TGCCTGGGGCAGGGTGGGGAAGG - Intergenic
1164561850 19:29297871-29297893 TGGCTGGAACACACTGTGGAGGG - Intergenic
1164636273 19:29793624-29793646 AGGCTGGAGCACAGTGACGGAGG - Intergenic
1164860668 19:31559859-31559881 TGGCTGAAACCGAGTGAGAAAGG - Intergenic
1165323875 19:35102806-35102828 CGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1165335762 19:35168624-35168646 TGGCTGCTCCAGAGTGAGGGAGG - Intronic
1165387222 19:35517635-35517657 TGGCTGGAGCAGTGTTGGGATGG + Intergenic
1165433119 19:35783602-35783624 TGGCTGGAGCTGAGTGAGTGAGG + Intronic
1165435081 19:35790946-35790968 AGGCTGGAGAACAGGGAGGAGGG + Intergenic
1165737321 19:38184964-38184986 TGGCTGGAACAGAGCAAGGAGGG - Intronic
1165746229 19:38231238-38231260 TGACTGGAGCAGAGTGAGCAGGG + Intergenic
1165791981 19:38498155-38498177 TGGCTGGAGCAGAGGTAGTGAGG + Intronic
1165814466 19:38633160-38633182 TGGCCAGAGCAGAGTAAGCATGG + Intronic
1165891234 19:39113497-39113519 TGGCTGCAGCAGAGTGGGCGAGG - Intergenic
1165899390 19:39161753-39161775 TGGCTGGAGCAGGGTGGGCGAGG - Intronic
1165940249 19:39411336-39411358 TGGCTGGAGCAGAGTGGCCAAGG - Intergenic
1165996449 19:39847151-39847173 TGGGTGGGGCAAAGTGAGCAAGG + Intergenic
1166051700 19:40264538-40264560 TGGCTGGAGCAGTGTGAGCTAGG - Intronic
1166099909 19:40565733-40565755 TGGCTGCAGCAGAGTGAGTGGGG + Exonic
1166171695 19:41032198-41032220 TGGCTGAAATAGAGTGAAGAAGG + Intergenic
1166219623 19:41356040-41356062 TGGCTAGAGCAGAATGAGGTGGG + Intronic
1166258848 19:41624309-41624331 TGGCTGGTGCAGGGTGTGAATGG + Intronic
1166654032 19:44596931-44596953 TGGCTGGAGGAAAGTGAGTGAGG + Intergenic
1166666971 19:44686154-44686176 TGTCTGGAGCGGTCTGAGGATGG - Intergenic
1166700958 19:44881344-44881366 TAGCTGGGGCAGAATGAGGCGGG - Intronic
1166729378 19:45050126-45050148 TGCCTGGAGCAGAGTAGGGGAGG + Intronic
1166730268 19:45055374-45055396 TGGCTGGAGCAGGGAGAGCGAGG + Intronic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1166921088 19:46229743-46229765 TGGTTGCAGTGGAGTGAGGAGGG - Exonic
1167427443 19:49436748-49436770 ACGCTGGAGCTGAGTGCGGATGG - Exonic
1167444749 19:49530974-49530996 TGGCTGGAACTCAGTGAGAAAGG + Intronic
1167556218 19:50197600-50197622 TGGCTGGAATGGAATGAGGAAGG + Intronic
1167604621 19:50475275-50475297 TGCCTGGAGCTGAGGGAGGAAGG + Intronic
1167670277 19:50848442-50848464 TGGCTGCAGCAGTGTGGGGCTGG + Intergenic
1167702061 19:51054648-51054670 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1167791709 19:51687646-51687668 TGGCTGGAGGATAGGGAGGGAGG + Intergenic
1167842308 19:52131958-52131980 TGGCTGGAGCAGAGGGAGTGAGG + Intronic
1167896668 19:52587345-52587367 TGGCTGGAGCAGAGGGAGTGAGG - Intergenic
1167906109 19:52661997-52662019 TGGCTGGAGCAGAGGGAGTGAGG + Intronic
1167932194 19:52874932-52874954 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167945109 19:52981839-52981861 TGGCTGGAGCAGAGGGAGTGAGG + Intergenic
1167963187 19:53123600-53123622 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1167988842 19:53340804-53340826 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1168114127 19:54211473-54211495 CGGGTGGAGCCGGGTGAGGAGGG + Intronic
1168140237 19:54381038-54381060 TGGCTGGATCAGGGTCACGAAGG - Intergenic
1168161525 19:54513313-54513335 TTGAGGGAGCAGAGAGAGGAAGG + Intergenic
1168281034 19:55305425-55305447 TGGTTGGAGGAGGGTTAGGAAGG - Intronic
1168311352 19:55462438-55462460 TGGCTGGAGCGGAGTGAGCAGGG - Intergenic
1168340908 19:55622438-55622460 TGGCTGGGGCCGAGGGAGGCGGG - Exonic
1168418216 19:56183001-56183023 AGGGTGGAGCAGGGGGAGGAGGG - Intronic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168472923 19:56654334-56654356 TGGCTGGAACAGAGTGAGAAAGG + Intronic
1168727174 19:58591603-58591625 TGGCTGGAGGCCATTGAGGAAGG + Intergenic
925001444 2:406050-406072 TGGCTGGAGCTGAGCATGGATGG - Intergenic
925001710 2:408045-408067 CGGCTGGAGCTGAGTGTGTATGG - Intergenic
925010836 2:484722-484744 TGGTTAGAGCAGTGTGAGAAAGG - Intergenic
925825827 2:7847558-7847580 TGGATGGAGCAGCGTGAGTGAGG - Intergenic
925842903 2:8009194-8009216 GGGCTGGAGCTGAGTCAGGCCGG + Intergenic
926099427 2:10104822-10104844 TGGCTGGAGCAGGCAGAAGAGGG + Intergenic
926335184 2:11857525-11857547 TGGCAGGAGCAGAGTTGGGCAGG + Intergenic
926605871 2:14897950-14897972 TGGCTGGGCCAGAGTGAGGTGGG + Intergenic
926862894 2:17327504-17327526 TGGCTGGAGCAGAGTGTGCATGG - Intergenic
926908286 2:17826232-17826254 TGGCTGGCACAGAGTGAGTTTGG + Intergenic
927144091 2:20149864-20149886 TGGCTGGAGCCCAGAGAGGAAGG - Intergenic
927224805 2:20753642-20753664 TGACTGGAGCAAAGTGACTAAGG - Intronic
927253384 2:21018440-21018462 TGGCTGGAGCAGAAAGACCAGGG - Intronic
927272100 2:21222726-21222748 TTCCTGGAGCAGAGTGAGTGAGG + Intergenic
927311547 2:21637423-21637445 TGGCTAGAGCATTGTGATGAAGG - Intergenic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
927631800 2:24780942-24780964 AGGCTGGAGCAGAGTGACCGAGG + Intergenic
928074454 2:28250277-28250299 TGGCTGGAGCACAGTGAGTAAGG + Intronic
928103244 2:28451848-28451870 TGGCTGGAGAGGAGTCAGCAGGG + Intergenic
928196515 2:29220277-29220299 TGGCAGGAGCAGAATGAAGGGGG - Intronic
928247837 2:29646594-29646616 TGGCTAGAGCAGAGTAAGGCAGG - Intronic
928407311 2:31024436-31024458 TGGCTGGAGTAGAGGGAGTGAGG - Intronic
928576056 2:32656495-32656517 TGCCTGGAGCAGAGTGTGAAGGG + Intronic
928771188 2:34703200-34703222 TGCAGGGGGCAGAGTGAGGAAGG + Intergenic
929073470 2:38057795-38057817 TGGCTGGATCAGAAGGAAGAGGG - Intronic
929372479 2:41242775-41242797 TGACTGGAGAAGTGTCAGGAAGG + Intergenic
929423200 2:41816185-41816207 TGGCCAGAGCAGAGGGAGTATGG + Intergenic
929457941 2:42079317-42079339 GGGCTGGAGGAGAGTGGTGAAGG - Intergenic
929836404 2:45404834-45404856 TGGCCAGAGCAGAGTGAGCAAGG - Intronic
929879986 2:45827121-45827143 TGACTGGAGCAGAGTGTGGAGGG - Intronic
929930662 2:46253259-46253281 TGCCTGGAGAAGAGAGAGGGAGG + Intergenic
930277965 2:49335777-49335799 TGGCTGGAGCAGACTGAACGAGG + Intergenic
930382198 2:50645152-50645174 TGGCTGGAACAGAGTGCGACTGG + Intronic
930511410 2:52349908-52349930 TGGCTGCAACAGAGTGGGCAAGG - Intergenic
930566582 2:53028324-53028346 TGGCTGGAAGAGAGGGAGAAAGG + Intergenic
930675040 2:54191313-54191335 TGGCTGGAGTACAGGGAGCAAGG - Intronic
930676742 2:54209752-54209774 TGGCAGGAATAGAGTGAAGATGG - Intronic
930886594 2:56333411-56333433 TGGCTGGTGCAGAGTGAATGAGG + Intronic
931146717 2:59527262-59527284 TGGCTTGAGCAGAGTGAGCAGGG - Intergenic
931380743 2:61750964-61750986 TGGCTGGAGCAAAGTGATCAAGG + Intergenic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
931825994 2:66001760-66001782 TGGGTGGGGCAATGTGAGGAGGG - Intergenic
931842411 2:66168330-66168352 TAGCTAGAGCAGAATGAGCAGGG + Intergenic
932173197 2:69576147-69576169 GGGCTAGTGGAGAGTGAGGAGGG - Intronic
932438489 2:71717096-71717118 CAGCTGGAGCAGGGTGAGCAAGG - Intergenic
932457019 2:71856389-71856411 TGAATGGAGCAGACTGAGAAGGG + Intergenic
932527683 2:72488969-72488991 TAGCTGGAGTGGAGTGAGCAAGG - Intronic
932674866 2:73770862-73770884 TGGCTGGAGTGGAGTGAGTGAGG - Intronic
932734089 2:74242188-74242210 TAACTGGGGCAAAGTGAGGAAGG - Intronic
933124432 2:78586544-78586566 TGGCTGGAGCAGAGGGAGTGAGG + Intergenic
933699455 2:85244153-85244175 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
933718076 2:85376656-85376678 TTTCTGGAGAAGAGTGGGGATGG + Intronic
934176525 2:89583395-89583417 TGTAGGGAGCAGAGTCAGGACGG - Intergenic
934286835 2:91657756-91657778 TGTAGGGAGCAGAGTCAGGACGG - Intergenic
934475228 2:94588933-94588955 TGGCTGGAGGAGGGAGAGCAGGG - Intronic
934545147 2:95207902-95207924 TGGCTGGCGCAGGCTCAGGAAGG + Intronic
934567895 2:95350671-95350693 TGGGTGGAGCCGAGTGAGTGAGG + Intronic
934752044 2:96799753-96799775 TGGCTGGGGCAGAGGGAGGCTGG + Intronic
934768894 2:96895595-96895617 TGGCTGGGGCAGAGGCAGGCAGG + Intronic
935363961 2:102270259-102270281 AGGCAGGAGCAGAGAGAGGGAGG - Intergenic
935608030 2:104990360-104990382 TGGCTGGAGCAGTGTGAGTAAGG + Intergenic
936030948 2:109070157-109070179 GGCCTGGAGCAGAGTGAGTGAGG + Intergenic
936563142 2:113559534-113559556 TGGCAGGAGCGGAAAGAGGAGGG - Intergenic
936563303 2:113560848-113560870 TGGCTGGAACAGAAGAAGGAGGG + Intergenic
936711351 2:115135046-115135068 TGGCTGGAGAACACTGAAGAAGG + Intronic
936917558 2:117655451-117655473 TGGCTGGAGCTGAGGGAAGAAGG + Intergenic
937085720 2:119170457-119170479 TCTCTGGTGCAGAGTGAGAAGGG - Intergenic
937593711 2:123647250-123647272 TGGCTCCAGGAGAGTGGGGAGGG - Intergenic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
937896547 2:126980518-126980540 TGGCTGGAGAACAATGAGTAAGG - Intergenic
937909606 2:127069029-127069051 TGACTGGGGCAGACAGAGGAGGG + Exonic
938502057 2:131835522-131835544 TGGCTGGAGCAGATGAGGGAAGG - Intergenic
938798844 2:134741301-134741323 TGGCTGGAGTATGGTGGGGAAGG + Intergenic
938910699 2:135883143-135883165 TGAATGGAGCAGTGTGGGGATGG - Intergenic
939010184 2:136837319-136837341 TGGCTAGAGCAGAGTGAATGAGG - Intronic
939279386 2:140042643-140042665 TGGCAGGAGCAGTGTGAGAGAGG - Intergenic
939432675 2:142130898-142130920 TGCCTGGAGCAGGATGTGGAAGG + Exonic
939475884 2:142686124-142686146 TGGCTGGAGCAGGCGGAAGAGGG - Intergenic
940012849 2:149073026-149073048 TGGCTGGAGAATAGTGAGCAGGG + Intronic
940233754 2:151486839-151486861 TGGATGGAGCAGAAAGGGGATGG + Intronic
940434732 2:153638144-153638166 TGGCTGGAATAGAGTGAGTTGGG + Intergenic
941196628 2:162460279-162460301 TGGCTGCAGCAGAGTGAGTTTGG - Intronic
941284869 2:163598231-163598253 TGGGGGAGGCAGAGTGAGGAAGG - Intronic
941422529 2:165300676-165300698 TGGCTGGAGCAGAGTGGGAAAGG + Intronic
941598580 2:167509708-167509730 TGGCTGGAGCAGTGTGAGTTAGG + Intergenic
941886200 2:170530341-170530363 GGTCTGGATCAGAGCGAGGAAGG - Intronic
941913745 2:170793616-170793638 TAACTGGAGCAGAATGAGCATGG + Intronic
942069901 2:172306813-172306835 TGGCTGGAGTGGAGTGAATAAGG - Intergenic
942110939 2:172682242-172682264 TGGCTGTAGTAGAGAGAGCAGGG + Intergenic
942193946 2:173498569-173498591 TGCCTGCAGCAGGGTGGGGAAGG - Intergenic
942345320 2:174996783-174996805 TGGCTGGAGTGGAGTCAGCAAGG - Intronic
942692726 2:178604061-178604083 TGGCTGGAGAAAAGAGAAGAGGG - Exonic
942852279 2:180502680-180502702 TGGCTGTAGCAGGGGGTGGAAGG + Intergenic
943529858 2:189065748-189065770 TGACTGGAGCACAGTGAGACAGG - Intronic
943772181 2:191730451-191730473 TGGCTGGAGTTGAGTGATTAAGG + Intergenic
944053309 2:195496011-195496033 TGGCTGGAGCAGAGTGAGTGGGG - Intergenic
944207176 2:197169098-197169120 TGGCTGAAGGAGAGTGAAGGAGG - Intronic
944494919 2:200297002-200297024 TGGCTATAGCTGAGTGTGGAAGG - Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945684183 2:212949315-212949337 TGGCTGAAGCAGAGTCAAGTTGG - Intergenic
945784708 2:214218501-214218523 TGGCAGGAGCAAAGTGGGAATGG - Intronic
946162303 2:217842781-217842803 TGGCTGGAGTAGAGTGATCAAGG - Intronic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
946440837 2:219693762-219693784 TGGCTGGAGCAGAGAGTGCAGGG + Intergenic
946523953 2:220497568-220497590 AGGCTGGGGTAGAGTGAGCAGGG + Intergenic
946855740 2:223948084-223948106 AGGCTGGAGCAGAGTGAGTGAGG + Intergenic
946883710 2:224201959-224201981 TGGCTGGAACAGAAGGAGGTGGG - Intergenic
946884361 2:224208339-224208361 CTGCTGGAGCAGTGTGAGCAAGG + Intergenic
947010534 2:225561380-225561402 TGGCTGGAACAGAGTGAACCTGG + Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947287003 2:228528191-228528213 TGGCTGGGGCAGGGACAGGAGGG - Intergenic
947406250 2:229780590-229780612 TGGCTCGAGCATAGAGAGCAAGG - Intronic
947428344 2:230004065-230004087 TGGCTGGGGCAGAGGGTGGCAGG - Intronic
947499937 2:230664510-230664532 TGGCTGGAGCACAGTGCAGAGGG + Intergenic
947739809 2:232479971-232479993 GGCCTGGAGCAGGGTGAGGCTGG - Exonic
947787212 2:232834016-232834038 TCTCTGGAGCTGAGGGAGGAAGG + Intronic
948124746 2:235556358-235556380 TGGCTACAGAAGAGAGAGGAGGG + Intronic
948131294 2:235602459-235602481 TGGCTGGAGCGGAGGGAGTGAGG - Intronic
948302679 2:236919815-236919837 TGGCTGGAGCAGTCAGAGAAGGG - Intergenic
948365037 2:237449246-237449268 TGGCTGGGTCTGAGGGAGGATGG - Intergenic
948443602 2:238014432-238014454 TGACTGGAGCAGAGGGAATAAGG + Intronic
948453544 2:238093378-238093400 TGGCGGGTGGAGAGTGTGGAGGG - Intronic
948768289 2:240234350-240234372 TGGTTGGGGCAGAGTGTGGCAGG + Intergenic
948787094 2:240358432-240358454 GGGCTGGAGCCTGGTGAGGAGGG - Intergenic
1168772065 20:421702-421724 TGGCTGGAGCAGAGGGATGAAGG + Intronic
1168797704 20:622535-622557 TGGCTGGAGAAGGGAGAGGGTGG - Intergenic
1168807121 20:678164-678186 TGGCTGGAGCAGAGAATGCATGG - Intergenic
1168809407 20:694445-694467 TGGCTGGAGCACAGTGAACAAGG + Intergenic
1168811267 20:706267-706289 TGGCTGGAGCAGGGCGAGAGGGG + Intergenic
1168845418 20:941218-941240 TGGCTGGAGTGGAGTGATGGGGG + Intergenic
1168857705 20:1020353-1020375 TGGATGAAGCAGAATGAGGGAGG + Intergenic
1168889414 20:1284735-1284757 TGGCTAGAGCAGAGTGAATGAGG + Intronic
1168957232 20:1842784-1842806 GGGCTGGAGCAAAGTGAGCGAGG - Intergenic
1169000330 20:2163622-2163644 TGGCTGCAGCAGAGGAAGCAAGG + Intronic
1169162815 20:3396717-3396739 TGGCTGGAGCAGAGTAGGTGAGG + Intronic
1170110325 20:12797939-12797961 TGGCTGGAGCAGCTTGAGGAAGG - Intergenic
1170175200 20:13461038-13461060 TGGCTGGAGCAGTGTGAGCAAGG - Intronic
1170220360 20:13935609-13935631 TAACTGGAGCAGAGTGAGTGGGG + Intronic
1170512833 20:17096669-17096691 TGGATGGGGCACAGTGAGAATGG - Intergenic
1170770464 20:19328201-19328223 TGGCTGGAGCAGAATGAGGGAGG + Intronic
1170852925 20:20020469-20020491 TGGCTGGTACAGAGTGAGCATGG + Intronic
1170912732 20:20590885-20590907 TGGCTGGAGTAGAAGGAAGACGG - Intronic
1170941980 20:20855650-20855672 TGGCTGGAGCAGGAGGAAGAAGG + Intergenic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1171406475 20:24915301-24915323 TGGCTGGAGCAGGGTCTGGGGGG - Intergenic
1172008540 20:31833358-31833380 TGGATGGAGTGGAGTGAGCAAGG + Intronic
1172027961 20:31962362-31962384 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1172115144 20:32569253-32569275 TGGCTGAAGGAAAGTGAGCAGGG + Intronic
1172291487 20:33780270-33780292 TGGCCAGAGCAGAGTGAGTGAGG + Intronic
1172293218 20:33790818-33790840 TGGCTGGCGCAGAGAGTGGCTGG + Intronic
1172359742 20:34303562-34303584 TGGCTGAACCAGCGAGAGGACGG - Intronic
1172460919 20:35118017-35118039 TGGCTGGAGCGGAGCAAGCAAGG - Intronic
1172577389 20:36019667-36019689 TGGCTGGAACAGACTAAGCAAGG + Intronic
1172639022 20:36429951-36429973 TGGCTGGAGCAGAGCAAGTGAGG - Intronic
1172674876 20:36661687-36661709 AGGCTGGAGCTGACTGTGGAAGG + Intronic
1172784071 20:37454458-37454480 TGGCTGGAGCAACATGAGCAAGG - Intergenic
1172872992 20:38147360-38147382 TGCCTGGAGTGGAGTGAGCAGGG - Intronic
1172898967 20:38320407-38320429 TGACTGGAGCAGGGAGAGGCGGG - Intronic
1172900635 20:38332090-38332112 TGTCTGGAGCAGAGCAAGTAGGG + Intronic
1173164606 20:40678169-40678191 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1173367131 20:42396494-42396516 TGGTTGGAATAGAGTGAGTAAGG - Intronic
1173539422 20:43840494-43840516 GGGCTGGAGCAGAGTGATCAAGG + Intergenic
1173548694 20:43917155-43917177 AGGCTAGAGCAGGGTGAGGCGGG + Intronic
1173659426 20:44723113-44723135 TGGCTGGAGCAGAGAGCAGGAGG - Intronic
1173669352 20:44787174-44787196 TGGCTGGAGCAGACAGAGCAAGG + Intronic
1173747952 20:45452477-45452499 TGGGTGGAGCAGAGGGAAGCAGG - Intergenic
1173834422 20:46115937-46115959 AGGTTGGGGCTGAGTGAGGAAGG + Intergenic
1173838740 20:46142462-46142484 TGACGAGAGCAGAGTGAGCAAGG - Intergenic
1173919095 20:46730625-46730647 TGCCTGGAACAGAGGGAGGAAGG + Intronic
1173929078 20:46803612-46803634 TGGCTGGAACACAGTCAGGGAGG - Intergenic
1173932241 20:46830443-46830465 TGGCAGGGGCAGAGGGAGTATGG - Intergenic
1173996974 20:47345984-47346006 TGGCTGCTGAAGGGTGAGGATGG + Intronic
1174118754 20:48246565-48246587 TGGCTGGAGCATAGTGACCCTGG - Intergenic
1174166001 20:48583986-48584008 TGGCCGGGGCAGAGTGAGTAGGG + Intergenic
1174181954 20:48680550-48680572 TGGCTGCCTCAGAGTGAGGAGGG - Intronic
1174266685 20:49337024-49337046 GGGCAGGAGCAGAGTGAGTGAGG + Intergenic
1174273631 20:49387392-49387414 TGGCTGGAGGGGACTGGGGAGGG + Intronic
1174278340 20:49419921-49419943 TGGCTGGAGGGGAGTGAGCAAGG - Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174299259 20:49569565-49569587 TGGCTGGAGCAGAGTGGGTGAGG - Intergenic
1174302106 20:49589872-49589894 TGGCTGGAGCTGAGTGAGTTGGG - Intergenic
1174308522 20:49632231-49632253 TGGCTGGAGTAGAGGGGGCAGGG - Intergenic
1174313949 20:49682433-49682455 TGGCTGGAACAGAGTGAGTGAGG - Intronic
1174387839 20:50197807-50197829 TGGCTGGAGCAGAGGCAGCAAGG + Intergenic
1174405108 20:50297709-50297731 TGGTTGCAGCAGAGAGAGGAAGG - Intergenic
1174410296 20:50330757-50330779 TGGCTGGAGCAGGGCCAGGCAGG - Intergenic
1174421246 20:50400444-50400466 TGGCTGCAGCAGAATGAGTGAGG + Intergenic
1174423976 20:50419085-50419107 TGACTGGAGCCAAGTGAGGCAGG + Intergenic
1174428278 20:50448804-50448826 TGGCTGGAGGAGAGTGAGTGAGG - Intergenic
1174531999 20:51221722-51221744 TGGCGGGAGCAGAGGGAGCAAGG + Intergenic
1174564443 20:51455254-51455276 TGGCTGGAACAGAGTGAATGAGG - Intronic
1174743626 20:53040331-53040353 TGGCTGGTGTGGAGGGAGGAGGG + Intronic
1174755879 20:53158193-53158215 TGTCTGGAGCCGAATGAGGAAGG + Intronic
1174943938 20:54964007-54964029 TGGCTGAAGTATAGTGAGGGAGG + Intergenic
1175050359 20:56150007-56150029 TGGATGGTGCAGAGTGATGGGGG - Intergenic
1175096654 20:56546563-56546585 AGGCTGGAGGAGACTAAGGAGGG - Intergenic
1175612797 20:60365391-60365413 TGGCTGGAGCCCAGGTAGGAGGG + Intergenic
1175810780 20:61856366-61856388 GGGCTGGAGAAGAGTGTGGGGGG - Intronic
1175918110 20:62436959-62436981 TGGCTGGAGCAGGGAGGAGAAGG - Intergenic
1175918790 20:62440285-62440307 TCGCTGGAGCAGACTGAGGCTGG + Intergenic
1176207390 20:63896534-63896556 TGGCAGGTGCAGAGTGAGTCAGG - Intronic
1176697034 21:9990484-9990506 TGACTGGAGATGAGTGAGGAAGG - Intergenic
1177019033 21:15829293-15829315 GGGTGGGAGCAGGGTGAGGATGG - Intronic
1177019512 21:15836754-15836776 TGTGTGGATCAGAGTGAGTAGGG + Intronic
1177019537 21:15837000-15837022 TGTGTGGATCAGAGTGAGTAGGG + Intronic
1177019545 21:15837082-15837104 TGTGTGGATCAGAGTGAGTAGGG + Intronic
1177019553 21:15837164-15837186 TGTGTGGATCAGAGTGAGTAGGG + Intronic
1177019561 21:15837246-15837268 TGTGTGGATCAGAGTGAGTAGGG + Intronic
1177019569 21:15837328-15837350 TGTGTGGATCAGAGTGAGTAGGG + Intronic
1177079390 21:16619824-16619846 TGGCTGAAGGAGAATGAGCAAGG + Intergenic
1177286314 21:19055916-19055938 TGACTGAAGCTTAGTGAGGAAGG + Intergenic
1177880016 21:26681876-26681898 TGGCTGCATTATAGTGAGGAAGG - Intergenic
1177927634 21:27238357-27238379 TGGCTGCAGCAGAGTAAGTGAGG - Intergenic
1178038912 21:28617283-28617305 GGGCTGGAGTAGAGGGAGGCAGG + Intergenic
1178407952 21:32339927-32339949 TGAGTAGAGGAGAGTGAGGAAGG - Intronic
1178431978 21:32525383-32525405 TGGCTGAAGCAGAGCCAGGAGGG + Intergenic
1178601567 21:33999203-33999225 TGGCTGGAGCAGGGTGACAAGGG - Intergenic
1178661380 21:34510402-34510424 TGGCTGGAGGGGAGGAAGGAGGG - Intergenic
1178906733 21:36642797-36642819 TTGCTGGAGAAGAGTGGGGAAGG - Intergenic
1179108015 21:38421027-38421049 TGCCTGGAGGAGAGGCAGGAGGG - Intronic
1179168810 21:38956959-38956981 TGGCTTGGGCTGAGGGAGGAAGG - Intergenic
1179224536 21:39442268-39442290 TGGCTGAAGCCCAGTGAGAAGGG + Intronic
1179231313 21:39506351-39506373 TGGCTGAAGTAGAGTGGTGAGGG + Intronic
1179358625 21:40684510-40684532 GGGCTGGAGCAGGTGGAGGAAGG - Intronic
1179639564 21:42738432-42738454 TTGCTGGAGCACAGTGAGGCTGG + Intronic
1179818871 21:43924982-43925004 TGGCTGAAGTGCAGTGAGGAAGG - Intronic
1179919140 21:44498004-44498026 TGGAGGGGGCAGAGGGAGGAGGG + Exonic
1179936425 21:44608038-44608060 TTCCTGGGGCAGAGTCAGGAGGG + Intronic
1180125807 21:45789621-45789643 TGGCCGGAGCAGAGCGAGCAAGG + Intronic
1180188733 21:46152867-46152889 AGACGGGAGCAGAGTGAGGGGGG + Intronic
1180571570 22:16727088-16727110 TGGCTGGAGCATAGTAAGTGAGG - Intergenic
1180754064 22:18148054-18148076 GGACTGGAGCAGGTTGAGGAGGG - Intergenic
1180933475 22:19608971-19608993 TGGCTGCAGCACAGTGAGAATGG - Intergenic
1181001925 22:19991839-19991861 TGCCCGGAGCACAGTGAGCATGG + Intronic
1181036366 22:20171637-20171659 GGGCTGGAGGGGAGTGGGGAGGG + Intergenic
1181041733 22:20195532-20195554 AGGCTGGGGCAGGGTGAGGACGG - Intergenic
1181114261 22:20621293-20621315 GGGCTGGAGGACAGTGAGGGTGG + Intergenic
1181175015 22:21030349-21030371 TGGCTGTAGCAGAGAGAGTGGGG + Exonic
1181396998 22:22629812-22629834 TGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1181499743 22:23309171-23309193 TGGGCGGGGCAGAGGGAGGAGGG + Intronic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1182754299 22:32666423-32666445 TGGCCAGAGCAGAGTGAGAGAGG - Intronic
1183099983 22:35578101-35578123 TGGCTGGATGAGTGAGAGGATGG + Intergenic
1183107467 22:35624944-35624966 TGTTAGGAGCAAAGTGAGGAAGG + Intronic
1183149258 22:36025186-36025208 TAGCTGGAGCAGAGAGAGCAAGG - Intronic
1183154397 22:36063908-36063930 TGACTGGAGGAGAGGGAGCAAGG - Intergenic
1183255965 22:36762403-36762425 GGGCTGCAGCAAGGTGAGGATGG + Intronic
1183320866 22:37164312-37164334 GGAGGGGAGCAGAGTGAGGAGGG + Intronic
1183465765 22:37979742-37979764 TGGCTGCCCCAGGGTGAGGAGGG + Intronic
1183669216 22:39262510-39262532 GGGCTGCAGCAGAGAGAGGTGGG - Intergenic
1183704967 22:39470576-39470598 TGGCTGCTGCAGAGGCAGGAGGG + Intronic
1184096735 22:42320145-42320167 TGACTGGAGCAGAGTGAGCAGGG - Intronic
1184156542 22:42671227-42671249 GGGTGGGAGCAGGGTGAGGATGG + Intergenic
1184189118 22:42883193-42883215 TGGCAGGAGCAGGGTGAGGCTGG - Intronic
1184240171 22:43207692-43207714 TGGCTGGAGCACAGGAGGGAGGG - Intronic
1184288749 22:43487004-43487026 AGGATGGTGCAGAGTGAAGAGGG + Intronic
1184653640 22:45930638-45930660 AGGCAGGAGCAGCCTGAGGAAGG - Intronic
1184714454 22:46273033-46273055 AGGCTGCAGCAGGGTGAGAAGGG - Intronic
1184773961 22:46613976-46613998 CGGCTGCAGCAGTGTGAGGAGGG + Intronic
1184798874 22:46748223-46748245 TGGCTGGAACAGAGCAAGGCAGG - Intergenic
1184825777 22:46949904-46949926 GGGCTGGAGCAGCCTGAGCAGGG + Intronic
1184852404 22:47128189-47128211 TGGGTGGGGCGGAGGGAGGATGG - Intronic
1184915128 22:47563841-47563863 TGGCTGGAGAGGGGTCAGGAGGG + Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185179824 22:49352885-49352907 TGGCTGGAGCCAAGTGACCAAGG + Intergenic
1185344430 22:50305170-50305192 TGGCTGGCACAGGGTGAGGCAGG + Intronic
949125259 3:439456-439478 TGGAGGGTGCAGAGGGAGGAGGG + Intergenic
949252600 3:2005281-2005303 TGGCTGAAGCAGAGAAAGTAAGG + Intergenic
949320156 3:2800763-2800785 TGGCTGGAACAGAATGAATAAGG - Intronic
949371893 3:3344179-3344201 TGGTTGGAGCAGGATGAGCAAGG - Intergenic
949629314 3:5905595-5905617 TAGATGGTGCAGACTGAGGATGG - Intergenic
949870335 3:8582730-8582752 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
950223272 3:11212865-11212887 TGGCTGGAGCTGAGTGAGTGAGG - Intronic
950399687 3:12760400-12760422 TTACTGGAGCAGAGTGAGGGAGG - Intronic
950455939 3:13092814-13092836 TGCCTGGAGCAGAGTGAGGAGGG - Intergenic
950484609 3:13265635-13265657 TGGCTGCACCAGAGGGATGAGGG - Intergenic
950494282 3:13324376-13324398 CGGCAGGAGCACTGTGAGGAAGG - Intronic
950582545 3:13871940-13871962 TGGCTGGAGTAGAGTGAGGAAGG - Intronic
950644334 3:14368169-14368191 AGGCCTCAGCAGAGTGAGGAGGG - Intergenic
950719149 3:14870264-14870286 TGGCTGGAGCAAGGTGAGGTTGG + Intronic
950748173 3:15107544-15107566 TGGCTGGAGCAGAGGAAGTGAGG + Intergenic
950863877 3:16173782-16173804 TGGCTGAAGCAAAGAGAGCAGGG - Intergenic
950908918 3:16567052-16567074 TGGTTGAAGTAGAGTGAGGGAGG - Intergenic
951271198 3:20626558-20626580 TGGCTGGAGCAGGAGGAAGAGGG + Intergenic
951583900 3:24195709-24195731 TGGCTGGAGGATAGAGAGAAGGG - Intronic
952113250 3:30148937-30148959 TAGCCTGAGCAGGGTGAGGAGGG + Intergenic
952121699 3:30252695-30252717 TGGCCAGAGCACAGTGAGCAAGG + Intergenic
952235230 3:31472499-31472521 TGGCTGAAGCTGAGTGAGCAAGG - Intergenic
952254328 3:31682407-31682429 TGGCTGGAGCAGGGTGAACAGGG - Intronic
952356021 3:32584836-32584858 CAGCTGGAGCAGTGAGAGGAGGG - Intergenic
952461925 3:33536527-33536549 TGGCAGGAGCAGAGTGAACAAGG + Intronic
952951917 3:38532562-38532584 GGGCTGGAGGAGGGAGAGGATGG - Intronic
953067650 3:39489054-39489076 TGGCTGAAGCACAGTGAGGGAGG - Intronic
953239355 3:41134868-41134890 TGGCTGGAGCAGAATGAGTGAGG + Intergenic
953416201 3:42719352-42719374 TGCCTGAGGCAGAGTGGGGAAGG - Intronic
953605628 3:44411441-44411463 TGGCTGGAGCAGAGGGAGAATGG - Intergenic
953831544 3:46301689-46301711 TGGCTGGAGCAGAGGAAGTGAGG - Intergenic
953955006 3:47225032-47225054 TGGCTGGAGTAGAGTGAGCAAGG + Intergenic
954652091 3:52171318-52171340 TGGTTGGAGCAGGGAGAGCAGGG - Intergenic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955088789 3:55729224-55729246 TGGCTGGCGTAGAGTGAGCAAGG - Intronic
955243876 3:57205530-57205552 TGGCTGGAACACAGTGAACATGG - Intronic
955457191 3:59136352-59136374 TGGCTTGGGAAGAGTGAGGAAGG + Intergenic
955665902 3:61348905-61348927 GGGAGGGAGGAGAGTGAGGATGG - Intergenic
955999886 3:64718003-64718025 TGGCTGGAGCACAGCGAGGCAGG - Intergenic
956171664 3:66438063-66438085 TGGCTGGTGTGGAGTGGGGAGGG + Intronic
956277558 3:67519285-67519307 TGGCTGGAGCACAGGGTGCAAGG - Intronic
956466045 3:69521662-69521684 TGGCTGGAACATATTGAGTAGGG - Intronic
956488108 3:69742515-69742537 TGGCTGTAGCAGAGGGAGGTAGG - Intronic
956570049 3:70684121-70684143 AGGCTGGAGCACAGAGAGGAAGG - Intergenic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
956707688 3:72013348-72013370 TGGCTGGAACATGGTGAGGGAGG + Intergenic
956894144 3:73642252-73642274 TGCATGGAGGAGAGTGAGGCTGG + Intergenic
956946797 3:74232493-74232515 TGGCTGGAACAGAGTGAGTAAGG + Intergenic
957054459 3:75433432-75433454 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
957199841 3:77119102-77119124 TGGCAGGAGAAGAGAGAGCAAGG - Intronic
957259701 3:77885032-77885054 TGGCTGGAGTACATTGAGCAAGG + Intergenic
957854827 3:85860953-85860975 TGTCTGAAGCAGAGTGAGCTAGG + Intronic
958271709 3:91508249-91508271 TGGCTGGTGCACGGTGAGCATGG + Intergenic
958438206 3:94123671-94123693 TGGCTGGAGCAAGGTGAGCCAGG - Intronic
958624562 3:96607320-96607342 TGGGTGCAGCACAGTGAGCATGG - Intergenic
958795310 3:98700842-98700864 AGTCTGAAGCAGACTGAGGAAGG + Intergenic
959520286 3:107317016-107317038 TGCCTGGTGAAGAGTGAGGGTGG + Intergenic
959664130 3:108902646-108902668 TGGCTGCTGCAGTGTGGGGAAGG + Intergenic
960143345 3:114172526-114172548 AGGCTGGAGCCAAGTGAGGCAGG + Intronic
960147330 3:114217288-114217310 TACCTGGTGCAGAGTGAGTATGG + Intergenic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
960312401 3:116132420-116132442 GGGGTGGAGCAGTGGGAGGAAGG - Intronic
960554806 3:119016134-119016156 TGGCTGGGCCAGAGCCAGGAAGG + Intronic
960571476 3:119189056-119189078 TGGCTGGCCCAAAGTGAGGCTGG - Intronic
961077503 3:123995599-123995621 TGGCTGGAGGGAAGTGATGAAGG - Intergenic
961159421 3:124710322-124710344 TGGCAGGGACAGAGGGAGGAAGG + Intronic
961307077 3:125965686-125965708 TGGCTGGAGGGAAGTGAGGAAGG + Intergenic
961478807 3:127166313-127166335 TGGATGGAGCCCAGGGAGGAAGG + Intergenic
961682718 3:128609555-128609577 TGGCTTGAGCAGAGTGGAGCTGG - Intergenic
961824776 3:129593259-129593281 CGGGTGGGGCAGAGGGAGGAGGG - Intronic
961829401 3:129615774-129615796 AGGATGCAGCAGAGTCAGGAGGG + Intergenic
961928887 3:130512504-130512526 GGCCTGGAGTTGAGTGAGGAAGG - Intergenic
961945397 3:130681932-130681954 TGGCAGGAACAGACTGAGAATGG + Intronic
961947130 3:130703235-130703257 TGGCTGGAGCAAAGTGAGCGAGG - Intronic
962501617 3:135999941-135999963 TGGGTGGAGCAGAGAAAGCAAGG - Intronic
962525186 3:136231892-136231914 TGGCTGGAGCAGAGAGACTGAGG + Intergenic
962649716 3:137476268-137476290 TGGCTGCAGCAGACTGAGTGAGG - Intergenic
962698686 3:137975824-137975846 TGGCTGCAGCAGAGTGAGGTGGG - Intergenic
962978602 3:140467766-140467788 TGGATGGAACAGAGAGAGGGTGG - Intronic
963120045 3:141768722-141768744 TGACTGGAGAGGATTGAGGAGGG - Intergenic
963247273 3:143074854-143074876 GGCTTGGAGCAGAGGGAGGATGG + Intergenic
963280289 3:143377874-143377896 TGGCTGGAGCTGAGTAAGCAAGG - Intronic
963476773 3:145815955-145815977 TGGCTGGAGCCGTGTGAGTGAGG + Intergenic
963492553 3:146019185-146019207 GGTGTGGAGCAGTGTGAGGAGGG - Intergenic
963730152 3:148963414-148963436 TGGCTGGAGAAAAGTGAGCAAGG + Intergenic
964081407 3:152763078-152763100 TGGCTGGAGCAGAGTGATTAAGG - Intergenic
964361954 3:155907913-155907935 TGGTTGGAGCAGAGTAAGCATGG + Intronic
964419696 3:156488516-156488538 TGGCTGCAGCAGAGTAAGGAAGG + Intronic
964626157 3:158762049-158762071 TGGCAGGAGCAGGATGGGGAAGG + Intronic
964682829 3:159361419-159361441 TGGCTGAAGCAGAGAGAGCAAGG + Intronic
964948605 3:162258858-162258880 TGTCTAGAGCAGAGTGAGAAAGG + Intergenic
965537320 3:169836836-169836858 TGGCTGGAGCAGAGTGAGCCAGG + Intronic
965894939 3:173564064-173564086 TGGCTAGAGCAGGGAAAGGAGGG - Intronic
966205842 3:177405531-177405553 GGGAGGGAGCAAAGTGAGGATGG + Intergenic
966261410 3:177983689-177983711 TGGCTGGAAGAGAGAGAGGGAGG + Intergenic
966311308 3:178596965-178596987 TGGCTGGAGAAGAGAGAACAGGG + Intronic
966323927 3:178733304-178733326 TGGCTGGAGTAGAGTGAGCTGGG + Intronic
966390409 3:179447257-179447279 AGGCTGGAAGAGAGTGAGCAGGG + Intronic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
966567199 3:181396576-181396598 TGGCTGCAGTAGAGTGAGGCTGG + Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
966663502 3:182444022-182444044 GGGCGGGAGGAGGGTGAGGATGG + Intergenic
966723528 3:183088040-183088062 TGGCTGGAACACAATGAGCAAGG + Intronic
967229462 3:187323882-187323904 TGGCTGGAGTGGAGGAAGGAGGG + Intergenic
967271861 3:187739108-187739130 TGGCTGGAGAGGAGGGGGGAAGG - Intronic
967397910 3:189027266-189027288 TGGCAGGGTCAGAGTGAGGCAGG - Intronic
967557862 3:190878987-190879009 AGGTTGGAGGAGAGAGAGGATGG - Intronic
967856292 3:194119972-194119994 TGACTGGGGCAAAGTGAGCAAGG - Intergenic
967886524 3:194337138-194337160 GCCCTGGGGCAGAGTGAGGAGGG + Intergenic
967889252 3:194353402-194353424 TTGCTGGAGGCGAGTGTGGATGG - Intergenic
967912315 3:194552511-194552533 TGGCCGCAGCAGAGTGGGCAAGG - Intergenic
968289498 3:197527632-197527654 TGGCTGAAGCAGAATGAGGGGGG - Intronic
968339986 3:197947464-197947486 TGGCTGGAGCCCAGAGAGCAAGG - Intronic
968471548 4:784835-784857 TGGATGGAGCTGAGTGAGAATGG + Intergenic
968479961 4:828904-828926 GGGCAGGAGCTGAGTGAGAAAGG + Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968675675 4:1877672-1877694 TGGCTGGAACAGAATGAGAATGG - Intronic
968676233 4:1881965-1881987 TGGCTGGAGCAGAGGGTGTCAGG + Intronic
968762234 4:2448720-2448742 GGGCTGGAGTGGAGTGAGGCAGG + Intronic
968975767 4:3821391-3821413 TGGCTTGAACAGTGTGAGGATGG + Intergenic
968997272 4:3953742-3953764 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
969192471 4:5533389-5533411 TGGCTGGAGCAGAGCCAGTGGGG + Intergenic
969256809 4:6007936-6007958 TGGCTGGAGGAGAAGGAGAAAGG + Intergenic
969435747 4:7188418-7188440 TGTCTGGGGCTGAGGGAGGAAGG - Intergenic
969587372 4:8102163-8102185 TGGCTGAAGCAGAATGACCAAGG - Intronic
969657818 4:8508277-8508299 TGGCTGTGGGAGGGTGAGGAGGG + Intergenic
969756742 4:9154940-9154962 TGGCTGGAGTGGAGTGAGCAGGG + Intergenic
969816712 4:9692509-9692531 TGGCTGGAGTGGAGTGAGCAGGG + Intergenic
970213769 4:13737637-13737659 TGGCAGGAGCAAAGTGAGAGAGG + Intergenic
970457347 4:16238285-16238307 TGGATGGGCCAGATTGAGGATGG - Intergenic
970689655 4:18607883-18607905 AGGCTGGAGAAGAGGGAGGACGG - Intergenic
970873397 4:20842377-20842399 TGGCTGGAGCAGAGTAAATAGGG + Intronic
970965665 4:21925009-21925031 TGACTGGAGTAGAGTGAGTAAGG - Intronic
971091951 4:23355958-23355980 TGGCTGGAGTAGAGTGAGAAAGG + Intergenic
971165935 4:24183680-24183702 AGGAAAGAGCAGAGTGAGGAAGG - Intergenic
971232896 4:24814821-24814843 TGGCTGGAGTAGAGGGAATAAGG - Intronic
971270676 4:25141828-25141850 TGGCTGGAGCAAAAAGAGCAAGG - Intronic
971470594 4:27021750-27021772 TGGCTGTTGCAGAGGAAGGATGG + Intronic
971482303 4:27125578-27125600 TGGCTGGAGCAGAGGGAAAGGGG - Intergenic
971507879 4:27386257-27386279 TAGCTGAAGCAGAGTGAATAGGG - Intergenic
972067158 4:34962489-34962511 TGGCTGGAACGAAGTGAGGGAGG - Intergenic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972425269 4:38927023-38927045 TGGCTGCAGCAGAGTGAGGCAGG - Intronic
972462350 4:39316328-39316350 TGGTTGGAGCATAGTGACCAAGG - Intronic
972514891 4:39802300-39802322 TGTCTAGTGCAGAGTGAGCAAGG - Intergenic
972730733 4:41792230-41792252 TGGCTGGAGCAGAATGAATGAGG - Intergenic
972753284 4:42014915-42014937 TGGGAGGTGGAGAGTGAGGATGG + Intronic
972766826 4:42158974-42158996 GGGCTGGAGAGGAGTGAGGGAGG - Intergenic
973167658 4:47097243-47097265 TGGCTGGAGCAGAGTGAGAAAGG - Intronic
973339911 4:48993416-48993438 TAACAGGATCAGAGTGAGGAGGG - Intronic
973607868 4:52605800-52605822 TGGCTGGAGCAGAGAGAAGGAGG - Intronic
973755574 4:54070222-54070244 TGGGTGGATCATAGTGAGGAAGG + Intronic
973786514 4:54337493-54337515 TGACTGGAGCACAATGAGCAAGG - Intergenic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
975101647 4:70520974-70520996 TGGCCAGAGCAGAGTGAGGGAGG + Intronic
975270090 4:72421191-72421213 TGGCTAGAGCAGAAAGAGCAAGG - Intronic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975475781 4:74821751-74821773 TGGCAGGAGCACAGTGAGTAAGG + Intergenic
975510841 4:75192761-75192783 TGGAGGGAGCAGAAGGAGGAAGG - Intergenic
975578870 4:75889321-75889343 TGGCTGGAGAAGAGGGAGCCAGG - Intronic
975650943 4:76592229-76592251 TGGGTGGAGCAGAATGTGGCGGG + Intronic
975654627 4:76629315-76629337 TGGCTGGGGCAGAGTGAGTGAGG + Intronic
975881169 4:78909536-78909558 TGGCTGGAATATAGTGAGCAAGG - Intronic
976074719 4:81284741-81284763 CGGCTGGAGCAGAGGGAGCTGGG - Intergenic
976229401 4:82825596-82825618 TAGCTGGAGCAGAGAGAACAAGG + Intronic
976369202 4:84267523-84267545 TGGCTGAAGGACAGGGAGGAGGG - Intergenic
976397559 4:84572500-84572522 TGGGTGGAGCAGAGAGGGTAGGG + Intergenic
976553343 4:86421935-86421957 AGGCTGGAGTACAGTGAGCATGG - Intronic
976674124 4:87685627-87685649 AGGCTGGAGGAGGGTGAGCAAGG - Intergenic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
976911454 4:90312234-90312256 TGGCATGAGCAGAGTGATGGAGG + Intronic
976951945 4:90844429-90844451 TGGCTGGAGTGGAATGAGGGAGG - Intronic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
977370708 4:96131292-96131314 TGGCTGAAACAAAGTGAGTAAGG - Intergenic
977593083 4:98848615-98848637 TGCCTGCAGCAGAGTGGGGAAGG + Intergenic
977641635 4:99364048-99364070 GGGATGGAGGAAAGTGAGGATGG - Intergenic
978174461 4:105712405-105712427 TGGCTGGAAGGGAGTGAAGAAGG + Intronic
978787531 4:112626458-112626480 TGGTTGGAACAGAGTGAGCAAGG - Intronic
978838440 4:113181796-113181818 TGCCTGGAGTAGAATGAGGGAGG + Intronic
979399531 4:120231715-120231737 TGGTTGGAGAGGAGAGAGGAAGG + Intergenic
979840615 4:125435676-125435698 TGTCTGGACCAGAGTGAGAAAGG + Intronic
979878567 4:125925867-125925889 AGACGGGGGCAGAGTGAGGAGGG - Intergenic
980091431 4:128447242-128447264 TGGCTGAAGCAGAGTGAATGAGG + Intergenic
980369640 4:131850676-131850698 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
980610282 4:135151534-135151556 CATCTGGAGCAGAGTGAGCAAGG - Intergenic
981069790 4:140523184-140523206 TGGCTGGAGGAGAAAGAGCAAGG - Intergenic
981078701 4:140617028-140617050 TGGATGGAGCAGAATGAGTGAGG - Intergenic
981422799 4:144570726-144570748 TGCTTGGAGCTGAGTGAGGGAGG + Intergenic
981567122 4:146113488-146113510 GGGGTGGAGCAGTGTGAGGTGGG + Intergenic
981837440 4:149071331-149071353 GGGGTAGAGGAGAGTGAGGATGG + Intergenic
982048593 4:151475622-151475644 TGGCTGAAGTAGAGTGAGGGAGG + Intronic
982090354 4:151875160-151875182 TGGCTGGAGTAGAGAGAGCAAGG + Intergenic
982134394 4:152259450-152259472 TGGCTAGAGTAGACAGAGGAAGG - Intergenic
982195388 4:152906789-152906811 TGACTGCAGCAGAGTGAATAAGG - Intronic
982413496 4:155105837-155105859 TGGATGAAGCAGAGTGAAGCGGG + Intergenic
982812544 4:159844226-159844248 TACCTGGAGCAGAGTGAGCAGGG - Intergenic
982864105 4:160488815-160488837 TGTATGCAGCAGGGTGAGGAAGG - Intergenic
983008096 4:162510261-162510283 GGCCTGGAGCAAAGTCAGGAAGG - Intergenic
983107612 4:163708762-163708784 TGGGTAGAGCAGTGGGAGGAAGG + Intronic
983671313 4:170241043-170241065 TGGCTGAAGTAGAGTGAGCAGGG - Intergenic
983803651 4:171966576-171966598 TGGCTGGTGCTTAGGGAGGAAGG + Intronic
984010530 4:174366229-174366251 TGGCTGCAGGACAGTGAGGATGG + Intergenic
984409678 4:179380485-179380507 TGCCTGGAGCATAGAGAGAAAGG - Intergenic
984441370 4:179774582-179774604 TGCCTGAGGCAGAGTGGGGAAGG - Intergenic
984802774 4:183729953-183729975 TGTGGGGAGCAGAGTGAGCAAGG + Intergenic
985044039 4:185922273-185922295 GGGCTGGGACAGAGAGAGGAAGG - Intronic
985487117 5:158158-158180 AGGATAGAGCAGAGGGAGGAGGG - Intronic
985487337 5:158801-158823 AGGATGGGGCAGAGTGGGGAGGG - Intronic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
985973410 5:3394789-3394811 AGGCTGGAGAAGAGGGAGGGAGG - Intergenic
986089889 5:4493604-4493626 AGGCAGGAGGAGAGAGAGGAAGG - Intergenic
986228801 5:5842673-5842695 TGGCTGGAGCCGATGGAGGAAGG + Intergenic
986253658 5:6083617-6083639 TGGCAGGAGCTGAGTGAGCCAGG - Intergenic
986323395 5:6652276-6652298 GGGCTGTAGCAGAATGAGCAGGG + Intronic
986361345 5:6981171-6981193 TGGATGGACTAGAGTGGGGATGG - Intergenic
986594102 5:9402788-9402810 TGGCTGGGGCAAGGTGAGAAGGG - Intronic
986637612 5:9838279-9838301 TGCCTGGAGAAGGGTGAGGATGG - Intergenic
986805527 5:11305281-11305303 TGTCAGGAGCAGAGTCAGAATGG + Intronic
987008983 5:13740477-13740499 TGGCTAGAGCAAAGTGAAAAAGG - Intronic
987302208 5:16606912-16606934 TGGCTGGGGCTGGGTGAGCAAGG - Intronic
987650534 5:20734404-20734426 TGGCTGGAGAGGACTCAGGAAGG + Intergenic
987862258 5:23503959-23503981 TGGCTGGAGCAGGAGGAAGAGGG - Intergenic
988403432 5:30793115-30793137 TGCCTGGGGCAGATGGAGGAAGG + Intergenic
988496588 5:31750812-31750834 TGGCTGGAGTGGAGTGAGTAGGG + Intronic
988627099 5:32889004-32889026 AGGCTGGAGCAGAGTGGGCAAGG - Intergenic
988660934 5:33267890-33267912 TGGCTGGAACAAAGCAAGGATGG + Intergenic
988663826 5:33302978-33303000 TGACAGGAGGAGAGTGAGCATGG + Intergenic
988884238 5:35537940-35537962 TGGCTGGAGAAGAGTATGTATGG + Intergenic
988901854 5:35741451-35741473 TGTCTGGAGCAGAGTGAGCTAGG + Intronic
988960546 5:36366802-36366824 TGGTTGAAGCTGGGTGAGGAAGG - Intergenic
988967504 5:36434001-36434023 TAGCTTGAGCAGAGTAAGCATGG - Intergenic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
989789002 5:45369494-45369516 AGGCTGGGGCTGAGTGAGCAAGG - Intronic
990168836 5:53024770-53024792 TGGCTGGAACACAGGGAGGGAGG + Intronic
990169897 5:53036448-53036470 TGGCTGGAACAGAATGAGTGAGG - Intronic
990282341 5:54264609-54264631 TGGCTGAAGCAGAAAGAGTAGGG - Intronic
990343506 5:54848830-54848852 TGACTGGAGCAGATGGAGGGAGG - Intergenic
990727169 5:58768746-58768768 TGGCTGGAACACAGTAAGTAAGG + Intronic
990974679 5:61548920-61548942 TGGCTGGGGCAGAATGGGGTGGG + Intergenic
991489104 5:67165878-67165900 TGGCTCTAGCAGAGAGGGGAAGG + Exonic
991979013 5:72212345-72212367 TGGCTGGAGCAGAATGTGTAAGG - Intergenic
992146811 5:73858901-73858923 TGACTGGAGCAGAGGGAGTAAGG - Intronic
992388656 5:76310462-76310484 TGGCTGGAGCAGAATGACCAAGG + Intronic
992406437 5:76461886-76461908 GGAGTGGAGCAGAGTGTGGAGGG - Intronic
992715761 5:79510128-79510150 TGACTTGAGTAGAGAGAGGAAGG - Intronic
992763159 5:79969712-79969734 GGTCAGGAGCAGAGTGAGCAGGG - Intergenic
992845787 5:80745601-80745623 TGGCTAGACCAGAGTGAATATGG + Intronic
993139127 5:84008146-84008168 TTGCAGGAGTAAAGTGAGGATGG + Intronic
993180784 5:84549243-84549265 GGGCTGGCACAGAGTGAGTAAGG - Intergenic
993249472 5:85499825-85499847 GGCCTAGAGCAAAGTGAGGATGG + Intergenic
993973290 5:94445841-94445863 TGGCTGTTCCAGAGTGTGGATGG - Intronic
994052688 5:95380610-95380632 TGGCTGGAGGAGAGTAAGCAAGG + Intergenic
994070680 5:95598762-95598784 TGGCTGGAGTAGAGTAAGTGAGG - Intronic
994114416 5:96046122-96046144 TGGCTGGAGTAGAATGAGATAGG + Intergenic
994804363 5:104424703-104424725 TGCCTTGAGCTGAGTGAGCAGGG + Intergenic
994820474 5:104644388-104644410 TGGTTGGAGCCTGGTGAGGAAGG + Intergenic
995059283 5:107796146-107796168 GGGCATGAGCAGAGTGAGCAGGG + Intergenic
995110252 5:108420989-108421011 TGGCTAGAGCAGAGTGACTAAGG + Intergenic
995821771 5:116242675-116242697 TGGCTGAAGCAGAAGTAGGAGGG - Intronic
995848493 5:116520085-116520107 GGGCTGGAACAGAGTGGGAATGG - Intronic
996132785 5:119802239-119802261 TGGATGGGGGAAAGTGAGGATGG - Intergenic
996139418 5:119887747-119887769 AGGCTGGAGCAGAGTAAGCAAGG - Intergenic
996190408 5:120533673-120533695 TGGCTGGAACAGAGGGAGCAAGG + Intronic
996421851 5:123271090-123271112 TGGATGGAGAAAAGTGAGGTGGG - Intergenic
996485323 5:124026884-124026906 TGATTGAAGCAGAGTGAGCAAGG + Intergenic
996839393 5:127829892-127829914 TGGCTTGAGTAGAGTCATGAAGG + Intergenic
997286185 5:132680390-132680412 TGGCTGGATCAGAGTGAGTGAGG + Intronic
997415669 5:133726479-133726501 CTTCTGGAGGAGAGTGAGGATGG - Intergenic
997424056 5:133791049-133791071 TGGCTACAGCAGAGTGAGTGAGG - Intergenic
997459636 5:134043120-134043142 TGGCAGGAGAAGAGTGATCAAGG + Intergenic
997592920 5:135086629-135086651 TGGCTGGAGAAGAGAGTGAAAGG + Intronic
997619138 5:135273343-135273365 GGGCTGGAGCTGAGTCTGGAAGG + Intronic
997859501 5:137403751-137403773 TGGCTGGAACAGAGCGAGTGAGG + Intronic
998002100 5:138633508-138633530 AGGCTGGAGTGGAGTGAGTAAGG - Intronic
998086177 5:139325688-139325710 TGTTTTGAGGAGAGTGAGGAAGG - Intronic
998141531 5:139702277-139702299 TGGCTGGAGCAGAAGGAGCAGGG - Intergenic
998167829 5:139854587-139854609 AGTCTGGAGGAGAGTCAGGAGGG - Intronic
998368833 5:141648377-141648399 TGGCTGGAGTACTGTGAGCAAGG - Intronic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
998882373 5:146656711-146656733 TGGCTGGAGAGGAGTGAGTAAGG + Intronic
998907033 5:146916644-146916666 TGTTTGGAGCTGAGTGAGTATGG - Intronic
999632037 5:153581411-153581433 TGGCTCAAGCACAGTGAGCAAGG - Intronic
999721519 5:154402241-154402263 GGGCAGGAGCAGAGGGAGAAAGG - Intronic
999857721 5:155613445-155613467 TGGATGGAGCAGAGTGAGCCAGG + Intergenic
1000158376 5:158574631-158574653 AGGCTGGAACAGAGTGAGCAAGG + Intergenic
1000166151 5:158650624-158650646 TGGCTGGAGAAGAATGAGCAGGG - Intergenic
1000186617 5:158864821-158864843 TGGCTGCAGCACAGTGAGCGAGG + Intronic
1000304759 5:159985049-159985071 TGGCTGAAGTGGAGTGAGGGAGG - Intergenic
1000448680 5:161357375-161357397 TGGCTGGAACAGAATGTGCAAGG + Intronic
1000763227 5:165252491-165252513 TGGCTAGAGTGGAGTGAGGAGGG + Intergenic
1000816328 5:165927134-165927156 GAGCTGGAGCAGGGTGAGGGGGG - Intergenic
1000963829 5:167631464-167631486 TGGCTGAAGCATAGGGAGTAAGG + Intronic
1001016869 5:168149806-168149828 TGGCTGTAGCAGAGTGAGTGAGG - Intronic
1001164242 5:169349114-169349136 TGGCTGGAGCAAAGTGAGAGAGG - Intergenic
1001209503 5:169796841-169796863 TGGTTGGAACAGAGAGAGGGAGG + Intronic
1001324150 5:170708157-170708179 TGCATGGAGCAGAGAGGGGATGG - Intronic
1001483076 5:172101908-172101930 AGGCTGGAGAAGAGTGAGGCTGG + Intronic
1001584466 5:172824017-172824039 CAGCTGGAGCCGAGTGAGCAAGG + Intergenic
1001751795 5:174137062-174137084 TGGCTGGAACTGAGTGAGCAAGG + Intronic
1001763965 5:174230387-174230409 TAGCTGCAGCAGAGTGAGTTTGG - Intronic
1001946923 5:175786884-175786906 TGGCTGGAGTAGAGTGAATGAGG - Intergenic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1001956206 5:175849796-175849818 TGGCTGGAGCAAGGCAAGGAAGG - Intronic
1002113326 5:176936643-176936665 TGGCTGGATTAGAGTAAGTAAGG - Intronic
1002122986 5:177020158-177020180 TGGCTGGAGCCCAGTGAACAAGG - Intronic
1002434368 5:179221861-179221883 GGGCTGGAGCAGAGGGAAGGAGG - Intronic
1003207541 6:4027005-4027027 TGGCTGGAGCAGGGTGACCGTGG + Intronic
1003257254 6:4485303-4485325 TGGCTGGGGCAGAGTGGGGCAGG - Intergenic
1003396066 6:5752938-5752960 TGGGTGGGGCAGAGTCAGCACGG - Intronic
1004019178 6:11761019-11761041 TGGCTGGTTCAGATTGAGGAGGG - Intronic
1004114888 6:12757308-12757330 TGGCTGGGGAGGAGTAAGGAAGG + Intronic
1004627448 6:17390203-17390225 TGGCAGGAGCAAGGGGAGGAGGG - Intergenic
1004903923 6:20218935-20218957 AGGCTGGAGCAGAGTGACTGAGG + Intergenic
1005091506 6:22061692-22061714 GGGCAGGAGCAGATGGAGGAAGG - Intergenic
1005423037 6:25672597-25672619 TGGCTGGAGCAGAGCAAGAAAGG + Intronic
1005543141 6:26834800-26834822 TGGCTGGAGAGGACTCAGGAAGG - Intergenic
1005556874 6:26994953-26994975 TGGCCGGAGCAGGGGGAAGAGGG + Intergenic
1005648072 6:27861031-27861053 TGGCTGGAACAGAGGGAACAAGG - Intronic
1005713795 6:28527652-28527674 TGGCTGGAGAAAAGAGAGAAGGG - Intronic
1005902080 6:30225486-30225508 TGTCTGGACCAGAGTGAAGGAGG + Intergenic
1006029872 6:31170744-31170766 TGGGTGGAGGAGAGGGAGGTGGG + Intronic
1006127096 6:31846035-31846057 TGGCTGAAGCAGAGTGGAAATGG - Intergenic
1006178350 6:32137713-32137735 TGAGTGGAGCAGAGTGAGCAAGG + Intergenic
1006191132 6:32210267-32210289 TTGCTGGAGCAGAGAGTAGAAGG + Intronic
1006291189 6:33138107-33138129 TGTCTGCAGCAGGGTGGGGAAGG + Intergenic
1006369617 6:33635820-33635842 GGGCTGGAGCAGAGGGGTGAGGG + Intronic
1006390672 6:33756418-33756440 TGGCTGGAGCAGAGGAAGCCAGG + Intergenic
1006466820 6:34200536-34200558 TGGCTAGAGCAGAGTAAGCAAGG + Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1006515525 6:34543708-34543730 TGGCGGGAGCAGAGTGAATGAGG + Intronic
1006803221 6:36772347-36772369 TGGTTGGAGCAGTGAGAGGACGG - Intronic
1006811120 6:36821242-36821264 TGACTGGAGTGGAGTGGGGAGGG + Intronic
1006864994 6:37202167-37202189 TGACTGGAGCATGGTGAGGAGGG - Intergenic
1006931273 6:37690083-37690105 TGGCTGGAGCAGAATGAGCCAGG - Intronic
1007029514 6:38615467-38615489 TGGCTGGAGCAGAATGTGCCAGG - Intronic
1007091199 6:39185898-39185920 TGGCTGGAGCCCAGAGAGGTGGG + Intergenic
1007221932 6:40285630-40285652 TGGCAGGATCAGATTGAGGTTGG + Intergenic
1007235659 6:40389999-40390021 GGGAGGGAGGAGAGTGAGGAAGG + Intergenic
1007357526 6:41332415-41332437 AGGCTGGAGCAGGGGGAGTATGG - Intergenic
1007365534 6:41389303-41389325 TGTCTGGGGCTGAGTGGGGAAGG - Intergenic
1007509450 6:42364150-42364172 TGGCTGGAGGAAATGGAGGAAGG - Intronic
1007547942 6:42708453-42708475 AAGCTGGAGCAGTGTGAGGGGGG + Intronic
1007657987 6:43464154-43464176 TGGATGGGACAGAGTGAGGTAGG - Intergenic
1007692431 6:43711401-43711423 TGGCTGGAGCAGAGGGACCGAGG + Intergenic
1007728415 6:43930982-43931004 TGGCTGGAGCACAGTGAGGAAGG + Intergenic
1007736336 6:43984622-43984644 AGGCTGGAGCAGAGTGAGCGAGG + Intergenic
1008095578 6:47336300-47336322 TAGCTGGAGCAGAGGGAGCATGG - Intergenic
1008291935 6:49726109-49726131 TAGCTGGAGTAGAGGGAGCATGG - Intergenic
1008392777 6:50972214-50972236 TGCCTGGAGCAGACTGAGTGAGG - Intergenic
1008486370 6:52040590-52040612 TGGCTGGAGTAGATTGAGTGAGG - Intronic
1008537595 6:52518577-52518599 AGGCAGGAGAAGAGAGAGGAAGG + Intronic
1008592782 6:53010570-53010592 TGGCCAGAGCATAGTGAGAAAGG - Intronic
1008609750 6:53174798-53174820 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008810003 6:55484987-55485009 TGGCTGGAGATAAGTGAGTAAGG - Intronic
1008815170 6:55556491-55556513 TAGATGGAGAAGAGTGAGCAAGG + Intronic
1008983407 6:57512885-57512907 TGGCTGGTGCATGGTGAGCACGG - Intronic
1009013963 6:57876966-57876988 TGGCTGGAGAGGACTCAGGAAGG - Intergenic
1009057156 6:58349729-58349751 TGGCAGGTGTAGAGTGGGGAAGG + Intergenic
1009565888 6:65310635-65310657 TGACTGTAGCAGAATGAGAAGGG - Intronic
1009822803 6:68826433-68826455 TGGCTGGAGCAGAGTGATCATGG + Intronic
1009989772 6:70827496-70827518 TGGCTGTAGCATAGAGAGTATGG + Intronic
1010153651 6:72766248-72766270 TGGCTGGAGCACAGTTCGGTAGG + Intronic
1010351197 6:74876618-74876640 CAGCTGGAGTAGAGTGAGCAAGG + Intergenic
1010642965 6:78353647-78353669 TGGCTGGAGCAGGTGGAAGAGGG + Intergenic
1010660628 6:78566834-78566856 AGACTGGAGCTGAGTGAAGAAGG - Intergenic
1011141400 6:84161465-84161487 TGGCTGGAGAAGAGTGACTCAGG + Intronic
1011388978 6:86830083-86830105 TGGCTGGAGCACAGGAAGGTTGG - Intergenic
1011694090 6:89896470-89896492 TGGCTGGAGCACAGGGTGGTAGG + Intergenic
1011842368 6:91517409-91517431 GGCCATGAGCAGAGTGAGGAGGG + Intergenic
1012010337 6:93776329-93776351 TGGCTGGTGGAGGATGAGGATGG - Intergenic
1012356324 6:98318566-98318588 TGGCTAGAGCTGAGTGAGCCTGG + Intergenic
1012415142 6:99005013-99005035 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1012417734 6:99027779-99027801 TGGCTGCAGCTGAGTGAGCAAGG + Intergenic
1012489369 6:99763756-99763778 TGGCTGGAGCATAGTGAGCTAGG + Intergenic
1012603695 6:101131099-101131121 TGGCTGGAGCAGAGTGACTGAGG + Intergenic
1013070399 6:106723946-106723968 TGGCTGGAGTAGAGTGAAGAGGG + Intergenic
1013372913 6:109485450-109485472 TGGCTGGAGCACAGTGAGTGAGG + Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013732403 6:113184223-113184245 TGGCTGGAGTAGAGAGAGGCAGG + Intergenic
1013774183 6:113660849-113660871 AAGCTGGAGCAGATTGAGTATGG + Intergenic
1014002939 6:116385150-116385172 TGGCTGGAGCAGAGAGAGACTGG + Intronic
1014007873 6:116442207-116442229 TGGCTAGAGCAGAGTGGGGGAGG + Intergenic
1014397907 6:120949307-120949329 TGGCTGGGGTAGACTGAGCAAGG - Intergenic
1014738249 6:125120293-125120315 TGCCTGTGGCAGAGTGGGGAAGG - Intronic
1014814170 6:125917360-125917382 TGGCTGGAGAAGAGACAGCAAGG - Intronic
1015144488 6:129970519-129970541 TGGCTGGAGCACAGTGAATGAGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015809084 6:137143225-137143247 GTGCTGGAGAAGAGTGAGGAAGG + Intergenic
1015812921 6:137179132-137179154 TGGCTGGAGAGGAGGGAGCAAGG + Intergenic
1015847676 6:137537880-137537902 TGACTGGAGCTGAGTGAATAAGG - Intergenic
1016295837 6:142572942-142572964 TGTCTGCAGCAGGGTGGGGAAGG - Intergenic
1016471425 6:144378641-144378663 GTGCTGGAGCAAACTGAGGAGGG + Intronic
1016580426 6:145623502-145623524 TGGCTAGAGCAGAGTGAGAGAGG + Intronic
1016688901 6:146912977-146912999 GGGCTGGAGCAGAGACAGGGTGG - Intergenic
1016873779 6:148844552-148844574 TGGCTGGAGCAGACAGGGAAGGG - Intronic
1017220488 6:151960570-151960592 TGACTAGAGCAGAGTGAGGCAGG + Intronic
1017256574 6:152340262-152340284 AGGCTGGAGCAGAGTGAATCAGG + Intronic
1017523689 6:155224361-155224383 TGTCTGGAGTTGAGGGAGGAGGG + Intronic
1017542068 6:155413304-155413326 TGGCTGGAGCCCAGAGAGGGTGG + Intronic
1017681587 6:156870002-156870024 TGGCTGGGGCAGGGTGGGGGCGG + Intronic
1018333596 6:162760625-162760647 TGGCTGGAGGAAAGTGAGCCAGG + Intronic
1019165827 6:170097071-170097093 GGGCTGGTTCAGAGTGGGGAAGG - Intergenic
1019512024 7:1422370-1422392 GGGTTGGGGCAGAGTGAGGCTGG - Intergenic
1019710892 7:2517754-2517776 TGGCTGCAGGGGATTGAGGAGGG + Intronic
1020133766 7:5574612-5574634 TTGCTGGAGCAGAGCCAGGTGGG - Intergenic
1020432130 7:8125318-8125340 TGGCTGGAGCTGACTAAGCAAGG - Intronic
1020643102 7:10780053-10780075 TGGATGGGGTAGAGCGAGGAGGG - Intergenic
1020739389 7:11994388-11994410 TGGCTGGAGCAGAGTGCTATGGG - Intergenic
1021052734 7:16009003-16009025 TGGCTGAACCATAGTGAGCAGGG + Intergenic
1021093694 7:16511475-16511497 TGGGTATAGCAGGGTGAGGAGGG + Intronic
1021511799 7:21441228-21441250 TGACAGGTGAAGAGTGAGGATGG + Intronic
1021804276 7:24339684-24339706 TGCCTGGTGCTGAGTGAGCACGG - Intergenic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1022026423 7:26452156-26452178 GGGCTGGAGCAGAGCGAGGTTGG - Intergenic
1022526139 7:31038538-31038560 TGGCTGGAGGACAGAGAGCAAGG - Intergenic
1022656962 7:32328514-32328536 TGTCTGGAGCACAGTGAACATGG - Intergenic
1022857218 7:34326903-34326925 TGGGTGGGACAAAGTGAGGATGG + Intergenic
1023088075 7:36592326-36592348 AGGCTGTAGCAGAGGGAAGATGG + Intronic
1023142354 7:37114015-37114037 TGGGTGGAGTTGAGGGAGGAAGG + Intronic
1023934188 7:44727498-44727520 TGGCTGGAGCATAGTGAGCAAGG + Intergenic
1024603403 7:51006561-51006583 AGGCAGGAGAAGAGAGAGGATGG + Intergenic
1025249584 7:57343024-57343046 TGGCTGCAGCAGAATGAGTGAGG - Intergenic
1026054241 7:66970817-66970839 TGGCTGGAGCTGGATGTGGAGGG + Intergenic
1026290761 7:69003709-69003731 TGGCTGGAGCTTAGTGAGCCAGG - Intergenic
1026633095 7:72055234-72055256 TGGGTGGGGCAGGGTGAGGCGGG + Intronic
1026947421 7:74325347-74325369 TGGGTGGAGCAGCGTGGCGAGGG + Intronic
1027602941 7:80261918-80261940 TGGTTGCAGCATAGTGAGGAAGG - Intergenic
1027617469 7:80441294-80441316 TGGCTGGAGCTCAAAGAGGAAGG - Intronic
1027798866 7:82726604-82726626 TGGCCACAGCAGAGTGAGCAAGG + Intergenic
1027814092 7:82946657-82946679 TGGTCGGAGCAGAGTGAGGAGGG + Intronic
1027861219 7:83584632-83584654 TGGCAGGAGAAAAGTGGGGAAGG - Intronic
1028172704 7:87617918-87617940 TGGCTGGAGCTCAGAGAGTAAGG - Intronic
1028276389 7:88863104-88863126 TTGCTGTAGCATAGTGAGCACGG - Intronic
1028850339 7:95530616-95530638 TGGCTGAAGTGGAGTGAGCAAGG + Intronic
1029121421 7:98270676-98270698 GGGCTGGGCCAGAGAGAGGATGG + Intronic
1029482802 7:100823371-100823393 TGGCTGGAGCACAGTGGGGTAGG + Intronic
1030109239 7:106012486-106012508 TGGCAGGAGGAGAGTGAACAAGG + Intronic
1030894650 7:115042844-115042866 TGGCTGGAGCAAGGTGAGCTAGG + Intergenic
1031117910 7:117688043-117688065 TTGCTGGGGCAGAGGGAGGGTGG + Intronic
1031528845 7:122852685-122852707 TAGCTGGAGCAGAGAGAGCAAGG + Intronic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1032415495 7:131732537-131732559 TGGCTGGAGCAGAGGGAGCTGGG - Intergenic
1032445138 7:131975889-131975911 TGGATGGAGCAGAGTGAACAAGG - Intergenic
1032832700 7:135644211-135644233 TGGCAGGAACAGGGTGAGGCAGG + Intronic
1033544322 7:142386165-142386187 TGGTAGGGTCAGAGTGAGGAGGG - Intergenic
1033562434 7:142545211-142545233 TGGCTGGAGCAGAGAGAGCCAGG - Intergenic
1033583071 7:142753980-142754002 TGGATGCAGCAGAGGGAGGCAGG + Intronic
1033584620 7:142764884-142764906 TGGATGCAGCAGAGGGAGGCAGG + Intergenic
1033595602 7:142855958-142855980 TGGAGGGAGCAGAGCGAGGGTGG - Intronic
1033871432 7:145758735-145758757 TGGCTGAAGCTGAGTGAGTAGGG - Intergenic
1034339985 7:150346727-150346749 TGGCGGTAGGAGGGTGAGGAGGG + Intergenic
1034446506 7:151116592-151116614 TGAGTGAAGCAGAGTAAGGATGG - Intronic
1034469455 7:151247717-151247739 AGGCTGGAGCTGAGTCAGTAGGG - Intronic
1034526620 7:151667783-151667805 TGGCTGGACCAGAGTGACCTCGG - Intronic
1035761993 8:2075331-2075353 TTGCTGGTGCTGAGTGAGCAAGG - Intronic
1035771850 8:2153834-2153856 GGCCTGGAGCAGAGTGAAGCAGG - Intronic
1035817953 8:2561534-2561556 TGCCTGTAGCAGTCTGAGGAGGG - Intergenic
1036849583 8:12192402-12192424 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1036870945 8:12434675-12434697 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1037143297 8:15542516-15542538 TGGCTGGGGCAGAGGTCGGAGGG + Intronic
1037269330 8:17108897-17108919 TGGTTGGTGCAGAGTGAGCTAGG - Intronic
1037431407 8:18817080-18817102 TGGCTGGAGAGGAGTGAGCAAGG + Intronic
1037941714 8:22956468-22956490 TGGCTGGACCAGGAGGAGGAGGG - Intronic
1038387325 8:27161044-27161066 TGGCTGGAGCACAGGGTGCATGG - Intergenic
1038406489 8:27326116-27326138 TGGCTGCAGGAGAGTCAGGGTGG - Intronic
1038576892 8:28712267-28712289 TGGCTGAAGCTGAGAGAGCAAGG + Intronic
1038820854 8:30950851-30950873 TGGCTGGAGAAGAGTGACTAAGG + Intergenic
1038876312 8:31554254-31554276 TGGTTGGAGCTTAGTGAGAAAGG + Intergenic
1039393952 8:37206811-37206833 TGGTTGGAGAAGAGTCAGGAGGG + Intergenic
1039719892 8:40151893-40151915 TGGTCAGAGCAGAGTGAGCAGGG - Intergenic
1039758455 8:40548092-40548114 TGGCTGGAGCCCAGGGAAGAAGG + Intronic
1039894582 8:41707462-41707484 TGGCTGCAGCAGTGTGTGGTGGG - Intronic
1039907042 8:41794281-41794303 TGGTTGAAGCAGAGTGAGGCAGG - Intronic
1041196915 8:55410009-55410031 TGACTGGAGCAGGGAGATGATGG + Intronic
1041207973 8:55517660-55517682 TGGCTGGAGCACAGAGAGGCAGG + Intronic
1041748882 8:61237703-61237725 AGGCTGGAGAGGTGTGAGGAGGG + Intronic
1042089253 8:65140822-65140844 CCGCTGGAACAGAGTGAGAACGG + Intergenic
1042312076 8:67388798-67388820 TGGCAGGAGCAGGAGGAGGAGGG - Intergenic
1042719935 8:71816484-71816506 TGGTTAGGGAAGAGTGAGGAAGG - Intergenic
1042986515 8:74589785-74589807 TGACTGGAGAAGGGTGTGGAGGG + Intergenic
1043526660 8:81104955-81104977 TGGCTGGTGCACATTGAGGGTGG - Intronic
1043582268 8:81727748-81727770 TGGCTGGAGCAGAGTGGATGGGG + Intronic
1044130534 8:88518143-88518165 TGGTTAGAACAGAGTGAGCAAGG - Intergenic
1044230627 8:89773446-89773468 TGGCTGGAATACAGTGAGCAAGG + Intronic
1044287677 8:90428048-90428070 TAGCTGGAACAGAGTCAGCAAGG + Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1044693550 8:94901201-94901223 TGGCTGGAACGTAGTGAGCAAGG + Intronic
1044701418 8:94968571-94968593 TGCCTGGAGCTGAGTGAGCAAGG + Intronic
1044889833 8:96822673-96822695 TGGCTGGAGTGCAGTGAGAAAGG - Intronic
1045009014 8:97941714-97941736 TGGCTGGAATGGAGTGAGAAAGG + Intronic
1045152969 8:99429956-99429978 TGGCTTCAGCAGAGTGAGCAAGG - Intronic
1045888243 8:107124544-107124566 TGGCTGGTGCAGAATGAACATGG - Intergenic
1046287164 8:112109154-112109176 TGGCTAATGCAGAGTGAGGAAGG + Intergenic
1046692234 8:117298872-117298894 TGGTTGGAGCCATGTGAGGAAGG + Intergenic
1046823502 8:118661575-118661597 TGGCTGGAACAGAGAGAGTAAGG + Intergenic
1047171062 8:122492626-122492648 TGGCTGCAGCAGAGTTAGCAAGG + Intergenic
1047236817 8:123048900-123048922 AGGCTGGAGCAGAGTGACAAGGG - Intronic
1047241747 8:123096276-123096298 TGGCTAGAGCAGACTAAGGAAGG - Intronic
1047292185 8:123540787-123540809 GGGCTGGAGCGGGCTGAGGAGGG - Intronic
1047367884 8:124228983-124229005 TGGCTGGAGCAGAGTGAGCTTGG + Intergenic
1047463277 8:125088933-125088955 TGGCTGGAGCAGAGTCAGCTAGG + Intronic
1047618982 8:126587083-126587105 TGGCTGGAGAAGAGAGGGCAGGG + Intergenic
1047915845 8:129582978-129583000 TGGGAGGAGCACAGTGAGCAAGG + Intergenic
1048047404 8:130785850-130785872 CAGCTGGAGCAGAGTGAGAGAGG - Intronic
1048059088 8:130899034-130899056 TGGCTAGAGCATAGTGAGCAGGG - Intronic
1048183175 8:132214907-132214929 TGGCAGGAGTTGATTGAGGAAGG - Intronic
1048248085 8:132831266-132831288 TGGCTGGAACACAGTGAATAAGG - Intronic
1048267353 8:132999195-132999217 AGTCTGGACCAGAGTGAGAAAGG + Intronic
1048651605 8:136484504-136484526 TGGCTGGAGCAGAATGACTGAGG - Intergenic
1048861448 8:138727175-138727197 GTGCTGGAGCTGAGGGAGGAGGG - Intronic
1048938572 8:139377225-139377247 AGGCTGGATGAGAGTGAGGAGGG - Intergenic
1049030410 8:140032407-140032429 TGGCTGGAGGAGGGTGGGGGGGG - Intronic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049090240 8:140509213-140509235 TGTCTGGAGCTTAGTGAGGGAGG - Intergenic
1049137470 8:140916367-140916389 TGGCTGGAACAGAGTGAATACGG - Intronic
1049251963 8:141594015-141594037 TAGCTGGAGCAGAGTGAGCCAGG + Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049534074 8:143169929-143169951 GGGATGGAGCTGAGTGAGGGCGG + Intergenic
1049614924 8:143571919-143571941 TGGCAGGAGCAGCCTGAAGATGG + Intronic
1049652976 8:143783839-143783861 TTGATGGTGTAGAGTGAGGAGGG - Intergenic
1049713814 8:144080100-144080122 TGGGTGCAGCTGTGTGAGGATGG - Exonic
1049889429 9:54840-54862 TGGCTGGAACAGAAGGAGGAGGG - Intergenic
1050185633 9:2969901-2969923 ATGCTGGAGCAGAGTGAGTGAGG + Intergenic
1050333150 9:4565501-4565523 TGGCTGCAGGAGAGAGAGCAAGG + Intronic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050915936 9:11132743-11132765 TGGCTGGAGCAGGAGGAAGAGGG - Intergenic
1051100541 9:13515881-13515903 TAGCTGGAGCAGAGAGAATAAGG + Intergenic
1051225334 9:14892806-14892828 TGCCTGGGGCAGAGTGGGGAAGG - Intronic
1051261425 9:15268974-15268996 TGGCTGGAGTCGAGTGAGTAAGG - Intronic
1051347150 9:16162520-16162542 TGGCTGGAGTGGAGAGAGCAAGG + Intergenic
1051463351 9:17348895-17348917 TGGCTGGAGTAGGGTGGGCATGG + Intronic
1051542203 9:18232167-18232189 TGGCTAGAGCAGAGTGAGTGAGG - Intergenic
1051571759 9:18566713-18566735 TGACTGGAGCTAAGTGAGCAAGG + Intronic
1051678533 9:19582984-19583006 TGGCTGGGGCGGAGAGGGGAGGG - Intronic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052292032 9:26852975-26852997 AGGCAGGAGCAGAGAGAGCAAGG + Intronic
1052463502 9:28798561-28798583 TGGTTTGAGAAGAGGGAGGAAGG + Intergenic
1052716133 9:32119788-32119810 TGGCTGGAGCTGCATGAGAAGGG + Intergenic
1052854825 9:33400839-33400861 TGGCTGGAGGAGGGAGAGCAGGG + Intronic
1053121892 9:35553704-35553726 TGGCTGGAGCACAGTGGGCCAGG + Intronic
1053634018 9:39976336-39976358 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
1053682843 9:40497158-40497180 TGGCTGGAGGAGGGAGAGCAGGG + Intergenic
1053730915 9:41056110-41056132 TGGCTGGAACAGAAGAAGGAGGG - Intergenic
1053753473 9:41279260-41279282 TGGCAGGAGCAGAGGGAGCCTGG + Intergenic
1053771729 9:41487168-41487190 TGGCTGGAGATGAGTGAGGAAGG + Intergenic
1053932825 9:43125472-43125494 TGGCTGGAGGAGGGAGAGCAGGG + Intergenic
1054209869 9:62274361-62274383 TGGCTGGAGATGAGTGAGGAAGG + Intergenic
1054258995 9:62843623-62843645 TGGCAGGAGCAGAGCGAGCCTGG + Intergenic
1054280871 9:63127770-63127792 TGGCTGGAGGAGGGAGAGCAGGG - Intergenic
1054295943 9:63332658-63332680 TGGCTGGAGGAGGGAGAGCAGGG + Intergenic
1054315126 9:63574593-63574615 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
1054332782 9:63776417-63776439 TGGCAGGAGCAGAGGGAGCCTGG - Intergenic
1054393959 9:64637153-64637175 TGGCTGGAGGAGGGAGAGCAGGG + Intergenic
1054428608 9:65142365-65142387 TGGCTGGAGGAGGGAGAGCAGGG + Intergenic
1054501771 9:65879177-65879199 TGGCTGGAGGAGGGAGAGCAGGG - Intronic
1054697598 9:68375980-68376002 TGGCTGGAACAGAAGAAGGAGGG + Intronic
1054749176 9:68886921-68886943 TGGCTGTAGCAGAGAGGGCAAGG - Intronic
1054870123 9:70041845-70041867 TGGCTAGAGAAGAGTAAGCAGGG + Intergenic
1055147040 9:72948438-72948460 TGGCTGGAGTAAAGTGAATAAGG - Intronic
1055249584 9:74286983-74287005 TGGCTGGAGCAGGGTGGGAGAGG - Intergenic
1055329817 9:75171964-75171986 GGGCTGGAACAGAGTGAAGGAGG + Intergenic
1056222501 9:84464221-84464243 TGGCTGGAGCAGAGGGAACCAGG - Intergenic
1056493107 9:87127263-87127285 TGGCTGGAGCAGAGTGAATGTGG - Intergenic
1056558900 9:87712452-87712474 GGGCTGGTGCTGGGTGAGGACGG + Intergenic
1056575209 9:87851295-87851317 GGGCTGGCGCTGGGTGAGGATGG - Intergenic
1056589027 9:87951036-87951058 TGGGTGGGGGAGACTGAGGAGGG + Intergenic
1056766554 9:89447754-89447776 GGGCTGAGGCAGAGTCAGGAAGG - Intronic
1056965628 9:91161121-91161143 TGGCAGGCGCAGAGGCAGGAAGG - Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057445643 9:95112585-95112607 AGGCTGTACCAGAGTGAGGAGGG + Intronic
1057500180 9:95590622-95590644 TGGCTGGAGCAGAGTAAACAAGG - Intergenic
1057734076 9:97637064-97637086 GTGCTGGAGCAGAGTGAGTGAGG + Intronic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057831271 9:98409121-98409143 TGGCCGGAACACAGTGAGGGAGG + Intronic
1058045763 9:100354951-100354973 TGACTGGAGCAGAGTAAAAAAGG - Intergenic
1058106600 9:100978983-100979005 TGGCTGGAGCAGAGAGTATAAGG - Intergenic
1058201667 9:102050012-102050034 TGCCTGAAGCACAGTGAGAAAGG - Intergenic
1058374106 9:104303946-104303968 TGGCTGGAGCAGGAGGAAGAGGG - Intergenic
1058387876 9:104460180-104460202 TGCCTGGAGCTGAGTGAACAAGG + Intergenic
1058597446 9:106630188-106630210 TGGATGGAGCAGAGTGCAGAAGG + Intergenic
1059310678 9:113387142-113387164 TGTCTGGAGCACTGAGAGGATGG - Exonic
1059400760 9:114069640-114069662 TGCCTGGGGCAGAGTGGGGTGGG + Intronic
1059565452 9:115379744-115379766 TGTCAGGAGCAGAGAGAGGCTGG - Intronic
1059750207 9:117240493-117240515 TGACTGGAGCAGAGTAAGAAAGG + Intronic
1060290576 9:122299066-122299088 TGCCTGTAGCAGAGTGAGTGAGG + Intronic
1060706464 9:125806277-125806299 TGGCTGGAGCAGAGGGAGGGAGG + Intronic
1060744776 9:126124109-126124131 TTGCTCGAGAACAGTGAGGAGGG + Intergenic
1060868817 9:127022613-127022635 TGGCTGGAGCAGAAGGAGCCTGG - Intronic
1060912733 9:127363612-127363634 TGGGAGGAGCACAGTGTGGACGG + Intronic
1060960978 9:127680455-127680477 TGGCTGATGCAGAGTGAGCGAGG - Intronic
1061085754 9:128397255-128397277 TGGCTGGAGCGCAGTGAGGAAGG + Intergenic
1061234335 9:129333860-129333882 TTTCTGGAGGAGAGAGAGGAAGG - Intergenic
1061327699 9:129874241-129874263 TGGCTGGAGCAAAGAGGAGAGGG + Intronic
1061350566 9:130061486-130061508 TGGCTGGAGCAGAGTGATCTAGG + Intronic
1061774146 9:132949397-132949419 AGGCTGGTTCAGTGTGAGGAAGG - Intronic
1061854835 9:133436329-133436351 TGGCTGGAGCACAGGGTGGTGGG + Intronic
1061902705 9:133681096-133681118 TGGCTGGGGCTGTGTGGGGATGG + Intronic
1061938693 9:133872564-133872586 AGCCTGGAGCAGAGGCAGGAAGG + Intronic
1062042532 9:134410696-134410718 TGGCTGGAGCTGGGGGGGGAAGG + Intronic
1062156243 9:135050290-135050312 GGCCTGGCGCAGAGTGAGGCAGG + Intergenic
1062497386 9:136838157-136838179 TGGCTGGAGCAGACGAGGGAAGG + Intronic
1062517913 9:136945343-136945365 TGCCAGGAGCAGAGTCAAGAGGG - Exonic
1062534283 9:137014689-137014711 TCGCTGGAGAACAGTGAGGCCGG - Exonic
1185775407 X:2799224-2799246 GGGTGGGAGTAGAGTGAGGATGG - Intronic
1186375338 X:8992541-8992563 TGGCTGGTGCCAAGTGGGGAAGG + Intergenic
1186506860 X:10100614-10100636 TGGCTGGAGCAGGGTGAGTGGGG - Intronic
1186536530 X:10355773-10355795 TGGCTGGAGCAGAACGAACAAGG + Intergenic
1186541908 X:10409589-10409611 AGGCTGGGGTGGAGTGAGGATGG - Intergenic
1186693620 X:12005781-12005803 TGGCTGGTGCCAAGTGGGGAAGG + Intergenic
1186719690 X:12289929-12289951 TGGGTAGTGCAGAATGAGGAGGG + Intronic
1187055006 X:15734652-15734674 TAGGTGGATCAGAGTGAGAAAGG + Intronic
1187145185 X:16630641-16630663 AGGCTCGAGGAGAGAGAGGAGGG - Intronic
1187549522 X:20287952-20287974 TGGCTGAAGCAGAGACAGCAAGG - Intergenic
1187731379 X:22258642-22258664 TGGCTGGAGCAGAGCGAGCAAGG + Intergenic
1187765462 X:22636920-22636942 TAGCTGGAGCTGAGTGAGAAAGG + Intergenic
1187932240 X:24304048-24304070 GGGCTGGAACAGAGTGGGGAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188681163 X:33007266-33007288 TGGCTGGTGCAGAGTGACTGAGG - Intronic
1188828618 X:34868372-34868394 TGGCAGGAGGAGAGAGAAGAGGG + Intergenic
1189244672 X:39554341-39554363 TGGCTGGAGCAGAGCGGGTGAGG + Intergenic
1189278618 X:39805200-39805222 TGGCTGGAGGGGAGGGAGCAAGG + Intergenic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1189383621 X:40519106-40519128 TGACTGGAGGAGGGAGAGGAGGG + Intergenic
1189482738 X:41405727-41405749 CAGCTGGAGCAGAGTGAGCCGGG - Intergenic
1189712503 X:43827760-43827782 TGGCTGGACCAGGGTGAGCTGGG + Intronic
1189715500 X:43860794-43860816 TGGCTGTAGTAGAATGAGCAAGG - Intronic
1190216093 X:48480402-48480424 TGGTTGGAACAGAGTGAGGGGGG + Intronic
1190217468 X:48489446-48489468 GGGCAGGAGCAGAGTGAACAAGG + Intergenic
1190221489 X:48515097-48515119 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190232137 X:48590460-48590482 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190257249 X:48772849-48772871 TGGCTGGAACGGAGTGATGGAGG + Intronic
1190286344 X:48963885-48963907 TGGGTGGAGGAGAGTGAGCTGGG - Intronic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1190328509 X:49221386-49221408 AGGCTGGAATGGAGTGAGGAAGG - Intronic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1190458558 X:50647894-50647916 GAGCTGGAGCACAGTGAGCAAGG + Intronic
1190491894 X:50990663-50990685 TGACTGGAGCAGAATGAGAGAGG - Intergenic
1190501268 X:51081017-51081039 TGACTGGAGCAGAATGAGAGAGG + Intergenic
1191025507 X:55908905-55908927 AGGGTGGAGCAGAGTGGGGTTGG + Intergenic
1191135997 X:57066327-57066349 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1191141036 X:57117178-57117200 TGTCTGGAGCTGAGTGAACAAGG - Intergenic
1191142636 X:57132894-57132916 TGACTGGAGCTGAGTGAACAAGG - Intergenic
1191613022 X:63136870-63136892 TGCCTGAAGCAGAGTGGGGAAGG - Intergenic
1191623275 X:63242056-63242078 TGCCTGAAGCAGAGTGGGGAAGG + Intergenic
1191662005 X:63661132-63661154 GGGCTGGAGCAGAAAGAAGAAGG - Intronic
1191713879 X:64180569-64180591 TGGCTGAAGTAGAGTGAGTGAGG - Intergenic
1191891104 X:65942294-65942316 TGGTGGGAGGAGGGTGAGGATGG - Intergenic
1191959346 X:66682891-66682913 TGGCTAGGGCAGAGTGAAGGAGG + Intergenic
1192273824 X:69610115-69610137 TGACTGGAGCAGAGTGAACAAGG + Intergenic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1192543656 X:71995483-71995505 TGGCTGGTGCAGAGTGCAGAAGG - Intergenic
1192786753 X:74343793-74343815 TGGCTGGAGCAGGAGGAAGAGGG - Intergenic
1192888489 X:75362831-75362853 TGCCTGTGGCAGAGTGGGGAAGG - Intergenic
1194086247 X:89532295-89532317 TGTCTGTAGCAGGGTGGGGAAGG + Intergenic
1194643675 X:96432044-96432066 TGGCTGGAACATAGTGAGGAAGG - Intergenic
1195005013 X:100677277-100677299 TGGTTGAAGCATAGTGAGCAAGG + Intronic
1195271261 X:103233374-103233396 TTGCCTGAGCAGGGTGAGGAAGG + Intergenic
1195419187 X:104654494-104654516 TGGCTGGAGCATAGGCAGCAAGG + Intronic
1195576637 X:106459135-106459157 TGACTGGAGCTGAGTGAGCAAGG - Intergenic
1195661252 X:107380888-107380910 TGATTGGAGCAGAGTAAGCAAGG + Intergenic
1195738009 X:108033424-108033446 TGGGTGCAGCAGCATGAGGAGGG - Intergenic
1195738581 X:108038742-108038764 TGGCTAGAGCAGAGTGCAGGGGG + Intergenic
1195791630 X:108594589-108594611 TTGCTAGAGCAGAATGAGGGAGG - Intronic
1196086299 X:111685911-111685933 TTGCAGGAGCATAGTGAGCAAGG + Intronic
1196264773 X:113629747-113629769 GGGGTGGAGAAGAGTGAGGATGG + Intergenic
1196377609 X:115051513-115051535 TTGCTGGGGCAGAGTAAGCAAGG + Intergenic
1196749305 X:119100476-119100498 GGGTTGGAGGGGAGTGAGGATGG - Intronic
1196830611 X:119772786-119772808 TGGCTGGAGCAGAGTGAGGGAGG - Intergenic
1196906754 X:120444541-120444563 CGGCTGGAGGAGAGTCAGGAAGG - Intronic
1197503574 X:127273221-127273243 TGGCGGGAGCATAGTATGGAGGG - Intergenic
1197631795 X:128869401-128869423 TGGCTGGACTATAGTGAGCAAGG + Intergenic
1197750970 X:129963336-129963358 TGACTCCTGCAGAGTGAGGAGGG - Intergenic
1197798905 X:130328615-130328637 TGGCTGGAGCAGAGCCATGAAGG - Intergenic
1197881736 X:131173772-131173794 TGGCTAAAGCAGAGTGATTAAGG + Intergenic
1197891008 X:131270367-131270389 TGGCTGGAGCATAGTAAGCAAGG - Intergenic
1197916608 X:131542473-131542495 TGACTGGAGCAAAGTGAGCAAGG + Intergenic
1198000824 X:132433787-132433809 TGGCTGGAGCAGAGCCATGAAGG - Intronic
1198229736 X:134677609-134677631 TGGCTGGAACGTAGTGAGTAAGG + Intronic
1198433885 X:136596352-136596374 TGGCTGTAGCAGCATGAGTAAGG + Intergenic
1198554629 X:137779935-137779957 AGGGTGGGGCAGAGTGGGGATGG - Intergenic
1198710439 X:139495726-139495748 TGCCTGGAGCTGAGTGAGAGAGG - Intergenic
1199177060 X:144801633-144801655 TGGCTGAAGCATAATGAGAAAGG - Intergenic
1199286384 X:146059169-146059191 TGGCTGGAGCATGGGGAAGAGGG + Intergenic
1199413486 X:147553212-147553234 TGGCTGGAGTGGAGTGAGTTGGG - Intergenic
1200059198 X:153476799-153476821 TGTCTGGAGCAGAGGGTGGGAGG - Intronic
1200250103 X:154548217-154548239 TAGCTGGAGCAGAGTGAGGGAGG + Intronic
1200259262 X:154603508-154603530 TGGCTGCATCAGCGTGAGCAAGG + Intergenic
1200335581 X:155347837-155347859 TGGCTGGAGCTGAGTAAGCAAGG - Intergenic
1200350887 X:155493388-155493410 TGGCTGGAGCTGAGTAAGCAAGG + Intronic
1200438907 Y:3188172-3188194 TGTCTGTAGCAGGGTGGGGAAGG + Intergenic
1200972689 Y:9172586-9172608 TTGCTGGAGCAGGCTGTGGAAGG + Intergenic
1201766289 Y:17576295-17576317 GGGCTGGAGCTCAGTGTGGATGG - Intergenic
1201798801 Y:17930593-17930615 TGGCTGGAGCAGACCGTGGAAGG - Intergenic
1201802752 Y:17975364-17975386 TGGCTGGAGCAGACCGTGGAAGG + Intergenic
1201835263 Y:18329694-18329716 GGGCTGGAGCTCAGTGTGGATGG + Intergenic
1202138327 Y:21691629-21691651 TGGCTGGAGCAGGCTGTGGAAGG - Intergenic
1202166159 Y:21990990-21991012 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202172231 Y:22061965-22061987 TGGAAGGAGCAGACTGTGGAAGG - Intergenic
1202172233 Y:22061981-22062003 TGGATGGAGCAGACTGTGGAAGG - Intergenic
1202219131 Y:22524390-22524412 TGGATGGAGCAGACTGTGGAAGG + Intergenic
1202219133 Y:22524406-22524428 TGGAAGGAGCAGACTGTGGAAGG + Intergenic
1202225199 Y:22595383-22595405 TGGCTGAAGCATAGTGTGGAAGG - Intergenic
1202317915 Y:23600278-23600300 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202324049 Y:23671662-23671684 TGGATGGAGCAGACTGTGGAAGG - Intergenic
1202360102 Y:24099209-24099231 TGGCTGGAGCAGACCGTGGAAGG - Intergenic
1202510675 Y:25570905-25570927 TGGCTGGAGCAGACCGTGGAAGG + Intergenic
1202546722 Y:25998392-25998414 TGGATGGAGCAGACTGTGGAAGG + Intergenic
1202552851 Y:26069780-26069802 TGGCTGAAGCATAGTGTGGAAGG - Intergenic