ID: 1161643072

View in Genome Browser
Species Human (GRCh38)
Location 19:5436364-5436386
Sequence GCGCGCGCGCGTGCGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161643065_1161643072 12 Left 1161643065 19:5436329-5436351 CCATGCTGCCTGGGGGACAATGT No data
Right 1161643072 19:5436364-5436386 GCGCGCGCGCGTGCGGGGAGGGG No data
1161643066_1161643072 4 Left 1161643066 19:5436337-5436359 CCTGGGGGACAATGTGTGTGTGT No data
Right 1161643072 19:5436364-5436386 GCGCGCGCGCGTGCGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161643072 Original CRISPR GCGCGCGCGCGTGCGGGGAG GGG Intergenic
No off target data available for this crispr