ID: 1161645531

View in Genome Browser
Species Human (GRCh38)
Location 19:5451212-5451234
Sequence CCCAAGCCTGGGGCTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161645524_1161645531 3 Left 1161645524 19:5451186-5451208 CCCTGGCTGTCTGGGTCCATCTC No data
Right 1161645531 19:5451212-5451234 CCCAAGCCTGGGGCTCCTTGAGG No data
1161645517_1161645531 25 Left 1161645517 19:5451164-5451186 CCCATTATCTGGGCTCCCTCAGC No data
Right 1161645531 19:5451212-5451234 CCCAAGCCTGGGGCTCCTTGAGG No data
1161645523_1161645531 9 Left 1161645523 19:5451180-5451202 CCTCAGCCCTGGCTGTCTGGGTC No data
Right 1161645531 19:5451212-5451234 CCCAAGCCTGGGGCTCCTTGAGG No data
1161645516_1161645531 26 Left 1161645516 19:5451163-5451185 CCCCATTATCTGGGCTCCCTCAG No data
Right 1161645531 19:5451212-5451234 CCCAAGCCTGGGGCTCCTTGAGG No data
1161645518_1161645531 24 Left 1161645518 19:5451165-5451187 CCATTATCTGGGCTCCCTCAGCC No data
Right 1161645531 19:5451212-5451234 CCCAAGCCTGGGGCTCCTTGAGG No data
1161645525_1161645531 2 Left 1161645525 19:5451187-5451209 CCTGGCTGTCTGGGTCCATCTCT No data
Right 1161645531 19:5451212-5451234 CCCAAGCCTGGGGCTCCTTGAGG No data
1161645522_1161645531 10 Left 1161645522 19:5451179-5451201 CCCTCAGCCCTGGCTGTCTGGGT No data
Right 1161645531 19:5451212-5451234 CCCAAGCCTGGGGCTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161645531 Original CRISPR CCCAAGCCTGGGGCTCCTTG AGG Intergenic