ID: 1161646033

View in Genome Browser
Species Human (GRCh38)
Location 19:5453992-5454014
Sequence CTGTGGGAGGGGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161646021_1161646033 26 Left 1161646021 19:5453943-5453965 CCACCCACTACATGGTACAAGAG No data
Right 1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG No data
1161646022_1161646033 23 Left 1161646022 19:5453946-5453968 CCCACTACATGGTACAAGAGATT No data
Right 1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG No data
1161646020_1161646033 27 Left 1161646020 19:5453942-5453964 CCCACCCACTACATGGTACAAGA No data
Right 1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG No data
1161646023_1161646033 22 Left 1161646023 19:5453947-5453969 CCACTACATGGTACAAGAGATTT No data
Right 1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161646033 Original CRISPR CTGTGGGAGGGGAGAGAAGT GGG Intergenic
No off target data available for this crispr