ID: 1161646104

View in Genome Browser
Species Human (GRCh38)
Location 19:5454454-5454476
Sequence CCATGCTCTAAACTCTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161646104_1161646108 0 Left 1161646104 19:5454454-5454476 CCATGGGAGAGTTTAGAGCATGG No data
Right 1161646108 19:5454477-5454499 GAAAGACTATGTTACAGGTCTGG No data
1161646104_1161646107 -5 Left 1161646104 19:5454454-5454476 CCATGGGAGAGTTTAGAGCATGG No data
Right 1161646107 19:5454472-5454494 CATGGGAAAGACTATGTTACAGG No data
1161646104_1161646109 9 Left 1161646104 19:5454454-5454476 CCATGGGAGAGTTTAGAGCATGG No data
Right 1161646109 19:5454486-5454508 TGTTACAGGTCTGGAAGCTGAGG No data
1161646104_1161646110 19 Left 1161646104 19:5454454-5454476 CCATGGGAGAGTTTAGAGCATGG No data
Right 1161646110 19:5454496-5454518 CTGGAAGCTGAGGCCCAGAGAGG No data
1161646104_1161646111 25 Left 1161646104 19:5454454-5454476 CCATGGGAGAGTTTAGAGCATGG No data
Right 1161646111 19:5454502-5454524 GCTGAGGCCCAGAGAGGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161646104 Original CRISPR CCATGCTCTAAACTCTCCCA TGG (reversed) Intergenic
No off target data available for this crispr