ID: 1161646107

View in Genome Browser
Species Human (GRCh38)
Location 19:5454472-5454494
Sequence CATGGGAAAGACTATGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161646104_1161646107 -5 Left 1161646104 19:5454454-5454476 CCATGGGAGAGTTTAGAGCATGG No data
Right 1161646107 19:5454472-5454494 CATGGGAAAGACTATGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161646107 Original CRISPR CATGGGAAAGACTATGTTAC AGG Intergenic
No off target data available for this crispr