ID: 1161647912

View in Genome Browser
Species Human (GRCh38)
Location 19:5465701-5465723
Sequence GGCTCCCCAAGGTCCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161647912_1161647916 13 Left 1161647912 19:5465701-5465723 CCCACTGGGGACCTTGGGGAGCC No data
Right 1161647916 19:5465737-5465759 AAACTCAGAATTGCCCCACCTGG No data
1161647912_1161647917 18 Left 1161647912 19:5465701-5465723 CCCACTGGGGACCTTGGGGAGCC No data
Right 1161647917 19:5465742-5465764 CAGAATTGCCCCACCTGGCCAGG No data
1161647912_1161647920 26 Left 1161647912 19:5465701-5465723 CCCACTGGGGACCTTGGGGAGCC No data
Right 1161647920 19:5465750-5465772 CCCCACCTGGCCAGGTGCGGTGG No data
1161647912_1161647918 23 Left 1161647912 19:5465701-5465723 CCCACTGGGGACCTTGGGGAGCC No data
Right 1161647918 19:5465747-5465769 TTGCCCCACCTGGCCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161647912 Original CRISPR GGCTCCCCAAGGTCCCCAGT GGG (reversed) Intergenic
No off target data available for this crispr