ID: 1161647917

View in Genome Browser
Species Human (GRCh38)
Location 19:5465742-5465764
Sequence CAGAATTGCCCCACCTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161647913_1161647917 17 Left 1161647913 19:5465702-5465724 CCACTGGGGACCTTGGGGAGCCT No data
Right 1161647917 19:5465742-5465764 CAGAATTGCCCCACCTGGCCAGG No data
1161647914_1161647917 7 Left 1161647914 19:5465712-5465734 CCTTGGGGAGCCTGTGTTGACTG No data
Right 1161647917 19:5465742-5465764 CAGAATTGCCCCACCTGGCCAGG No data
1161647912_1161647917 18 Left 1161647912 19:5465701-5465723 CCCACTGGGGACCTTGGGGAGCC No data
Right 1161647917 19:5465742-5465764 CAGAATTGCCCCACCTGGCCAGG No data
1161647915_1161647917 -3 Left 1161647915 19:5465722-5465744 CCTGTGTTGACTGTGAAACTCAG No data
Right 1161647917 19:5465742-5465764 CAGAATTGCCCCACCTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161647917 Original CRISPR CAGAATTGCCCCACCTGGCC AGG Intergenic
No off target data available for this crispr