ID: 1161648539

View in Genome Browser
Species Human (GRCh38)
Location 19:5469663-5469685
Sequence CTGTGTAGGGGGAAAGTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161648526_1161648539 30 Left 1161648526 19:5469610-5469632 CCAGCAGAAGGAAGGAGTTGGTG No data
Right 1161648539 19:5469663-5469685 CTGTGTAGGGGGAAAGTTGTCGG No data
1161648529_1161648539 6 Left 1161648529 19:5469634-5469656 CCACGGCTGCACCTTCGCAAGGG No data
Right 1161648539 19:5469663-5469685 CTGTGTAGGGGGAAAGTTGTCGG No data
1161648534_1161648539 -5 Left 1161648534 19:5469645-5469667 CCTTCGCAAGGGGGCTGGCTGTG No data
Right 1161648539 19:5469663-5469685 CTGTGTAGGGGGAAAGTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161648539 Original CRISPR CTGTGTAGGGGGAAAGTTGT CGG Intergenic
No off target data available for this crispr