ID: 1161657326

View in Genome Browser
Species Human (GRCh38)
Location 19:5524336-5524358
Sequence CTGAATCAAGTGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161657316_1161657326 15 Left 1161657316 19:5524298-5524320 CCCCAGCAGTGGAATAATTGAAT No data
Right 1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG No data
1161657318_1161657326 13 Left 1161657318 19:5524300-5524322 CCAGCAGTGGAATAATTGAATCG No data
Right 1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG No data
1161657317_1161657326 14 Left 1161657317 19:5524299-5524321 CCCAGCAGTGGAATAATTGAATC No data
Right 1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG No data
1161657315_1161657326 18 Left 1161657315 19:5524295-5524317 CCACCCCAGCAGTGGAATAATTG No data
Right 1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG No data
1161657314_1161657326 22 Left 1161657314 19:5524291-5524313 CCAGCCACCCCAGCAGTGGAATA No data
Right 1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161657326 Original CRISPR CTGAATCAAGTGAGGGTGGA AGG Intergenic
No off target data available for this crispr