ID: 1161657362

View in Genome Browser
Species Human (GRCh38)
Location 19:5524490-5524512
Sequence GGACTCAGCTTGTCTTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161657362_1161657364 -5 Left 1161657362 19:5524490-5524512 CCTGCTGAAGACAAGCTGAGTCC No data
Right 1161657364 19:5524508-5524530 AGTCCTGCAGAGAGAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161657362 Original CRISPR GGACTCAGCTTGTCTTCAGC AGG (reversed) Intergenic
No off target data available for this crispr