ID: 1161665362

View in Genome Browser
Species Human (GRCh38)
Location 19:5572800-5572822
Sequence TTGGACACCAGCAATTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161665362_1161665369 -1 Left 1161665362 19:5572800-5572822 CCATCATAATTGCTGGTGTCCAA No data
Right 1161665369 19:5572822-5572844 AGAAGGTCAAAGGGAGGCCTGGG No data
1161665362_1161665366 -7 Left 1161665362 19:5572800-5572822 CCATCATAATTGCTGGTGTCCAA No data
Right 1161665366 19:5572816-5572838 TGTCCAAGAAGGTCAAAGGGAGG No data
1161665362_1161665375 21 Left 1161665362 19:5572800-5572822 CCATCATAATTGCTGGTGTCCAA No data
Right 1161665375 19:5572844-5572866 GGACACTCGGCTTTAACACGGGG No data
1161665362_1161665368 -2 Left 1161665362 19:5572800-5572822 CCATCATAATTGCTGGTGTCCAA No data
Right 1161665368 19:5572821-5572843 AAGAAGGTCAAAGGGAGGCCTGG No data
1161665362_1161665371 8 Left 1161665362 19:5572800-5572822 CCATCATAATTGCTGGTGTCCAA No data
Right 1161665371 19:5572831-5572853 AAGGGAGGCCTGGGGACACTCGG No data
1161665362_1161665373 19 Left 1161665362 19:5572800-5572822 CCATCATAATTGCTGGTGTCCAA No data
Right 1161665373 19:5572842-5572864 GGGGACACTCGGCTTTAACACGG No data
1161665362_1161665376 24 Left 1161665362 19:5572800-5572822 CCATCATAATTGCTGGTGTCCAA No data
Right 1161665376 19:5572847-5572869 CACTCGGCTTTAACACGGGGAGG No data
1161665362_1161665374 20 Left 1161665362 19:5572800-5572822 CCATCATAATTGCTGGTGTCCAA No data
Right 1161665374 19:5572843-5572865 GGGACACTCGGCTTTAACACGGG No data
1161665362_1161665365 -10 Left 1161665362 19:5572800-5572822 CCATCATAATTGCTGGTGTCCAA No data
Right 1161665365 19:5572813-5572835 TGGTGTCCAAGAAGGTCAAAGGG No data
1161665362_1161665370 0 Left 1161665362 19:5572800-5572822 CCATCATAATTGCTGGTGTCCAA No data
Right 1161665370 19:5572823-5572845 GAAGGTCAAAGGGAGGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161665362 Original CRISPR TTGGACACCAGCAATTATGA TGG (reversed) Intergenic
No off target data available for this crispr