ID: 1161668613

View in Genome Browser
Species Human (GRCh38)
Location 19:5591697-5591719
Sequence GGGCCACTGTACTGCTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161668613_1161668624 21 Left 1161668613 19:5591697-5591719 CCTGCACAGCAGTACAGTGGCCC 0: 1
1: 0
2: 0
3: 10
4: 219
Right 1161668624 19:5591741-5591763 TACTCACCTGCCCATCCCGGTGG 0: 1
1: 0
2: 2
3: 6
4: 92
1161668613_1161668618 -6 Left 1161668613 19:5591697-5591719 CCTGCACAGCAGTACAGTGGCCC 0: 1
1: 0
2: 0
3: 10
4: 219
Right 1161668618 19:5591714-5591736 TGGCCCCAGGGCTTGGCATCGGG 0: 1
1: 0
2: 2
3: 33
4: 293
1161668613_1161668619 -5 Left 1161668613 19:5591697-5591719 CCTGCACAGCAGTACAGTGGCCC 0: 1
1: 0
2: 0
3: 10
4: 219
Right 1161668619 19:5591715-5591737 GGCCCCAGGGCTTGGCATCGGGG 0: 1
1: 0
2: 3
3: 21
4: 261
1161668613_1161668617 -7 Left 1161668613 19:5591697-5591719 CCTGCACAGCAGTACAGTGGCCC 0: 1
1: 0
2: 0
3: 10
4: 219
Right 1161668617 19:5591713-5591735 GTGGCCCCAGGGCTTGGCATCGG 0: 1
1: 0
2: 7
3: 31
4: 386
1161668613_1161668623 18 Left 1161668613 19:5591697-5591719 CCTGCACAGCAGTACAGTGGCCC 0: 1
1: 0
2: 0
3: 10
4: 219
Right 1161668623 19:5591738-5591760 CTCTACTCACCTGCCCATCCCGG 0: 1
1: 0
2: 0
3: 23
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161668613 Original CRISPR GGGCCACTGTACTGCTGTGC AGG (reversed) Intronic
904346727 1:29877219-29877241 GAGCCACTGTACTCCAGTTCCGG + Intergenic
907377404 1:54055018-54055040 GTGCCACTGTACTGCAGTCTGGG - Intronic
908422728 1:63975104-63975126 GGGCCACTGTAGAGCAGTTCTGG - Intronic
910243212 1:85110406-85110428 GTGCCACTGTACTCCAGTCCGGG + Intronic
910857357 1:91708847-91708869 AGGCCACAGGACAGCTGTGCAGG - Intronic
913238334 1:116804596-116804618 GTGCCACTGTACTCCAGTGTGGG + Intergenic
914841947 1:151255765-151255787 GGGCCACTGCACTCCAGTCCGGG - Intronic
914880387 1:151541880-151541902 GAGCCACTGTACTGCAGCTCCGG - Intronic
917456047 1:175186937-175186959 AGGCCACTGTTATGCTGTGCTGG + Intronic
919388869 1:196955802-196955824 GTGCCACTGTACTGCAGTCTGGG + Intronic
919743176 1:200992609-200992631 GGGCACCTGCACTGCTGGGCTGG - Intronic
920294325 1:204946643-204946665 GGCCTCCTGTACTGCTGGGCTGG + Intronic
921209280 1:212878944-212878966 GTGCCACTGTACTGCAGTCTGGG + Intronic
921315246 1:213884352-213884374 GGGACCCTGTTCTGCTGTGCTGG + Intergenic
921364910 1:214364571-214364593 GGTCCACTGTAGTGCTGGGGTGG - Exonic
924530462 1:244889543-244889565 GCGCCACTGTACTCCAGTGTGGG - Intergenic
1063426759 10:5956420-5956442 CGTCCACTGTCCTGCTGTGTGGG - Exonic
1064005078 10:11692943-11692965 GTGCCACTGTACTCCAGTCCGGG - Intergenic
1067052150 10:43027840-43027862 CAGCCACTTTCCTGCTGTGCTGG - Intergenic
1069229648 10:65993776-65993798 GTGCCACTGTACTGCAGCCCAGG - Intronic
1069862963 10:71482606-71482628 GGGGCACTGGACTGCTGGGCAGG + Intronic
1073073768 10:100810629-100810651 TGACCACTGTACTTCTGAGCAGG - Intronic
1073606491 10:104900849-104900871 GTGCCACTGTACTCCAGTGTGGG + Intronic
1074489237 10:113924137-113924159 GAGCCACTGTACTCCTGTCTGGG + Intergenic
1078059816 11:8035961-8035983 GGGCTTCTGTTCTGCTGAGCAGG + Intronic
1078106599 11:8361780-8361802 ATGCCACTGTGCTGCTGTGTGGG - Intergenic
1078111127 11:8393550-8393572 GGGCCCCTGTGCTGCTTTGTGGG - Intronic
1078239699 11:9520077-9520099 GGGCCACTGCACTGCAGTCTGGG - Intronic
1078248131 11:9595047-9595069 GGGCCACTGTACTCCAGTCTGGG - Intergenic
1078767455 11:14312460-14312482 GGGCCACTGCACTTCAGTGCGGG - Intronic
1079935759 11:26614285-26614307 CAGCCACTTTCCTGCTGTGCAGG + Intronic
1080757154 11:35212864-35212886 GCGCCACTGTACTACAGTGTGGG - Intronic
1081306191 11:41514931-41514953 GGGCCACTGCACTCCAGTCCGGG + Intergenic
1083815630 11:65130877-65130899 GGGCCTGTGCCCTGCTGTGCAGG + Intronic
1084184920 11:67466503-67466525 GGGCCAGTGTACAGCGGTGCTGG + Intronic
1084271627 11:68032305-68032327 CTGCCACTGCACTGCTGTGGAGG - Exonic
1084293405 11:68192351-68192373 GGGGCACTGTATTCCTGAGCAGG - Intronic
1084911673 11:72394781-72394803 GGGGCACGGTGCTGCGGTGCTGG + Intronic
1085043403 11:73340040-73340062 GGGCCACGGTACCCCTATGCAGG - Intronic
1086837323 11:91640925-91640947 GGGCCCCCGTAGTGGTGTGCTGG + Intergenic
1087400187 11:97655257-97655279 GCGCCACTGTACTCCAGTGTCGG + Intergenic
1088075306 11:105841419-105841441 GGCCCACAGTCCTGCTGTGAAGG - Intronic
1088971817 11:114780584-114780606 GGGCCACTTCCCTGCTGGGCTGG - Intergenic
1089695869 11:120216026-120216048 GGGGAACTGTACAGCTGTGTGGG + Intronic
1091152628 11:133342943-133342965 GTGCCACTGCACTGCAGTGTGGG - Intronic
1091732268 12:2890189-2890211 GGGCCACTGCACTGCAGTCTGGG + Intronic
1092392539 12:8093678-8093700 GTGCCACTGTACTCCAGTGTGGG + Intronic
1093171732 12:15868654-15868676 GGGCCACTGTACTACAGTCTGGG + Intronic
1093827717 12:23714576-23714598 GCGCCACTGTACTCCAGTGCGGG + Intronic
1095949180 12:47772632-47772654 GCGCCACTGTACTCCTGCCCGGG + Intronic
1096247410 12:50000054-50000076 GGGCCACTGTACTCCAGCGTGGG - Intronic
1101634313 12:106525243-106525265 GGGAAACAGTACTGCTGAGCAGG + Intronic
1101895232 12:108751425-108751447 GCGCCACTGTACTCCAGTGTGGG + Intergenic
1103524076 12:121555967-121555989 GTGCCACTGTACTCCAGTGTAGG - Intronic
1104969357 12:132524211-132524233 GGGCTACTGTGCAGCTGAGCAGG + Intronic
1105892640 13:24692551-24692573 GGGCCACTGTCATCCTGTTCTGG - Exonic
1111744176 13:92244993-92245015 GGGCCACTGCACTCCAGTCCTGG + Intronic
1112210441 13:97371884-97371906 AGGCCACACAACTGCTGTGCTGG - Intronic
1113534165 13:111050912-111050934 GGTCATCTGTCCTGCTGTGCAGG + Intergenic
1114699178 14:24659898-24659920 GTGCCACTGCACTGCAGTCCGGG + Intergenic
1115470587 14:33764760-33764782 GGCCCATTGTACTACTGTGGAGG - Intronic
1116819938 14:49618072-49618094 GTGCCACTGCACTCCAGTGCGGG + Intergenic
1116948100 14:50854850-50854872 GGTCCACTGTGCTGCAGGGCAGG + Intergenic
1120744445 14:88141072-88141094 GGGCCTCTGGAGTGCTGTCCCGG + Intergenic
1120921439 14:89759331-89759353 GGGCCACTGCTCTGCTGGGCAGG - Intergenic
1121065198 14:90957105-90957127 GTGCCACTGTACTTCAGTGTGGG - Intronic
1122384722 14:101336564-101336586 GGGCCAATGTCCACCTGTGCAGG + Intergenic
1122515127 14:102302456-102302478 GGGCCACTGTACTGCAGCCTGGG - Intronic
1124655256 15:31502045-31502067 GGGCTCCTGTACACCTGTGCAGG - Intronic
1125092432 15:35810139-35810161 GGGCTGATTTACTGCTGTGCTGG - Intergenic
1126574345 15:50182682-50182704 GGGCCACTTGATTGCTGCGCCGG - Exonic
1127345809 15:58096821-58096843 GGCCCACAGTACTGCAGGGCTGG + Intronic
1128082556 15:64865166-64865188 GAGCCACTGTCCTCCTCTGCTGG - Exonic
1130189752 15:81722411-81722433 AGGCCACTGTACTGTTTTCCTGG - Intergenic
1130987011 15:88851199-88851221 GGGTAACTGTACTGGTGTGGGGG - Intronic
1132806360 16:1776902-1776924 GGGCCCCTCTGCTGCTGTGCTGG - Exonic
1133127407 16:3655817-3655839 GGGCCACAGTGGTGCTGAGCAGG - Intronic
1133817045 16:9205707-9205729 GGGACATTGAACTGCTGTGAAGG - Intergenic
1135863393 16:26078021-26078043 GTGCCACTGCACTGCAGTGTGGG + Intronic
1136139808 16:28281420-28281442 GGGGCACTGTCCTGGTGTCCCGG - Intergenic
1136567854 16:31080681-31080703 GAGCCACTGTCCTGGGGTGCAGG + Exonic
1139570678 16:67809904-67809926 GGGCCACTGCACTCCAGTCCGGG + Intronic
1139746084 16:69075807-69075829 GAGCCACTGTACTCCAGTCCGGG - Intronic
1141065229 16:80908699-80908721 GAGCCACTGCACTCCTGGGCAGG + Intergenic
1141575244 16:84959281-84959303 GGGCCCCTGGAGTGCAGTGCTGG + Intergenic
1142549317 17:728257-728279 GTGCCACTGTACTGCAGTCTGGG - Intergenic
1143167472 17:4904237-4904259 GTGCCACTGTACTCCTGTCTGGG - Intergenic
1144650819 17:17005715-17005737 GGGCCACTGGAGAGCTGGGCGGG + Intergenic
1144713563 17:17419189-17419211 GGGCCACTGTACTCCAGTCTGGG + Intergenic
1147895391 17:43747673-43747695 GTGCCACTGTACTGCAGTCTGGG + Intergenic
1148890041 17:50800669-50800691 GGGCCACTTGTCTGCTCTGCGGG - Intergenic
1149480117 17:56996560-56996582 GGGCCACTGCACTACAGTGTGGG - Intronic
1151352958 17:73542529-73542551 GGGCCACTGTGCTGCTTACCAGG - Intronic
1152797142 17:82314071-82314093 AGGCCACTGTCCTGGTGTCCAGG - Intergenic
1154311464 18:13270028-13270050 GTGTCACTGGACCGCTGTGCTGG + Intronic
1154356251 18:13624836-13624858 GGCTCCCTGTGCTGCTGTGCAGG + Intronic
1155083807 18:22435596-22435618 GGAGCACTGTACTGATGAGCTGG - Intergenic
1157912348 18:51628769-51628791 GGTCAACTGTACAGCTTTGCAGG + Intergenic
1159129450 18:64264382-64264404 GGGCCCCTGCACAGCTGTGGTGG + Intergenic
1160477603 18:79206928-79206950 GGGTCACTGTCTTCCTGTGCAGG - Exonic
1161668613 19:5591697-5591719 GGGCCACTGTACTGCTGTGCAGG - Intronic
1162827191 19:13260389-13260411 GGGCCACTGTACTCCAGTCTGGG - Intronic
1163321844 19:16579237-16579259 GGTCAGCTGTACTGCTGTACAGG - Intronic
1164573914 19:29394255-29394277 GGGCCAGTGTTCTGCTTAGCAGG - Intergenic
1165937022 19:39395557-39395579 GGGCCACAGGACCGGTGTGCTGG + Intronic
1166813049 19:45525653-45525675 GGGCCACTGCACTGCAGTCTGGG + Intronic
1167140878 19:47649992-47650014 GTGCCACTGTACTCCAGTTCGGG - Intronic
1167470211 19:49671593-49671615 GCGCCACTGTACTCCAGTGTGGG + Intronic
1168209760 19:54881836-54881858 GGGCCACTGCACTGCAGCGTGGG + Intronic
925127961 2:1475464-1475486 GGGCCACTGTACTCCTGCCTGGG - Intronic
925219857 2:2129861-2129883 GGGCCACTGTACTCCTGCCTGGG + Intronic
925414029 2:3656979-3657001 GGGGCACTGCACTGCTGTGGCGG + Intergenic
925466410 2:4110512-4110534 GGGCCACTGCACTGCTTGGTTGG + Intergenic
925617321 2:5756026-5756048 AGCCCACTGTACAGCTGTGAGGG - Intergenic
925868330 2:8248029-8248051 GGCCCCCTCTCCTGCTGTGCAGG + Intergenic
925889357 2:8421180-8421202 GGGCCAAGGTGCTGCTATGCAGG - Intergenic
926482363 2:13415048-13415070 GGGGCACTGCACTGCAGTGATGG + Intergenic
928553014 2:32392663-32392685 GGGCCACTGTACTCCAGCGTGGG - Intronic
929417343 2:41756904-41756926 GGGACACTGAACTACAGTGCAGG - Intergenic
929593215 2:43160161-43160183 GTGCCACTGCACTGCAGTGTGGG - Intergenic
931745770 2:65290813-65290835 GGGCCACTTTACTCTTGTGAGGG - Intergenic
932084618 2:68746963-68746985 GGGCCACTGTACTCCAGCCCAGG + Intronic
932410976 2:71547594-71547616 GGGCCACTGTGCTCCAGTGTGGG + Intronic
933664704 2:84955520-84955542 GGGCCACTGAACTCCAGTGTGGG + Intergenic
934787912 2:97028509-97028531 GGGCCACTGGACTTCTGTCTGGG + Intergenic
936508068 2:113123989-113124011 GGGACACTGCACTGCTGTAAGGG - Intronic
936696738 2:114959099-114959121 GGGCCACTGTACTCCAGCCCGGG - Intronic
936785280 2:116087309-116087331 GGGCCCTTGTTCTGCTCTGCAGG + Intergenic
937331044 2:121030263-121030285 GGGACTCTTTACTGCTGTGGAGG + Intergenic
937952176 2:127397171-127397193 GTGCCACTGTACTCCAGTCCGGG + Intergenic
938125431 2:128667589-128667611 GGGTCACTGTGCTGCAGTGTGGG + Intergenic
941173315 2:162165769-162165791 CGGCCACTGTGGTGCTTTGCAGG + Intergenic
947215714 2:227748131-227748153 GTGCCACTGTACTGCAGCGTGGG + Intergenic
948714486 2:239851984-239852006 GGGTGACTGCTCTGCTGTGCAGG + Intergenic
1170508168 20:17050257-17050279 GAGCCTCTGCACCGCTGTGCAGG - Intergenic
1172512069 20:35507799-35507821 GGACCCCAGTTCTGCTGTGCTGG - Exonic
1174319562 20:49730450-49730472 GCGCCACTGTACTCCAGTGAGGG + Intergenic
1174323166 20:49758439-49758461 ATGCCACTGTACTCCTGTGATGG + Intergenic
1175260946 20:57673775-57673797 GAGCCTCTGTACTGCTCTGGAGG - Intronic
1176203520 20:63875530-63875552 GGGCAACAGCACTGCTGTGGGGG - Intronic
1178828030 21:36032492-36032514 GGGTCACTGTCCTACTGTGGGGG + Intergenic
1178828055 21:36032590-36032612 GGACCACTGTCCTACTGTGGGGG + Intergenic
1179678469 21:43001004-43001026 GAGCCACTGCACTGGGGTGCAGG + Intronic
1180212961 21:46306628-46306650 GTGCCACTGTACTGCAGTCTGGG - Intronic
1180997109 22:19971072-19971094 GGGCCACTGGGCTGCTGGACTGG + Intronic
1182009910 22:26992103-26992125 TGGCCACTCCAGTGCTGTGCCGG + Intergenic
1182384685 22:29927981-29928003 ATGCCACTGTACTTCTGTGGGGG - Intronic
1183313852 22:37126700-37126722 GGGTCACTGTCCTGCTGGGGTGG + Exonic
1184955342 22:47882337-47882359 GCGCCACTGCACTCCAGTGCAGG - Intergenic
949799919 3:7892547-7892569 GGGCAACTCTAATGGTGTGCTGG - Intergenic
950109960 3:10412592-10412614 GGGCCACTGTCCTCCTGGGGTGG - Intronic
950505055 3:13389384-13389406 GGGCCACTGTACAGCTCAGTGGG - Intronic
950573138 3:13814445-13814467 GGACCACAGTAATTCTGTGCTGG + Intergenic
950896882 3:16460814-16460836 GGGCCACTTCACAGCTGTGGTGG - Intronic
953140891 3:40228228-40228250 GGGCCACTGTGTGGCTTTGCTGG + Intronic
956673341 3:71711938-71711960 GGGCCACTGTACTCCAGCCCGGG + Intronic
956964346 3:74441631-74441653 GGGCAACTGTGCTGATGTGGAGG + Intronic
960462364 3:117952038-117952060 GTGCCACTGTACTCCAGTGTGGG - Intergenic
962793933 3:138834818-138834840 GGGCGAGTGTAGTGCTGCGCGGG - Intronic
967100350 3:186210713-186210735 GCCCCACTGGACTGCAGTGCGGG + Intronic
968340737 3:197953331-197953353 GGGCCACTGTACTGCAGCCTGGG + Intronic
968783513 4:2601075-2601097 GTGCCACTGTACTGCAGTCTGGG + Intronic
973909501 4:55565241-55565263 GGGCCACAGTACTGCTTGGTGGG - Intronic
975558803 4:75690612-75690634 GCGCCACTGTACTCCAGTGGGGG - Intronic
980098740 4:128520248-128520270 GTGCCACTGCACTCCTGTCCAGG - Intergenic
980556975 4:134420260-134420282 AGGCCATTGTATTGCTGTGTAGG - Intergenic
981275027 4:142889172-142889194 GTGCCACTGTACTCCGGTGTGGG - Intergenic
982425011 4:155247760-155247782 GGGCCACTGCACTGCAGCCCAGG + Intergenic
983322184 4:166209887-166209909 GTGCCACTGTACTCCAGTCCAGG - Intergenic
984342355 4:178473199-178473221 GGGCCACTGCACTCCAGTGTGGG - Intergenic
985850918 5:2388508-2388530 GGAACACAGAACTGCTGTGCTGG - Intergenic
987173771 5:15285985-15286007 GGGTGACTGAAGTGCTGTGCAGG + Intergenic
991016195 5:61935161-61935183 AGGTCACTGTCCAGCTGTGCTGG - Intergenic
993064474 5:83080481-83080503 GTGCCACTGTACTCCTGCGTGGG + Intronic
993092965 5:83449884-83449906 GGTCCACTGTAACCCTGTGCTGG + Intergenic
994440967 5:99802142-99802164 GGGCCACTGTACTGCAGCCTGGG - Intergenic
994748792 5:103712137-103712159 GGGCCACTGTACTCCAGTCTGGG + Intergenic
994814524 5:104568373-104568395 GCGCCACTGTACTCCAGTGTGGG + Intergenic
995164780 5:109026719-109026741 GGGCCACTGTACTCCAGCTCAGG - Intronic
998013823 5:138716615-138716637 GGCTCACTGTCCTGCTCTGCAGG - Intronic
999460134 5:151750687-151750709 GTGCCACTGCACTGCAGTGGGGG - Intronic
1000043040 5:157499505-157499527 GGACCACAGGACTGCTCTGCTGG - Intronic
1000360869 5:160446243-160446265 GTGCCACTGTACTCCTGTGTGGG - Intergenic
1002402745 5:179000837-179000859 GGGCCACTGTACTCCAGTCTGGG - Intergenic
1002514901 5:179750501-179750523 GGGCCACTGTACTCCTGCCTGGG - Intronic
1002796077 6:471854-471876 GGGCTATGGTGCTGCTGTGCAGG + Intergenic
1004151162 6:13121174-13121196 GGCACACTGTACTTCTTTGCTGG - Intronic
1006246722 6:32743529-32743551 GGGCCAGTGTCCTGCTCAGCAGG - Intronic
1006690685 6:35882357-35882379 GTGCCACTGTACTCCAGTGTGGG - Intronic
1007559403 6:42793809-42793831 GGGCCACTGTACTCCAGCCCGGG - Intronic
1010300199 6:74251365-74251387 GGGCCACTGTACTCCAGTCTGGG + Intergenic
1017679971 6:156853777-156853799 GTGCCACTGTACTCCAGTCCGGG - Intronic
1019635125 7:2071379-2071401 GGGCCAATGTACTGGCGTCCAGG + Intronic
1024254889 7:47533173-47533195 GCGCCACTGTACTCCAGTGTGGG - Intronic
1024930694 7:54664533-54664555 GGGCCGCTGTGCGGCTGCGCGGG - Intergenic
1026204115 7:68240646-68240668 TTGCCTCTGTACTGCTGTTCAGG + Intergenic
1027480367 7:78687925-78687947 GGGCCACTGTACTCCAGTCTGGG + Intronic
1029008409 7:97233302-97233324 GGCCATGTGTACTGCTGTGCAGG + Intergenic
1030746711 7:113174410-113174432 GGGCAACTCTCCTGCAGTGCTGG - Intergenic
1032498414 7:132380359-132380381 GGGCCACAGTATTGCAGTGGAGG - Intronic
1033320322 7:140333251-140333273 GTGCCACTGTACTCCAGTGTGGG + Intronic
1035727147 8:1831716-1831738 CGGCTCATGTACTGCTGTGCGGG + Intronic
1037536742 8:19831645-19831667 GGGCCACTGTACTGCCAGCCTGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1038588289 8:28811462-28811484 GCGCCACCGTACTCCAGTGCGGG - Intronic
1038755240 8:30334638-30334660 ACGCCACTGTACTGCAGTCCGGG - Intergenic
1043457737 8:80429166-80429188 GGAAGACTGTACTTCTGTGCAGG + Intergenic
1043837061 8:85060345-85060367 GGGCAGCTTTCCTGCTGTGCTGG + Intergenic
1048317653 8:133374306-133374328 GGCCCAGTGTCCTGCTCTGCAGG + Intergenic
1048469855 8:134696297-134696319 GGAACGCTGTACTGCTTTGCAGG - Intronic
1049494381 8:142922827-142922849 GGGACTCTGCAGTGCTGTGCGGG - Intergenic
1049698679 8:143996498-143996520 GGGCCACTGTTCTGCAGCTCTGG + Intronic
1049748951 8:144274576-144274598 GAGCCACTGGCCGGCTGTGCTGG + Intronic
1057016580 9:91657661-91657683 GGGCCCCTGTGCTGCTGGGTGGG - Intronic
1061045419 9:128162410-128162432 GGGACACTGTGTTGCTGAGCAGG + Intronic
1061911166 9:133725631-133725653 GTGCCACTGTACTCCAGTGTGGG + Intronic
1189204374 X:39225301-39225323 GGGCTACTGAAATGGTGTGCTGG - Intergenic
1189448963 X:41109068-41109090 GAGCTACTGTCCTGCTGAGCTGG + Intronic
1190590926 X:51999995-52000017 AGGCCACTGTACTCCAGTGTGGG - Intergenic
1192492892 X:71591680-71591702 GTGCCACTGCACTGCAGTGTGGG - Intronic
1192493143 X:71593891-71593913 GTGCCACTGCACTGCAGTGTGGG - Intronic
1194877457 X:99207692-99207714 TGGTCACTGCAGTGCTGTGCTGG - Intergenic
1195051921 X:101104804-101104826 GTGCCACTGTACTCCAGTGTGGG + Intronic
1196431547 X:115632421-115632443 GGGCCTCTGTACTGCAGCCCAGG + Intronic
1197232499 X:124019893-124019915 GCGCCACTGCACTCCAGTGCGGG + Intronic
1201111834 Y:10805093-10805115 GGGCCACTGCACTGCAGTCTGGG - Intergenic
1201112009 Y:10806389-10806411 GGGCCACTGCACTCCTGTCTGGG - Intergenic
1201113059 Y:10814592-10814614 GGGCCACTGCACTCCTGTCTTGG - Intergenic
1201571655 Y:15421836-15421858 GGGCCACAGAACTTCTGTGAAGG + Intergenic
1201711947 Y:17002141-17002163 GGTTCACTTTATTGCTGTGCAGG - Intergenic