ID: 1161672824

View in Genome Browser
Species Human (GRCh38)
Location 19:5623600-5623622
Sequence GGCCAGGAGAACCACAAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161672815_1161672824 21 Left 1161672815 19:5623556-5623578 CCTTGGCCGGCTGGGCCTGGGTT 0: 1
1: 0
2: 4
3: 31
4: 260
Right 1161672824 19:5623600-5623622 GGCCAGGAGAACCACAAAAACGG 0: 1
1: 0
2: 2
3: 22
4: 237
1161672817_1161672824 6 Left 1161672817 19:5623571-5623593 CCTGGGTTCAAATCCTAACGCCG 0: 1
1: 1
2: 10
3: 200
4: 1052
Right 1161672824 19:5623600-5623622 GGCCAGGAGAACCACAAAAACGG 0: 1
1: 0
2: 2
3: 22
4: 237
1161672821_1161672824 -7 Left 1161672821 19:5623584-5623606 CCTAACGCCGCAATGGGGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 56
Right 1161672824 19:5623600-5623622 GGCCAGGAGAACCACAAAAACGG 0: 1
1: 0
2: 2
3: 22
4: 237
1161672816_1161672824 15 Left 1161672816 19:5623562-5623584 CCGGCTGGGCCTGGGTTCAAATC 0: 1
1: 1
2: 12
3: 53
4: 300
Right 1161672824 19:5623600-5623622 GGCCAGGAGAACCACAAAAACGG 0: 1
1: 0
2: 2
3: 22
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161672824 Original CRISPR GGCCAGGAGAACCACAAAAA CGG Intronic
900073594 1:793645-793667 AGCCAGGAGAACCACCACAGAGG - Intergenic
900320188 1:2079759-2079781 GGCCAGGACAAACACAAAAAGGG - Intronic
901281577 1:8040386-8040408 GGCCAGGAGAAAAAAAAAAAAGG - Intergenic
901357191 1:8661277-8661299 GGGCAGGAATAGCACAAAAAGGG + Intronic
901988392 1:13093050-13093072 GAACTGCAGAACCACAAAAAGGG + Intergenic
901993420 1:13133717-13133739 GAACTGCAGAACCACAAAAAGGG - Intergenic
902966488 1:20008306-20008328 GGGCAGGTGAACCCCAAAATTGG + Intergenic
904006309 1:27365046-27365068 TGCCAGGGGAACCCTAAAAAGGG - Intronic
904065833 1:27750040-27750062 GGCCTGGAGGAACAGAAAAATGG - Intronic
904633837 1:31864253-31864275 TCCCAGGAGTACCACAAGAAAGG - Intergenic
904783851 1:32970859-32970881 GGCCAGGAGACCCAGAAAATAGG - Intergenic
907043026 1:51280430-51280452 GGCCAGGAGAAGGGCAACAAAGG + Intergenic
907940680 1:59084290-59084312 TGCCAGGAGCCCCACAGAAAAGG - Intergenic
908460451 1:64343941-64343963 GTCCACGAGACCCATAAAAAAGG + Intergenic
908628551 1:66075256-66075278 GGGCAGGTGAACCCCAAAATTGG - Intronic
908930446 1:69311840-69311862 GGCCTGGAGAACAGCAAAGATGG + Intergenic
910362596 1:86429023-86429045 GGCCAGGTGATGCACTAAAATGG + Intronic
913207335 1:116552207-116552229 GGCCAGGAGAAGGAGAAAGATGG + Intronic
914648141 1:149673337-149673359 GGGCAGGCGAACCTCAAAACTGG + Intergenic
915259345 1:154665165-154665187 GGACAGGAGAGCCCCAAAACTGG - Intergenic
915559993 1:156681557-156681579 GGCCAAGAGGACCCCACAAACGG + Intergenic
915921455 1:159978710-159978732 GGCAAGGTGAACCTCAAAAATGG + Intergenic
917582285 1:176391404-176391426 AGCCTGGAGAACAGCAAAAATGG + Intergenic
918121803 1:181546947-181546969 GGCCAGGAGGACGACATCAAAGG - Intronic
919188544 1:194185819-194185841 GGCCAGAAGATCAACAAAATAGG - Intergenic
920059307 1:203216713-203216735 GCCCAGGAGACCCAGAAAAAAGG + Exonic
920678423 1:208054807-208054829 GGCATGGGGAACCACAGAAATGG - Intronic
920702175 1:208226200-208226222 GGGCAGGAGAAGCAAAAAAAGGG - Intronic
921011718 1:211148348-211148370 GTCCAGGAGAGCAACATAAAGGG + Intergenic
1063698467 10:8360866-8360888 GTCCAGGTCAACCACAAAATAGG - Intergenic
1064007603 10:11710927-11710949 GGCTAGGGTAACCACAAGAATGG + Intergenic
1064461756 10:15541321-15541343 GGGCAGGTGAACCCCAAAATTGG - Intronic
1065478957 10:26172796-26172818 GGCCAGTAGAATTAGAAAAATGG + Intronic
1067815524 10:49472999-49473021 GGTCAGAAGAAACACAAATATGG + Exonic
1069170420 10:65221258-65221280 GGAGAGGAAAACCACAATAATGG + Intergenic
1069832693 10:71290886-71290908 GGACAGGAGGACCACATAAGGGG - Intronic
1070449860 10:76547329-76547351 GGCAAGAAGAACCCCAAAATGGG + Intronic
1070956631 10:80468133-80468155 GGCCAGGAAAGGCACATAAAGGG - Intronic
1074477847 10:113788901-113788923 GCCCAGAAGAATCACAAAAGTGG + Intergenic
1074794400 10:116926853-116926875 GGCATGTGGAACCACAAAAAAGG + Intronic
1075527523 10:123199153-123199175 GCTCAGGGGACCCACAAAAATGG - Intergenic
1075858418 10:125651654-125651676 GGGCAGGAGAAAGACATAAAGGG + Intronic
1079629919 11:22661567-22661589 GATCAAGAGAACCACAAAGAAGG + Intronic
1080164800 11:29224305-29224327 AGCCTGGAGAACAACAAACATGG + Intergenic
1080451774 11:32384052-32384074 GTGCATGAGAACCACAAAAAGGG - Intergenic
1080875685 11:36272208-36272230 GGCCAGGCCAACCAGAAATACGG + Intergenic
1080882314 11:36333973-36333995 GTGCAGGAGCAGCACAAAAAGGG - Intronic
1085648145 11:78241385-78241407 GGACACAAGAAACACAAAAAAGG + Intronic
1086617202 11:88835917-88835939 GGAGAGGAGAACCAGAACAAAGG - Intronic
1089798071 11:120999387-120999409 TGCCAGGAGACCCACAACCAAGG + Intergenic
1092523123 12:9293477-9293499 AGCCAGGAAAAACAGAAAAAAGG - Intergenic
1092544168 12:9438422-9438444 AGCCAGGAAAAACAGAAAAAAGG + Intergenic
1093042443 12:14398822-14398844 GGCAAATAGTACCACAAAAAAGG - Intronic
1094129409 12:27059392-27059414 GGCCAGGAGTTCAGCAAAAATGG - Intronic
1095158888 12:38892103-38892125 GGCAAGGAGAGCCACAAATGGGG + Intronic
1096449090 12:51722066-51722088 GGCCAGGAAGAACACAGAAATGG - Intronic
1099759867 12:86905647-86905669 GGCCAACAGAAGCTCAAAAAAGG + Intergenic
1101593039 12:106139652-106139674 GTCCAGGAGAACCCCAAGAGCGG + Exonic
1103451560 12:121032843-121032865 GGCCTGGGTAACCACAGAAAGGG - Intronic
1104093044 12:125531898-125531920 CGCCAGGAGAGCCACAAGTAGGG - Intronic
1104756025 12:131269772-131269794 GGGCAGGAGAGCCCCAAAAGTGG + Intergenic
1105240817 13:18608923-18608945 CGCCTGCAGAACCAAAAAAACGG - Intergenic
1105462758 13:20607386-20607408 GGACAGGAGGACCACCCAAATGG - Intronic
1106461010 13:29968945-29968967 CCCCAGGAGAACCAGAAAATGGG + Intergenic
1109710757 13:66156334-66156356 AACAAGGAGAACCATAAAAAAGG + Intergenic
1115102215 14:29716106-29716128 GGCAATGAAAACCACACAAAGGG - Intronic
1117058512 14:51936983-51937005 GGGGAGGAGAACCAAGAAAAGGG - Intronic
1119719071 14:76879067-76879089 GGCCATTAGAAATACAAAAATGG + Intergenic
1119746275 14:77046452-77046474 GGCCAGGAGAACCTCAGGAGAGG + Intergenic
1121859279 14:97301275-97301297 GGACATGCGAGCCACAAAAATGG + Intergenic
1122043599 14:99007743-99007765 GGGCAGGAGGACAACAAAATGGG + Intergenic
1122589927 14:102841341-102841363 TGGGAGGAGAACCACCAAAAAGG + Intronic
1123490539 15:20776217-20776239 CGCCTGCAGAACCAAAAAAACGG + Intergenic
1123547041 15:21345304-21345326 CGCCTGCAGAACCAAAAAAACGG + Intergenic
1124787996 15:32699712-32699734 GGACAGGAGAGCCAGGAAAATGG + Intergenic
1125922717 15:43535089-43535111 TGCCAGGAGAACCATGACAATGG - Exonic
1127207608 15:56736599-56736621 AGTCAGGAGAACCAAAAGAACGG - Intronic
1130198686 15:81805286-81805308 GGCAAGGAGAAGCCCAGAAATGG + Intergenic
1130240973 15:82190666-82190688 GGCAAGTAGAATCACAATAAGGG + Intronic
1130641444 15:85679431-85679453 GGCAGGGAGAACCAAAAGAAGGG + Intronic
1202955372 15_KI270727v1_random:72520-72542 CGCCTGCAGAACCAAAAAAACGG + Intergenic
1136778275 16:32882891-32882913 AGTCAGGAGCACCACAAACAAGG - Intergenic
1136892345 16:33978623-33978645 AGTCAGGAGCACCACAAACAAGG + Intergenic
1136987689 16:35125842-35125864 GGCCAGGAGAAAAATAAACATGG + Intergenic
1138678305 16:58667388-58667410 TGCCAAGAGATCCACAAAGATGG + Exonic
1138871686 16:60895735-60895757 GGCCAGAAGAACTAGCAAAAAGG + Intergenic
1139489146 16:67277436-67277458 TGCCAGGAGAGCCACAGAGATGG + Intergenic
1140628695 16:76825853-76825875 GGCCATGAGAAAAACAGAAAAGG + Intergenic
1140767328 16:78172590-78172612 GGCCAGGAAAAAAAAAAAAAAGG - Intronic
1141305558 16:82860085-82860107 GGAGAGGAGAGCCAGAAAAATGG - Intronic
1142142357 16:88478296-88478318 AGCCAGGGCAACCACAAAAGCGG - Intronic
1142205255 16:88779850-88779872 GGCCAGGAGACCCGCAACACAGG - Intronic
1203080697 16_KI270728v1_random:1145000-1145022 AGTCAGGAGCACCACAAACAAGG - Intergenic
1146480609 17:33202148-33202170 GGCCAGGTGAGCCTCAAAATTGG - Intronic
1147312160 17:39601818-39601840 GGCCAGGAGAGCCACATGGAGGG + Intergenic
1148351345 17:46944011-46944033 GGCCAGTGGAACCACACTAATGG - Intronic
1152442764 17:80319055-80319077 GGCCAGGAGAAGCTTAAAATTGG + Intronic
1154427250 18:14281401-14281423 TGCCAGGAAAACAACACAAATGG - Intergenic
1154429971 18:14300936-14300958 TGCCAGGAAAACAACACAAATGG - Intergenic
1154448152 18:14450984-14451006 CGCCTGCAGAACCAAAAAAACGG + Intergenic
1156160470 18:34351995-34352017 GGACAGGAGAGCCCCAAAATTGG - Intergenic
1157874546 18:51260254-51260276 GGCCAGAAGTACCAGGAAAATGG - Intergenic
1158022364 18:52858542-52858564 TGCCAGGAGAAGCTCAAAAAAGG - Intronic
1158804728 18:60957054-60957076 GGCCAGAGGAACCGGAAAAAAGG + Intergenic
1158888655 18:61852937-61852959 GACCAGGAGAACAATAAAAAGGG - Intronic
1159533109 18:69680447-69680469 GGCCAAGAGGAACACAGAAAAGG - Intronic
1159643685 18:70892349-70892371 GGCCAGCAGCACCAGAAAGAGGG + Intergenic
1160064374 18:75561489-75561511 GTCCAGGAGAATCCCAGAAAAGG - Intergenic
1160915076 19:1492577-1492599 GGCTGGGAGCACCACACAAACGG - Intronic
1161672824 19:5623600-5623622 GGCCAGGAGAACCACAAAAACGG + Intronic
1162001925 19:7750236-7750258 GGACAGGTGAACCCCAAAATTGG - Intergenic
1164065348 19:21709797-21709819 GAACAGAAGAACCACAAAAATGG + Intergenic
1164885290 19:31773483-31773505 GCCTAGGAGAACCAGAAACAAGG + Intergenic
1166088514 19:40492776-40492798 GGCCAGGACATCCACAATTAGGG - Intronic
1167148774 19:47697100-47697122 GGGCAGGAGAATCACATGAACGG - Intronic
926115785 2:10212374-10212396 GGCCAGGCGAGCCCCAAAATTGG - Intergenic
926412021 2:12614557-12614579 GGGCAGGTGAACCCCAAAACTGG + Intergenic
926542321 2:14196726-14196748 TGCAAGAAAAACCACAAAAATGG + Intergenic
926543945 2:14215468-14215490 GCCCAGGAACACTACAAAAATGG - Intergenic
927273945 2:21245647-21245669 GCCCAGGGGAATCACAACAAGGG - Intergenic
927383024 2:22500602-22500624 GGGCAGAAGAACCACAAATGAGG + Intergenic
928205948 2:29283507-29283529 GGCGAGAAGACCCAGAAAAAGGG + Intronic
929833081 2:45365660-45365682 CTCTAGGGGAACCACAAAAAGGG - Intergenic
931086536 2:58837354-58837376 GACCAGGAGAAGAAAAAAAATGG + Intergenic
931108895 2:59088729-59088751 GGGCAGGAGAAGCAAATAAAGGG - Intergenic
931830200 2:66043116-66043138 GAACAGGAGAAGGACAAAAAGGG + Intergenic
932565933 2:72909351-72909373 GGCCAGCAGAACAACAAAATAGG + Intergenic
932658342 2:73629901-73629923 GGCCTGGTGAAGCTCAAAAATGG + Intergenic
932664968 2:73689949-73689971 GGCCTGGTGAAGCTCAAAAATGG + Intergenic
933226039 2:79750709-79750731 GGGCAGAAGAACCACAACCAGGG + Intronic
933975826 2:87508572-87508594 GCCCAGGAGAACCAGGCAAAAGG - Intergenic
935625708 2:105170742-105170764 GGCCAGGTGACCCAGAAACATGG + Intergenic
935709728 2:105887485-105887507 GGCCTGGTGAATCACACAAAGGG + Intronic
936152635 2:110030076-110030098 GGCCAGAGGCACCACAGAAATGG + Intergenic
936192045 2:110341336-110341358 GGCCAGAGGCACCACAGAAATGG - Intergenic
936317998 2:111442241-111442263 GCCCAGGAGAACCAGGCAAAAGG + Intergenic
939598441 2:144157547-144157569 GCCCAGGAAAGCCAGAAAAAAGG + Intronic
940081479 2:149807762-149807784 AGGCAGGAGGACCACAAAAGGGG + Intergenic
945206892 2:207341998-207342020 GGCCTGGAGAACCACCTAGAGGG + Intergenic
946529630 2:220557796-220557818 GGTCTGGAGTATCACAAAAATGG + Intergenic
946704966 2:222449372-222449394 GGCCAGGTGAAAAACAAAAATGG + Intronic
947159200 2:227194526-227194548 GACCATGAGGACCACAGAAAGGG - Intronic
947520301 2:230840708-230840730 GGCCAAGAGAACCACCAAGCAGG + Intergenic
948719743 2:239891683-239891705 GGCAACGAGAACCACATATACGG + Intergenic
948939946 2:241190631-241190653 GCCCAGGAGAACCAGGAAGAGGG - Intronic
1170381559 20:15765343-15765365 GGCAAGGAGAACCAGAAGAATGG - Intronic
1170430076 20:16267694-16267716 GGCCAGTGGAGCCACAAGAATGG + Intergenic
1170731792 20:18982535-18982557 GGAAGGGAGAGCCACAAAAATGG + Intergenic
1170932585 20:20782169-20782191 TGCCAGAACAACAACAAAAAAGG - Intergenic
1173259969 20:41425206-41425228 GTTCAGGAGAACCTCAGAAATGG - Exonic
1173478750 20:43382807-43382829 GGCCACGGCAACCACAAAAGCGG - Intergenic
1173521825 20:43705590-43705612 AGGCAGGAGGATCACAAAAAAGG - Intronic
1174273988 20:49390255-49390277 TTCCAGGAGAACCACAAGAATGG - Intronic
1175200018 20:57270439-57270461 GGCCAGGGGAACCACAACTGGGG - Intergenic
1179930455 21:44568034-44568056 GGCCAGGACACCCCCAAAAGTGG + Intronic
1182495598 22:30705129-30705151 GGCCAGGAGAGCCACAGAGCAGG - Intronic
1184044036 22:41961136-41961158 GGAAAGGAGAAACACAAAGAGGG + Intergenic
949465467 3:4339122-4339144 GAACAGGAGAGCCACAGAAATGG - Intronic
950606377 3:14084848-14084870 GACCAGTAGAACCACTGAAATGG + Intergenic
950675459 3:14551611-14551633 GGACAGGAGAAGCACAGAGAAGG + Intergenic
950899497 3:16484510-16484532 AGACAGGAAAACCACAAAGATGG + Intronic
953612483 3:44458768-44458790 GGCCAGCAGAAAGACAGAAAAGG - Intronic
954475200 3:50737951-50737973 GGCCAAGAGGATCACAAATAAGG - Intronic
955610658 3:60753379-60753401 GTCCAGAACAATCACAAAAAGGG + Intronic
956120909 3:65964870-65964892 GGCCTGGACATCCACAAAAAGGG - Intronic
956450436 3:69369351-69369373 GGCCAGGAGAAAAGAAAAAAGGG + Intronic
957389531 3:79545996-79546018 GGCCAGGAGGAAGAGAAAAAGGG - Intronic
961115118 3:124322633-124322655 ACCCAGAAGAACCACACAAATGG + Intronic
962878152 3:139551905-139551927 GGGCAGGAGAAGCACAGAAAGGG + Intergenic
964217471 3:154302707-154302729 AGGCAGGAGAACCAGCAAAAGGG + Intronic
967781332 3:193443170-193443192 GGCCAGAAGAGCCAGGAAAAGGG + Intronic
969549453 4:7854947-7854969 GGCCAGGAGAACCAGAACTTAGG + Intronic
972556291 4:40184210-40184232 GACAAAGAAAACCACAAAAATGG + Intergenic
974569058 4:63620315-63620337 GGCCATGAGGACAACAAAGAAGG - Intergenic
979352174 4:119656901-119656923 GCCCAGGAAAAACAGAAAAAAGG - Intergenic
980410684 4:132414337-132414359 GGTCAGCAGCACCTCAAAAAAGG + Intergenic
980781785 4:137500285-137500307 GGCCAGGAGAAGGAAATAAAGGG + Intergenic
980889540 4:138799754-138799776 AGCCTGGAGTGCCACAAAAAGGG + Intergenic
981989407 4:150899148-150899170 GGCAACTACAACCACAAAAATGG + Intronic
983019666 4:162659882-162659904 TCCCAGGAAAACCACAATAAAGG - Intergenic
984388620 4:179097960-179097982 CTCCACTAGAACCACAAAAAAGG + Intergenic
984883192 4:184428333-184428355 GGCCAGGAGAAGCAAAAAAAAGG + Intronic
987401286 5:17479812-17479834 TGTCAGGAGAACCAGGAAAAGGG + Intergenic
989348130 5:40453255-40453277 GGGCTGGAGAACAACAAAGACGG + Intergenic
989791138 5:45403183-45403205 GGCCAAGTGAACCATAACAAAGG + Intronic
991258230 5:64638524-64638546 GGCCAGGAGAACTGCAAGTAAGG - Intergenic
992077247 5:73202958-73202980 GGACAGGAGAACCACTAGTAGGG - Intergenic
992583569 5:78208037-78208059 AGCCAGGAAAACCAAAAGAAAGG + Intronic
994241490 5:97426821-97426843 GCCAAGGAGAACAGCAAAAATGG + Intergenic
995024694 5:107406378-107406400 GGCCTGGAGAAGCACCAAGAAGG - Intronic
996113912 5:119597481-119597503 GACCAGGATAACAACAAAAATGG + Intronic
997649220 5:135503298-135503320 GCCCAGGAGAAAGAGAAAAATGG - Intergenic
1002702549 5:181135565-181135587 GGTCTGGAGAACAACAGAAAGGG + Intergenic
1003057941 6:2840397-2840419 GGTCAGCAGAAACAAAAAAAAGG - Exonic
1003151811 6:3558931-3558953 GTCCACAGGAACCACAAAAAGGG - Intergenic
1003225959 6:4205752-4205774 AGCCAGGAGAATCAAAACAAGGG - Intergenic
1003574721 6:7282283-7282305 AGGCAGGAGAACCACAGAGATGG + Exonic
1005051345 6:21686711-21686733 GGCCTGGTGAACCTCCAAAAGGG - Intergenic
1005276396 6:24223786-24223808 GGCCAGTGTAACCACCAAAATGG + Intronic
1007188565 6:39994361-39994383 GGAAAGCATAACCACAAAAAAGG - Intergenic
1007720257 6:43880915-43880937 GGAAAGGAAAACAACAAAAAGGG + Intergenic
1008625101 6:53307816-53307838 TGCCAGGAGTACAAAAAAAAAGG - Intronic
1010318685 6:74481147-74481169 GTCCAAGAAAACCACAAACAAGG + Intergenic
1014782446 6:125580037-125580059 GGGCAGAGGAACCACAAAATTGG - Intergenic
1017079802 6:150656756-150656778 GGCCAGCACAAACACAGAAATGG + Intronic
1017264512 6:152426793-152426815 AGGCAGGAGAACCAGAAGAATGG + Intronic
1017618422 6:156269949-156269971 GGCAAGGAGAATCACTGAAATGG - Intergenic
1021001242 7:15332956-15332978 GGCAGGGAGAAGCACAACAAAGG - Intronic
1022418635 7:30199454-30199476 GGCCAGAAGGACCACAAAGTAGG - Intergenic
1024219502 7:47276874-47276896 GGCAAGGAGCAGCACAAAGAGGG + Exonic
1025845069 7:65188730-65188752 TGCCAGGAGAAAAACAGAAAAGG - Intergenic
1025895345 7:65694758-65694780 TGCCAGGAGAAAAACAGAAAAGG - Intergenic
1026221409 7:68401027-68401049 GGCCATGAGCACCCCAAAAAAGG + Intergenic
1026679299 7:72453142-72453164 GGGCAGGTGAACCCCAAAATTGG + Intergenic
1027604072 7:80277816-80277838 AGTCAGGAGAACAACAAAATTGG + Intergenic
1027971011 7:85081778-85081800 GACCAGAAGATTCACAAAAATGG - Intronic
1030164409 7:106539277-106539299 AGCAAGAAGAACCAGAAAAATGG - Intergenic
1030190390 7:106804840-106804862 GGCCTGAGCAACCACAAAAATGG + Intergenic
1034282380 7:149863233-149863255 GGTCTGGAGAACCCCAACAATGG - Intronic
1036021435 8:4851392-4851414 AGCCAGGAAAAAAACAAAAAAGG - Intronic
1040450310 8:47539564-47539586 GGCCAGAAAAACCACCAAAAAGG - Intronic
1042066634 8:64884132-64884154 ACCCATGAAAACCACAAAAAGGG - Intergenic
1042429921 8:68693921-68693943 GGAAAGGGGTACCACAAAAAGGG + Intronic
1042865331 8:73351815-73351837 GGACAGGAGAACCACCAATGGGG - Intergenic
1043625042 8:82245815-82245837 GGCCAGGAAAATCATAAAAATGG - Intergenic
1044063068 8:87663465-87663487 GGCATGGACAACAACAAAAAAGG - Intergenic
1045377261 8:101586390-101586412 GGCAAGGAGAACCCCAGAGATGG - Intronic
1046347273 8:112947813-112947835 ATCCAGGAGAACCAGAAAATGGG - Exonic
1047772112 8:128037909-128037931 GGGAAGGAGAACCAGTAAAAGGG - Intergenic
1048041826 8:130737589-130737611 TGCAAGGAGAACTGCAAAAATGG + Intergenic
1050232225 9:3538727-3538749 GGCCAGGAGAAAGAAATAAAGGG - Intergenic
1051746634 9:20301003-20301025 TCCCAGGAAAACCACAAGAAAGG + Intergenic
1055657544 9:78466760-78466782 GGTCAGGAGAACAAAGAAAATGG - Intergenic
1058690712 9:107518128-107518150 TGGCAGGAGAACCGCAACAAGGG - Intergenic
1059054305 9:110962695-110962717 GGCCAGGAGAAAAGCAAAAGTGG - Intronic
1059332309 9:113543291-113543313 GGCCACTTGAACCCCAAAAATGG + Intronic
1060434783 9:123584075-123584097 AGGCAGGAGAAACACAAAGATGG - Intronic
1060727474 9:126016049-126016071 GGACAGGAGAACCACAACCACGG - Intergenic
1061245361 9:129398768-129398790 GGCCTGGAGAACCACAAACCAGG + Intergenic
1061739334 9:132688918-132688940 AGACAGGAGAATCACAGAAAGGG - Exonic
1062268677 9:135699151-135699173 GGCCCTGAGAACCCCAGAAAAGG + Intronic
1185776792 X:2809665-2809687 GACCAGGAGGACCACTAGAATGG - Intronic
1186475587 X:9854808-9854830 GGTCAGGAGAAACAGAAACACGG + Intronic
1187258413 X:17661973-17661995 GGCTAGGAGAGTCACAACAAAGG - Intronic
1187527230 X:20065196-20065218 GGAGAGGAGAAGCACAAAAATGG + Intronic
1190581570 X:51896206-51896228 GGCCAGGAGCAACCCAAAGATGG - Intronic
1190751563 X:53366452-53366474 AGCCAAGAGAATCACAGAAATGG - Intergenic
1190804020 X:53818131-53818153 AGCCAAGAGAATCACAGAAATGG - Intergenic
1190918039 X:54824610-54824632 AGACAGAAGAACCACAGAAAGGG - Intergenic
1191647353 X:63496249-63496271 AGGCAGGAGAAACACATAAAGGG + Intergenic
1194467441 X:94251313-94251335 GAACAGGAGAACCACACAGAAGG - Intergenic
1195249318 X:103027452-103027474 GGCCAGAACATCCAGAAAAAGGG - Intergenic
1195280219 X:103326051-103326073 GGCTAGGGGAAGCAAAAAAATGG - Intergenic
1196731706 X:118947513-118947535 GGCCAGGATAACCACACACTGGG - Intergenic
1197229016 X:123983304-123983326 AACTAGGAGAACCACAAATAAGG - Intronic
1199221657 X:145323131-145323153 AGGCAGGAGAAATACAAAAAGGG - Intergenic
1200101556 X:153691170-153691192 AGTCAGGAGCACCACAAACAAGG + Intronic
1200107150 X:153720894-153720916 GACAATGAGAACCACAAAGAAGG + Exonic
1201293200 Y:12441803-12441825 GACCAGGAGGACCACTAGAATGG + Intergenic
1201553992 Y:15249385-15249407 GGGCAGGAGAGCCACAAAGTAGG - Intergenic
1202379608 Y:24263662-24263684 GGCAAGTAGAATCACAATAAGGG + Intergenic
1202491174 Y:25406459-25406481 GGCAAGTAGAATCACAATAAGGG - Intergenic