ID: 1161680317

View in Genome Browser
Species Human (GRCh38)
Location 19:5676833-5676855
Sequence GCCAGAAAGCAGCTGCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 261}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161680316_1161680317 -5 Left 1161680316 19:5676815-5676837 CCTGGATGGAGGGGAGGGGCCAG 0: 1
1: 1
2: 5
3: 129
4: 1864
Right 1161680317 19:5676833-5676855 GCCAGAAAGCAGCTGCTCACTGG 0: 1
1: 0
2: 4
3: 16
4: 261
1161680315_1161680317 -2 Left 1161680315 19:5676812-5676834 CCGCCTGGATGGAGGGGAGGGGC 0: 1
1: 0
2: 2
3: 54
4: 572
Right 1161680317 19:5676833-5676855 GCCAGAAAGCAGCTGCTCACTGG 0: 1
1: 0
2: 4
3: 16
4: 261
1161680311_1161680317 2 Left 1161680311 19:5676808-5676830 CCGGCCGCCTGGATGGAGGGGAG 0: 1
1: 0
2: 0
3: 27
4: 249
Right 1161680317 19:5676833-5676855 GCCAGAAAGCAGCTGCTCACTGG 0: 1
1: 0
2: 4
3: 16
4: 261
1161680310_1161680317 3 Left 1161680310 19:5676807-5676829 CCCGGCCGCCTGGATGGAGGGGA 0: 1
1: 0
2: 1
3: 24
4: 233
Right 1161680317 19:5676833-5676855 GCCAGAAAGCAGCTGCTCACTGG 0: 1
1: 0
2: 4
3: 16
4: 261
1161680303_1161680317 25 Left 1161680303 19:5676785-5676807 CCACATTCGTGGAGCTGCAGGAC 0: 1
1: 0
2: 1
3: 6
4: 88
Right 1161680317 19:5676833-5676855 GCCAGAAAGCAGCTGCTCACTGG 0: 1
1: 0
2: 4
3: 16
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161680317 Original CRISPR GCCAGAAAGCAGCTGCTCAC TGG Intronic
900286263 1:1902021-1902043 CCCACAGTGCAGCTGCTCACTGG + Intergenic
900704584 1:4072331-4072353 GCCAGGAAGCACCTGCTCTGTGG + Intergenic
900795643 1:4706649-4706671 GGCAGACACCAGCTGCTCCCAGG + Intronic
901231630 1:7644883-7644905 GCCAGAAAGCTGAAGCCCACAGG - Intronic
901376688 1:8844663-8844685 GCCAGATAACAGCTGCACACAGG + Intergenic
901486175 1:9563801-9563823 GCCAGAAATCACTTGATCACAGG - Intronic
901905866 1:12409977-12409999 AGCAGAAAGCAGCTGCCAACAGG + Intronic
904326912 1:29732506-29732528 GCAAGAAAGCAGTGGCTCAAGGG - Intergenic
904796606 1:33061016-33061038 GCCCCACAGCAGCTGCACACAGG + Intronic
904965880 1:34372231-34372253 CCCTGTATGCAGCTGCTCACAGG - Intergenic
910845552 1:91601724-91601746 GAGAGAAGGCAGCTGCTGACAGG + Intergenic
914356710 1:146891794-146891816 ACCACATAGCAGCTGCTCCCTGG - Intergenic
916575394 1:166062505-166062527 GCAAGAAAGCATCTGTTCCCAGG - Intronic
921525181 1:216208931-216208953 GCCAGATAGAGGCTGCTCATAGG - Intronic
921752957 1:218818638-218818660 GCAAGGAAGCAGCAGCTCAGTGG + Intergenic
922223483 1:223626437-223626459 GCCAGAGGGCAGCTGGTCACAGG + Intronic
923071145 1:230565477-230565499 CCCAGAAAGCAGGAACTCACTGG + Intergenic
923266790 1:232322256-232322278 CCCACCAACCAGCTGCTCACAGG - Intergenic
1063234293 10:4096708-4096730 GGCAGAAAGAGGCTGCACACAGG - Intergenic
1063324313 10:5081883-5081905 GCAAGAAATCAGGAGCTCACTGG - Intronic
1063366220 10:5492675-5492697 GCCCGGGGGCAGCTGCTCACAGG - Intergenic
1065376297 10:25046511-25046533 GCCAGGACGCAGATGCACACAGG - Intronic
1066464545 10:35640893-35640915 GCCCGAAGGCGGCTGCTCGCCGG + Exonic
1066701619 10:38135713-38135735 GACAGAAGGCACCTCCTCACAGG + Intergenic
1068665477 10:59670915-59670937 GCCAGCAAGCAGTAACTCACAGG + Intronic
1069686071 10:70319578-70319600 GCTAGATAGCACCTGGTCACAGG - Intronic
1069895342 10:71677059-71677081 GGCAGAAAGCAGCTGGTGAAGGG - Intronic
1069959220 10:72069889-72069911 CCCAGAAGGCCCCTGCTCACTGG + Intronic
1070744898 10:78927726-78927748 GCCAAAGAGCCACTGCTCACTGG - Intergenic
1071044448 10:81356528-81356550 GGCAGAAAGCACCTCTTCACAGG - Intergenic
1071909794 10:90218580-90218602 GCAAGAAAGCATTTCCTCACAGG - Intergenic
1075213088 10:120508438-120508460 GCCAGAGAGGAGCTTGTCACTGG - Intronic
1075674782 10:124288893-124288915 GCCAGCAAACTGCAGCTCACAGG + Intergenic
1076331855 10:129675981-129676003 GCCAGGTAGCAGCTACTCAATGG - Intronic
1076496899 10:130903530-130903552 GCCAGGAAGCTGCTGGTCCCAGG - Intergenic
1077486897 11:2843025-2843047 GGCACAAAGCACCTCCTCACGGG - Intronic
1077897367 11:6463598-6463620 GCCAGGACGCAGCTGGTGACTGG + Intronic
1078468929 11:11571517-11571539 ACCAGAAAGCTGGTGTTCACTGG - Intronic
1079876446 11:25863379-25863401 CCTAGAAAGCAGCTTTTCACAGG + Intergenic
1081896628 11:46592810-46592832 CCCAGAAAGCAGACCCTCACAGG + Intronic
1083815731 11:65131388-65131410 TGCAGAAAGCAGCAGGTCACAGG + Intronic
1084693467 11:70740189-70740211 GCCACACAGCAGGTGCTCACTGG + Intronic
1085063040 11:73466004-73466026 GCTAGAAGACAGCTGCTTACTGG + Intronic
1087807657 11:102572516-102572538 GCAAGAAAGCAGCTGAGCATAGG + Intergenic
1089337194 11:117733415-117733437 GGGACAAAGCAGCTGTTCACAGG - Intronic
1089692451 11:120195371-120195393 GTGAGAAAGCTGCTGCTTACAGG + Intergenic
1089766472 11:120770869-120770891 ACCAGAAAGCAGGCCCTCACTGG + Intronic
1090176908 11:124658089-124658111 CCATCAAAGCAGCTGCTCACTGG + Intronic
1090441637 11:126729581-126729603 GCAAGAAAGGAGCAGCTCCCTGG + Intronic
1094478553 12:30861611-30861633 ATCAGAAAGCAGGTCCTCACCGG - Intergenic
1094704253 12:32899061-32899083 GCAAGAAGGCACCTTCTCACAGG + Intergenic
1095487085 12:42696482-42696504 GGCAGAAAGCAGATGCTCTGTGG + Intergenic
1096226427 12:49869448-49869470 GCCAGCAAACAGCAGCTGACAGG + Exonic
1098534934 12:71583659-71583681 GCCATCAAGCAGGTGTTCACAGG - Exonic
1100958446 12:99935968-99935990 GGCAGAAGGCACCTCCTCACAGG + Intronic
1101267449 12:103104172-103104194 GCCAGACTGCAAGTGCTCACAGG - Intergenic
1102396844 12:112593203-112593225 ACCAGAAAGGGGATGCTCACCGG + Intronic
1102826073 12:115948815-115948837 TCCAGCCAGCATCTGCTCACTGG - Intergenic
1103215112 12:119195751-119195773 CCCAGGAGGCAGCTGCTGACAGG + Intronic
1103731066 12:123028119-123028141 CCCTGAAAGCAGCCGCTCCCAGG + Intronic
1104367746 12:128193184-128193206 GTCAGACAGCAGCTGGGCACAGG - Intergenic
1104369805 12:128214728-128214750 ACCAGAAGGCACCTGTTCACTGG - Intergenic
1104842913 12:131833156-131833178 GGCACAAAGCAGGTGCTCACAGG - Intronic
1107284719 13:38778321-38778343 GCCAGAAAGAGGCCCCTCACCGG - Intronic
1107341841 13:39415616-39415638 GCCAGAAAGCCACTGCCCCCTGG - Intronic
1107880192 13:44825927-44825949 GGCAGAATTCAGCTCCTCACAGG + Intergenic
1109241141 13:59890095-59890117 GCCAGATAGCAGCTGCTACAGGG - Intronic
1110562892 13:76928124-76928146 GTCGGAAAGGAACTGCTCACAGG + Intergenic
1111903013 13:94222836-94222858 GTCAGAATGCAGCTGAGCACAGG - Intronic
1112757900 13:102659715-102659737 GCCTGAAAGCAGGTGATCTCTGG + Intronic
1115986125 14:39104873-39104895 ATCAGAAAGCAGGTCCTCACCGG - Intronic
1116860899 14:49994893-49994915 TCTAGAAAGCATCTGCTCCCAGG - Intronic
1118347523 14:64950811-64950833 TCAGGAAAGAAGCTGCTCACAGG + Intronic
1118864014 14:69688476-69688498 TCCAGAAAGCAGCTGCTCCCAGG - Intronic
1119183429 14:72619522-72619544 AGCAGAAAGCAGGTGCTCAGAGG + Intronic
1120668805 14:87340135-87340157 ACCAGAAAGAGGCTGCTCATCGG - Intergenic
1120845146 14:89118908-89118930 GGCAGAAAGCACCTCTTCACAGG + Intergenic
1121086001 14:91146535-91146557 CCCAGGAAGCAGCTCCTCCCAGG - Intronic
1121097939 14:91230786-91230808 GCCAGAAAGCAGCCTCTCGTTGG + Intergenic
1121801238 14:96775960-96775982 GCCAGAGAGGAGCTGAGCACAGG - Intergenic
1122320001 14:100849470-100849492 GCCAGGAAGGAGCTGCCCATGGG + Intergenic
1122830806 14:104394686-104394708 GCCAGAGAGCACCTGCTGCCGGG - Intergenic
1125047530 15:35259387-35259409 GCGTGAAAGCAGCTGCTCCCAGG - Intronic
1125293199 15:38172753-38172775 GCCACATTGCAGCTGCTCATGGG + Intergenic
1125584820 15:40812909-40812931 GCTGGGGAGCAGCTGCTCACTGG + Intronic
1125747228 15:42005234-42005256 GACAGAAAGGAGATGCTCTCGGG - Intronic
1126510826 15:49471756-49471778 GCTAGGAAGCAGCTGAACACAGG + Intronic
1129015130 15:72460643-72460665 GGCAGAATGCAGCTCCTCATAGG + Intergenic
1130686816 15:86045136-86045158 GCAAGGAAGCAGCTACTCAACGG + Intergenic
1131107209 15:89743431-89743453 GCCACGAGGCAGCTGCTCCCAGG + Exonic
1135660991 16:24296450-24296472 GCTGCAAAGAAGCTGCTCACGGG + Intronic
1136052860 16:27665440-27665462 GGCAGAAAGCACCTCTTCACAGG - Intronic
1138381426 16:56605516-56605538 TCCAGAAGACAGCTGATCACAGG - Intergenic
1139455433 16:67071473-67071495 GCCAGAAAGAGGTTCCTCACGGG + Intronic
1139977304 16:70823659-70823681 ACCACATAGCAGCTGCTCCCTGG + Intronic
1141446234 16:84060450-84060472 GTGGGAAAGCAGCTGCACACTGG + Intronic
1143761096 17:9104869-9104891 GCCAGGGACCTGCTGCTCACAGG + Intronic
1144125559 17:12199391-12199413 GCCAGAAAGCATCTTCACAGAGG + Intergenic
1144433781 17:15220970-15220992 AGCAGAAAGCAGCTGCTAAGGGG + Intergenic
1145117552 17:20225420-20225442 GCCAGAACTCAGATTCTCACTGG + Intronic
1146964751 17:37016042-37016064 GCCAGAGAGCTGATCCTCACAGG + Intronic
1147348974 17:39825057-39825079 GGCAGAAGGCAGCTTTTCACAGG - Intronic
1148000738 17:44385634-44385656 GCCAAAAAGCAGCTACCTACGGG + Exonic
1148165733 17:45482924-45482946 ACCAGGAAGCAGGGGCTCACAGG + Intronic
1148322458 17:46765762-46765784 CCCAGGACCCAGCTGCTCACAGG - Intronic
1148824903 17:50385459-50385481 CCCCAAAAGCAGCTGCTCTCAGG + Intronic
1149574413 17:57701479-57701501 ACCAGGAAGCGGGTGCTCACCGG + Intergenic
1150396960 17:64829648-64829670 ACCAGGAAGCAGGGGCTCACAGG + Intergenic
1151189948 17:72391037-72391059 GGCAGAAAGCACCTCTTCACAGG + Intergenic
1151929603 17:77223864-77223886 GCCGGAAAGCGGCTCCTCCCTGG + Intergenic
1157084468 18:44565058-44565080 GCAAAAAAGCTGCTGCTCAGAGG - Intergenic
1157185990 18:45540418-45540440 GTTAGCAAGCTGCTGCTCACAGG + Intronic
1157262805 18:46190984-46191006 GCCAGAGACCAGTTGCACACTGG - Intronic
1158426810 18:57347759-57347781 GCCAAAGAGCAGCTCCTCAGTGG + Intergenic
1158435760 18:57435033-57435055 CCCAGATCGCAGCTGCTCAGGGG + Intergenic
1158551360 18:58438871-58438893 AACAGAAAGCAGTTGCTCCCAGG + Intergenic
1159603582 18:70452181-70452203 GGCAGAAGGCACCTGTTCACAGG + Intergenic
1160298460 18:77658180-77658202 GCCAGAACGCAACTGATGACAGG + Intergenic
1161061111 19:2215423-2215445 CCTAGAAAGCAGCAGGTCACGGG + Intronic
1161680317 19:5676833-5676855 GCCAGAAAGCAGCTGCTCACTGG + Intronic
1161680318 19:5676834-5676856 GCCAGTGAGCAGCTGCTTTCTGG - Intronic
1163675339 19:18653014-18653036 GCCAAAAAGCACCTGTGCACTGG - Intronic
1163980068 19:20890989-20891011 GACAGTGAGCAGCTTCTCACTGG - Intergenic
1164502346 19:28830638-28830660 GCCACAAACCAGCAGCTCAGAGG + Intergenic
1164559977 19:29284020-29284042 TACAGAAAGCAGCTGGTCCCTGG - Intergenic
1165088949 19:33372562-33372584 ACCAGGAAGCAGCAGCTCGCTGG - Intergenic
1165926733 19:39331095-39331117 GGCAGAGTGCAGATGCTCACAGG + Intronic
1167423653 19:49418200-49418222 GCCACTCAGCAGCTGCACACTGG - Intergenic
924982726 2:237969-237991 TCCTGAAAGCAGCTGCTGAGAGG + Intronic
925033711 2:671250-671272 GCCAGAAAGGTGCTGCACCCTGG + Intronic
925364400 2:3302008-3302030 GCGATAAAGCAGAAGCTCACAGG + Intronic
925905565 2:8537891-8537913 GCCAGGACTCAGCTGCTCTCAGG + Intergenic
926688573 2:15717338-15717360 GTCAGGAAGCAGTTGCTCAGGGG - Intronic
927944768 2:27129037-27129059 GCCAGGAAGCAGCAGCACAATGG - Exonic
928411759 2:31059800-31059822 GCCAGAAAGCAGGTCCTCACCGG + Intronic
928621780 2:33096752-33096774 GACAGAAAGTAGCTGAGCACAGG + Intronic
930713023 2:54567042-54567064 ACCAGACGACAGCTGCTCACTGG - Intronic
930921907 2:56766034-56766056 GGCAGAAAGCACCTCTTCACAGG - Intergenic
932877588 2:75469944-75469966 TCCAGAAAGCAGGAGCCCACTGG - Intronic
933383171 2:81577025-81577047 GCCAGGGAGCAGCAGCTCATAGG - Intergenic
933771812 2:85749432-85749454 GCCAAGAAGCAGCTAATCACTGG + Intergenic
933776717 2:85775531-85775553 TTCAGAAATCAGCTGCTCCCTGG + Intronic
935059728 2:99596702-99596724 GCCAAAACACAGCTGCACACAGG + Intronic
937151247 2:119687465-119687487 GGCAGAAAGCACCTTTTCACAGG + Intergenic
937318621 2:120947712-120947734 GCCAGAATGCTGCTCCTCTCTGG - Intronic
937340115 2:121085882-121085904 GTCAGAGAGCAGCAGCCCACAGG - Intergenic
938408429 2:131045413-131045435 GCCAGCAAGCAGCAGGTCACAGG + Exonic
938562871 2:132490036-132490058 GACAGAAAGCAGGTGAGCACAGG - Intronic
939955996 2:148528074-148528096 GCCAGAAATCAGGAGCTCCCGGG + Intergenic
941400707 2:165026918-165026940 GGCAGAAGGCACCTCCTCACAGG + Intergenic
941548824 2:166889115-166889137 GCCAGGAGGCAGCTGCTGAGGGG - Intronic
942838981 2:180336924-180336946 GGCAGAGAGCAGCTGCTTGCTGG - Intergenic
947143580 2:227042617-227042639 GCTAGAAAGGAGCTGCTATCTGG + Intronic
1168892727 20:1305444-1305466 GCCACACAGCAGCTTCTCATAGG - Exonic
1169046578 20:2538157-2538179 ACCAGACAGCAGCGGGTCACAGG - Intronic
1169085019 20:2821122-2821144 GTCAGACAGCAGCTGCTCTGAGG + Intergenic
1169210125 20:3761274-3761296 GACAGGAAGCAGATACTCACAGG + Intronic
1169995122 20:11547519-11547541 ACCAACAAGCAGCTCCTCACTGG - Intergenic
1173799748 20:45887471-45887493 GCCAGAAAGCAACTTCTCAGGGG + Intronic
1175720355 20:61281954-61281976 GCCAGAGAACAGCAGCACACTGG + Intronic
1175748646 20:61479619-61479641 GCCATAAAAAAGCTGATCACTGG + Intronic
1176515637 21:7781445-7781467 ACCAGGAAGCAGGTCCTCACCGG - Intergenic
1178283546 21:31305882-31305904 GCCAGAAGGTGTCTGCTCACGGG + Intronic
1178649665 21:34411457-34411479 ACCAGGAAGCAGGTCCTCACCGG - Intergenic
1179100096 21:38348813-38348835 CCCTGGCAGCAGCTGCTCACAGG + Intergenic
1180150161 21:45943255-45943277 GCCACAAGGCACCCGCTCACAGG + Intergenic
1181040948 22:20192410-20192432 GGCACACAGCAGGTGCTCACAGG - Intergenic
1182097490 22:27635962-27635984 GCCAGAGAGCCACTGCTCAGTGG + Intergenic
1182149917 22:28020679-28020701 GCCAGGGAGCAGCTGCACACAGG - Intronic
1182442156 22:30370929-30370951 GACAAACAGCAGCTGCTCACAGG + Exonic
1183432045 22:37771795-37771817 GGCACAGAGCAGGTGCTCACAGG - Intronic
1183640992 22:39092285-39092307 GGCAGAAAGCAGCCTCTCACAGG - Intergenic
1183700154 22:39446472-39446494 GCCACACAGCAGCCGCTCCCTGG + Intergenic
1183701516 22:39453844-39453866 GCCAGGCAGCAGCTGCTGAAAGG + Intergenic
1185111318 22:48901713-48901735 TCCAGAAAGCACCTGCCCAGCGG + Intergenic
1185111592 22:48903055-48903077 TCCAGAAAGCACCTGCCCAGCGG - Intergenic
949716378 3:6936235-6936257 GGCAGCCAGCAGCTTCTCACAGG + Intronic
951884575 3:27511334-27511356 GCCAGAAAGCAGGCTGTCACCGG + Intergenic
953125631 3:40089074-40089096 CCCAGAAAGTAGCAGCTTACAGG + Intronic
953158327 3:40395043-40395065 GCCAAGAGGCAGCTGCTTACAGG + Intronic
957989918 3:87614616-87614638 GCCAGAAACCAGCTCCTCTGAGG - Intergenic
958116680 3:89228824-89228846 GCCTGAAAACTGCTGCTCTCTGG - Intronic
958582386 3:96044133-96044155 GGCAGAAAGCACCTCTTCACAGG + Intergenic
959442601 3:106396743-106396765 GACAGAAAGCACCTCTTCACAGG - Intergenic
959646187 3:108704705-108704727 GCCAGAAAACAGTTGCTAAGAGG + Intergenic
960101870 3:113750823-113750845 GCCCCAAACCTGCTGCTCACAGG - Intronic
960296152 3:115946467-115946489 GGCAGAAAACAGCTGCTAAGAGG + Intronic
961167642 3:124774517-124774539 GCCAGGAAGCCGATGCTCCCTGG + Intronic
962264737 3:133936716-133936738 TTCTGGAAGCAGCTGCTCACAGG - Intronic
963222536 3:142827410-142827432 GCCAGAGGGCAGCTTCACACGGG + Intronic
963229037 3:142891401-142891423 GGCAGAAGGCACCTCCTCACAGG + Intergenic
965630740 3:170730148-170730170 GCCTGAAGGCATCTGTTCACAGG + Intronic
966842083 3:184098117-184098139 GCCAGAAGGCAGCAGGTCAAGGG + Intronic
966911960 3:184564744-184564766 GGCAGAAAACAGCTGCCCACTGG - Intronic
970406183 4:15766633-15766655 GCTAGAAAGAAGCAGGTCACAGG + Intergenic
970502451 4:16691886-16691908 GACAGGAAGCAGCTTCTCAAGGG - Intronic
971127742 4:23772803-23772825 GTGAGAAAGCAGCTGTTCTCTGG + Intronic
973024367 4:45248958-45248980 TCCAAAAGGCAGTTGCTCACTGG - Intergenic
973636921 4:52869332-52869354 GCCATCAGCCAGCTGCTCACTGG + Intergenic
973786468 4:54337230-54337252 GCCAGAAAGTAGCAACTCAGAGG + Intergenic
974437339 4:61873197-61873219 GTCAGAAAGCAACTGGACACTGG + Intronic
974525441 4:63044238-63044260 GGCAGAAAGCACCTCTTCACAGG + Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
976947706 4:90791071-90791093 GGCAGAAAGCACCTCTTCACAGG + Intronic
977559224 4:98515676-98515698 ACCAGAGAGCATGTGCTCACAGG + Intronic
978501252 4:109412192-109412214 GCCACATGCCAGCTGCTCACTGG + Intergenic
978779392 4:112534065-112534087 GCCACAGAGCAGATGCTCAATGG + Intergenic
980310227 4:131118675-131118697 ACCAGACAGCAGCTGTTCAAGGG - Intergenic
981912825 4:150001561-150001583 GGCAGAAAGCACCTCTTCACAGG + Intergenic
983886302 4:172984285-172984307 GGCTGAAAGCAGCTCTTCACAGG + Intronic
984880699 4:184407776-184407798 GCCAGGAAGCAGTTGCTGAGAGG + Intronic
985366579 4:189237469-189237491 GTCTGGAAGCGGCTGCTCACGGG + Intergenic
987330343 5:16851545-16851567 CCCAGAAAGCACCTCCACACAGG + Intronic
988928324 5:36011520-36011542 GGCAGAAGGCAGCTCTTCACAGG - Intergenic
990018630 5:51098380-51098402 ACCAGGAAGCTGCTGATCACCGG + Intergenic
991093978 5:62720036-62720058 TCCAGGAAGCGGCTGCTCAGAGG - Intergenic
993252837 5:85550313-85550335 CCCAGGAGGCAGCTGCTGACGGG + Intergenic
995585009 5:113639655-113639677 GGCAGAAAGCACCTTTTCACAGG - Intergenic
998530585 5:142880787-142880809 TCCAGAAAGCAGATGCACTCAGG - Intronic
1002563875 5:180099499-180099521 GGCACACAGCAGCTGCTCAGAGG + Intergenic
1003067256 6:2914251-2914273 GCCAGGAAGCAGATTCTCCCCGG + Intergenic
1004034968 6:11914976-11914998 GCCACAAAGTAGGTGCTCAGTGG + Intergenic
1006053832 6:31365701-31365723 GCCAGTGAGCAGGTTCTCACTGG - Intergenic
1007556210 6:42768678-42768700 GGAAGAAAGCAGATTCTCACTGG - Intronic
1008430459 6:51410664-51410686 GCAATAGAGCAGCTGCTCCCCGG + Intergenic
1011123954 6:83986484-83986506 GGCAGAAGGCACCTCCTCACAGG + Intergenic
1012877416 6:104744593-104744615 GCCAGAAAGCAGTAGCTCCTTGG + Exonic
1013520049 6:110924470-110924492 GCCAGAAGGCAGCTGCTGACGGG + Intergenic
1013741360 6:113290117-113290139 GGCAGAAGGCACCTCCTCACGGG - Intergenic
1013889112 6:115004954-115004976 TTCATAAAGCAGCTGCTCAAAGG + Intergenic
1017690708 6:156961456-156961478 GCCAGCAAGCCGCTGCTGGCGGG - Intronic
1019138248 6:169925655-169925677 GCCAGACAGCAGCAGCTGAAGGG - Intergenic
1019406277 7:885792-885814 GCCAGAAAGCAGCCTCACCCTGG - Intronic
1019433536 7:1010579-1010601 GCCAGAAAGCAGCAGGCCCCAGG - Intronic
1019610795 7:1935788-1935810 GCCAGAAAGCAGCAGCCTCCAGG + Intronic
1019967396 7:4510947-4510969 GCCAGAGAGCACCTGCACAAAGG + Intergenic
1022042867 7:26597055-26597077 GGCAGGAGGCAGCTGCTAACCGG - Intergenic
1022496097 7:30854045-30854067 GCCAGACAGCAGCAGATCACAGG + Intronic
1022819605 7:33946112-33946134 GGCAGAAAGCACCTCTTCACAGG + Intronic
1023770694 7:43554078-43554100 GCCTGAGAGCAGCTGCTCAAGGG + Intronic
1028815486 7:95139215-95139237 GGCAGAAGGCACCTCCTCACAGG + Intronic
1029274515 7:99396298-99396320 CCCAGGAGGCAGCTGCTGACAGG - Exonic
1032951034 7:136913217-136913239 GCCACAAAGAAGATGCTCAAAGG - Intronic
1033588855 7:142794140-142794162 GCCTGAAAGAAGCAGCTCAGGGG - Intergenic
1034736787 7:153436472-153436494 GGCAGAAAGCACCTCTTCACAGG - Intergenic
1034820969 7:154215996-154216018 ACCAGAATGCAGCTGTTCACTGG - Intronic
1035039250 7:155915601-155915623 CCCAGAAACCAGCTGCTACCAGG - Intergenic
1037586783 8:20282304-20282326 CTCAGAGAGCAGCTGCTCAGAGG - Intronic
1038906699 8:31912414-31912436 CCCTGGAAGCAGCTGCTCTCAGG + Intronic
1040588563 8:48767130-48767152 GCCAGGAAGCAGGTCCTCGCCGG + Intergenic
1041755727 8:61311382-61311404 GGCAGAAAGCAGCTGAGCCCTGG - Intronic
1041784486 8:61616369-61616391 GCCCCAAATCTGCTGCTCACAGG - Intronic
1044183889 8:89228797-89228819 GCCAGAATGCAGCACCTCAAAGG + Intergenic
1044450780 8:92333981-92334003 GGCAGAAGGCATCTGTTCACAGG - Intergenic
1044909905 8:97045873-97045895 GCCAGAAAGCAGCTCCTCGCTGG + Intronic
1045076322 8:98573350-98573372 GGCAGAAAGCACCTCTTCACAGG + Intronic
1045437791 8:102181902-102181924 GACAGAAGGCACCTCCTCACGGG - Intergenic
1046038562 8:108874585-108874607 GGCAGAAGGCACCTGTTCACAGG + Intergenic
1047085045 8:121506760-121506782 GACAGACAGCAGCCACTCACTGG + Intergenic
1047275333 8:123401291-123401313 CCCACACAGCAGCTGCTCATGGG - Intronic
1048651040 8:136477834-136477856 ACCAGAAAGCAGATCTTCACCGG + Intergenic
1049920040 9:354674-354696 GGCAGGATGCAGTTGCTCACGGG + Intronic
1050585781 9:7109981-7110003 GGCAGAAGGCACCTCCTCACAGG - Intergenic
1053140225 9:35677812-35677834 GCGAGACAGCAACTGCTCATAGG - Exonic
1055668543 9:78576307-78576329 GCCCGCAAGCAGCAGCTCAAGGG - Intergenic
1056827142 9:89884211-89884233 GCCAGATAGCAGCTGCTGGCAGG - Intergenic
1061493178 9:130957308-130957330 GCGAGGAAGCAGCTGCTCTGGGG + Intergenic
1187980391 X:24750351-24750373 GCCAGATACCAAGTGCTCACTGG - Intronic
1189577084 X:42365399-42365421 GGCAGCAAACAGCTGGTCACTGG - Intergenic
1192227205 X:69237475-69237497 GGCAGATAGCTCCTGCTCACTGG + Intergenic
1192358660 X:70425121-70425143 GTCAGAAGGCAGAGGCTCACTGG + Intronic
1192539602 X:71957041-71957063 TCCAGAAAGCAGACGCTCTCTGG + Intergenic
1192629350 X:72763755-72763777 GCCAGAAAGCAACTGCACCAAGG + Intergenic
1192652360 X:72957059-72957081 GCCAGAAAGCAACTGCACCAAGG - Intergenic
1193865184 X:86721818-86721840 GGCAGAAAGCAGCTCTTCACGGG + Intronic
1195324432 X:103746890-103746912 CCCAGAAGGCAGCTGGTCATTGG - Intergenic
1199597018 X:149514096-149514118 GCCTGAAAGCAGCTTTTCAAGGG - Intronic
1200270295 X:154676401-154676423 GGAAGAAGGCAGCTCCTCACAGG + Intronic
1200384274 X:155874348-155874370 GCCAGAACGCAGCTGCCTGCTGG - Intergenic
1201148213 Y:11078223-11078245 GCCAGGAAGCAGTCCCTCACTGG + Intergenic
1201849443 Y:18461893-18461915 GCCATAAATGAGCTGCTCAGTGG + Intergenic
1201883875 Y:18858482-18858504 GCCATAAATGAGCTGCTCAGTGG - Intergenic