ID: 1161683759

View in Genome Browser
Species Human (GRCh38)
Location 19:5693239-5693261
Sequence GGCCCACACCACCACGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161683759_1161683762 -8 Left 1161683759 19:5693239-5693261 CCTGTCCCGTGGTGGTGTGGGCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1161683762 19:5693254-5693276 TGTGGGCCCTGCCAGTGCTGTGG 0: 1
1: 0
2: 5
3: 43
4: 395
1161683759_1161683772 21 Left 1161683759 19:5693239-5693261 CCTGTCCCGTGGTGGTGTGGGCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1161683772 19:5693283-5693305 TACAGGGACACTCACCGCAATGG 0: 1
1: 0
2: 1
3: 10
4: 227
1161683759_1161683770 4 Left 1161683759 19:5693239-5693261 CCTGTCCCGTGGTGGTGTGGGCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1161683770 19:5693266-5693288 CAGTGCTGTGGGGTGGGTACAGG 0: 1
1: 0
2: 4
3: 26
4: 358
1161683759_1161683765 -3 Left 1161683759 19:5693239-5693261 CCTGTCCCGTGGTGGTGTGGGCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1161683765 19:5693259-5693281 GCCCTGCCAGTGCTGTGGGGTGG 0: 1
1: 0
2: 4
3: 44
4: 362
1161683759_1161683763 -7 Left 1161683759 19:5693239-5693261 CCTGTCCCGTGGTGGTGTGGGCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1161683763 19:5693255-5693277 GTGGGCCCTGCCAGTGCTGTGGG 0: 1
1: 0
2: 3
3: 28
4: 251
1161683759_1161683767 -2 Left 1161683759 19:5693239-5693261 CCTGTCCCGTGGTGGTGTGGGCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1161683767 19:5693260-5693282 CCCTGCCAGTGCTGTGGGGTGGG 0: 1
1: 0
2: 4
3: 43
4: 399
1161683759_1161683764 -6 Left 1161683759 19:5693239-5693261 CCTGTCCCGTGGTGGTGTGGGCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1161683764 19:5693256-5693278 TGGGCCCTGCCAGTGCTGTGGGG 0: 1
1: 1
2: 3
3: 30
4: 320
1161683759_1161683771 5 Left 1161683759 19:5693239-5693261 CCTGTCCCGTGGTGGTGTGGGCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1161683771 19:5693267-5693289 AGTGCTGTGGGGTGGGTACAGGG 0: 1
1: 1
2: 1
3: 50
4: 679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161683759 Original CRISPR GGCCCACACCACCACGGGAC AGG (reversed) Intronic
900650806 1:3729272-3729294 GCCCCAGACCCCCACGGGAGGGG - Intronic
902212458 1:14913708-14913730 GGCCCCCACCACCCCTGCACAGG - Intronic
903565789 1:24264690-24264712 GGACCACAGCCCCACGGGATAGG - Intergenic
903608234 1:24590750-24590772 GGCACACACCACCACCAGGCTGG + Intronic
904762884 1:32817974-32817996 GGCCCCCACCCCCACTGGGCAGG - Exonic
907635813 1:56133916-56133938 GGCCCACACCACCACATCACTGG + Intergenic
909403249 1:75258070-75258092 GGCCCACTCCACCAGGGCCCTGG + Intronic
910136705 1:83980407-83980429 GGCGCACACCACCATGGGCCTGG + Intronic
910330956 1:86072037-86072059 CGCCTACACCACCAAGGGCCTGG + Intronic
916290312 1:163158710-163158732 GGACCACAGGACCACAGGACCGG + Intronic
919796957 1:201326686-201326708 GGCCCACACCACCTCCAGCCTGG - Intronic
924763150 1:247007731-247007753 GGCCCCCACCTGCGCGGGACGGG + Intronic
1062932921 10:1364251-1364273 AGACCACACCACCCCGGGAAAGG - Intronic
1063374489 10:5545943-5545965 GGCCCAAGCCACCCAGGGACTGG - Intergenic
1064033720 10:11899280-11899302 AGCCGACTCCACCACGGGATGGG + Intergenic
1064893638 10:20209035-20209057 GGACCACAGGACCACAGGACGGG + Intronic
1068399817 10:56513712-56513734 GGTCCACACCACCAAGTGTCAGG + Intergenic
1068860813 10:61846086-61846108 GGCCAACACCAGCACAGGGCTGG + Intergenic
1070349211 10:75575888-75575910 TGCCCACACCACCAGGGCCCTGG + Intronic
1076713083 10:132349787-132349809 GGCCCACCCAACCATGGGGCAGG - Intronic
1079799821 11:24854743-24854765 TGCCTACACCACCAGGGCACTGG - Intronic
1084481134 11:69420831-69420853 GGCCCACATCCCCACAGGCCTGG - Intergenic
1085048962 11:73369882-73369904 GGTCCTCAACACCACAGGACGGG + Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1094216087 12:27944326-27944348 GGCCCCCACCACCATGAGACAGG - Intergenic
1097967423 12:65595856-65595878 AGCCCACACCACCCAGGGAGAGG + Intergenic
1100156272 12:91804146-91804168 AGCCCACACCACCAGGGCATTGG + Intergenic
1102028620 12:109727388-109727410 GGCCGACACCTCCAGGGGACTGG + Intronic
1102954060 12:117048196-117048218 CGGCCACACCACTAAGGGACAGG + Intronic
1108982742 13:56539194-56539216 GGCACACATTACCACGGGAAGGG - Intergenic
1113750872 13:112775803-112775825 AGCCCACACCTCCACGGCCCTGG + Intronic
1117077431 14:52118408-52118430 GGCCCAGACCACCGTGGTACTGG + Intergenic
1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG + Intergenic
1119769198 14:77209882-77209904 GGCCCACACCACCTCTTCACTGG - Intronic
1120565372 14:86048447-86048469 TGCCTACACCACCAGGGCACTGG - Intergenic
1121470637 14:94151653-94151675 TGCCCACACCACCAGGGCCCTGG - Intronic
1122113289 14:99515892-99515914 GCCCCCCACCCCCCCGGGACTGG - Intronic
1122858499 14:104571634-104571656 GGCCCATCCCACCACTGCACCGG - Intronic
1123056490 14:105572947-105572969 GGCCCACACGCCGACGGGATCGG + Intergenic
1123057443 14:105578860-105578882 GGCCCACACGCCGACGGGATCGG - Intergenic
1123080923 14:105693075-105693097 GGCCCACACGCCGACGGGATCGG + Intergenic
1123081719 14:105698793-105698815 GGCCCACACGCCGACGGGATCGG - Intergenic
1125751739 15:42033791-42033813 GGCCCACTCCACCCAGGGCCAGG - Intronic
1127978765 15:64018575-64018597 GACCCAGAGAACCACGGGACAGG - Intronic
1128455584 15:67829687-67829709 GGCCCCCACCACCCCGCGATGGG - Intronic
1128936024 15:71747154-71747176 CGTCCAGACCCCCACGGGACGGG - Intronic
1129450701 15:75649578-75649600 GGCCCAAGCCACCACTGGAGCGG + Exonic
1131461963 15:92623793-92623815 GGACACCACCACCACGTGACAGG + Intronic
1132814518 16:1819353-1819375 GGTGCTCCCCACCACGGGACTGG + Intronic
1135295625 16:21277397-21277419 GCCCCATTCCACCCCGGGACAGG + Intronic
1136247502 16:28984345-28984367 GGCCCACCCCACGAAGGGCCTGG + Exonic
1139650381 16:68359309-68359331 GGCCCACCCCTCCAAGGGGCTGG - Exonic
1140409758 16:74734581-74734603 GGCCCACAGCAGCACGGCAGGGG + Intronic
1142161225 16:88558669-88558691 GACTCACACCACCAGGGAACGGG - Intergenic
1142619229 17:1154387-1154409 GGCAGGCAGCACCACGGGACGGG - Intronic
1143116792 17:4585629-4585651 GGCCCACACCACGTGGGGATAGG + Intronic
1147525216 17:41216160-41216182 TGCCTACACCACCACGGCCCTGG + Intronic
1148214131 17:45825255-45825277 AGCCAGCACCACCAGGGGACAGG + Intronic
1148588885 17:48800736-48800758 GGACCACACCACCGAGGAACAGG - Intronic
1155509386 18:26561858-26561880 TGCTCACGCCAGCACGGGACTGG - Intronic
1159939096 18:74392474-74392496 GGCTCAGACCACCACAGGAGCGG - Intergenic
1161683759 19:5693239-5693261 GGCCCACACCACCACGGGACAGG - Intronic
1162435582 19:10655925-10655947 GGGCCCCAGCACCACGGAACAGG - Intronic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1163787249 19:19281180-19281202 GGCCCACTCCACCACATGAGCGG + Intronic
1164549596 19:29198128-29198150 GGACCACAGGACCACAGGACTGG + Intergenic
1165090797 19:33387556-33387578 GGCCCACCCCACCATGGGATGGG + Intronic
1167601810 19:50459118-50459140 GGTCCACACCACCTGGGGCCGGG - Exonic
1167610729 19:50506649-50506671 GGCCCTCACCACCACCAGCCTGG - Intronic
928939610 2:36714515-36714537 GGGCCACACAACCATGGCACTGG + Intronic
932294561 2:70613545-70613567 GGATCACACCTCCATGGGACAGG - Intronic
933611839 2:84444527-84444549 GGACCACAGGACCACAGGACCGG + Intronic
933750301 2:85598906-85598928 GGCCCACTCCTCCATGGCACAGG + Exonic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
937893250 2:126956613-126956635 TGCCCACACCACCAGGGCCCTGG + Intergenic
948188792 2:236042730-236042752 GGCCCACACCTCCCCTGCACTGG - Intronic
1171459553 20:25291070-25291092 GGCCCACAACCCCACTGGCCTGG - Intronic
1172116324 20:32575500-32575522 GACCCACCCTCCCACGGGACAGG - Intronic
1175881061 20:62259306-62259328 GGCCCACCCCACCAGGGCAGCGG + Intronic
1176148404 20:63575694-63575716 GGCACACACCACCACAGTACAGG + Intergenic
1179537321 21:42060978-42061000 CGCCCACACCAGCACAGGCCAGG - Intergenic
1180000492 21:44993353-44993375 GGCCCACACAGCGGCGGGACTGG - Intergenic
1182075263 22:27491115-27491137 GGGCCACACCAGCATGGGCCAGG - Intergenic
1184700875 22:46171762-46171784 GGCCCCGACCTCCACGAGACTGG - Intronic
1184788174 22:46682000-46682022 AGCTCACACCAACACAGGACGGG - Intergenic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
954408712 3:50359680-50359702 CGCGCTCACCACAACGGGACCGG - Intronic
958903937 3:99921449-99921471 GGCCCACACTACCAAGATACTGG + Intronic
962411202 3:135143215-135143237 GGCCCACAACTCCATGGGGCTGG + Intronic
965880406 3:173382178-173382200 GGCCTACACCACCAGGGCCCTGG + Intergenic
968481070 4:833350-833372 GGCCCACAGCTCCACAGGCCTGG + Intergenic
968574929 4:1361207-1361229 GGACCACAGCACCACAGGCCTGG - Intronic
968835872 4:2963857-2963879 GGCCCTCACCAGCAGGGGAGCGG - Exonic
968886398 4:3336149-3336171 GGCCCAGACCACCGAGGGACAGG - Intronic
968920029 4:3517720-3517742 GGCCAACAGCAGCACGGGAGGGG + Intronic
969050403 4:4369002-4369024 GTCCCACTCCACCATGGGGCTGG - Intronic
969353666 4:6612858-6612880 GGCCCACATAACCAAGGGAAGGG + Intronic
970407164 4:15774794-15774816 GGCACGCACCACCATGGGCCTGG - Intergenic
981468738 4:145103904-145103926 GGCGCACACCACCACATGTCTGG + Intronic
985731864 5:1553908-1553930 GGCCCACTCCACTCGGGGACAGG + Intergenic
988661015 5:33268588-33268610 GGGCCACTCCAACACAGGACAGG + Intergenic
992383894 5:76265589-76265611 TGCCTACACCACCACGGCCCTGG - Intronic
992895811 5:81244282-81244304 GGCCCACACCAGGAAGGGGCAGG - Intronic
994660052 5:102642228-102642250 GGCCACCACCACCACTGGCCCGG - Intergenic
996270731 5:121602079-121602101 TGCCTACACCACCACGGCCCTGG + Intergenic
998040279 5:138947093-138947115 GCCCCACACCAGGACTGGACTGG - Exonic
999607610 5:153333265-153333287 GCCCCCCACCACCCCTGGACAGG + Intergenic
1001447061 5:171793956-171793978 GGCCCACACCAGCACTGGGGGGG - Intronic
1005378230 6:25207261-25207283 TGCCTACACCACCAGGGCACTGG + Intergenic
1005795717 6:29359803-29359825 TGCCTACACCACCAGGGGCCTGG + Intronic
1007281056 6:40712799-40712821 AGCCCACACAACAACAGGACTGG + Intergenic
1009797795 6:68494774-68494796 TGCCCACACCACCAGGGCCCTGG + Intergenic
1017324618 6:153131124-153131146 TGCCCACACCTCCAGGCGACCGG - Intronic
1018273348 6:162103976-162103998 GGCCCTCACCTCCACAGCACAGG - Intronic
1018680216 6:166258318-166258340 TGCCTGCTCCACCACGGGACAGG - Intergenic
1019711973 7:2521941-2521963 GGGTCACCCCACCAGGGGACAGG + Intronic
1026937528 7:74267121-74267143 GGCGCACACCACCACCAGGCCGG + Intergenic
1029373838 7:100166432-100166454 GGCTGACACCACCAAGGGAGGGG - Intronic
1029606163 7:101600739-101600761 GGCCCAGGCCACCCAGGGACTGG + Intergenic
1029884056 7:103848447-103848469 TGTCCACCCCACCATGGGACAGG + Intronic
1030325892 7:108218032-108218054 TGCCTACACCACCAGGGCACTGG - Intronic
1034273734 7:149815236-149815258 GGCACACACTCCCAGGGGACAGG - Intergenic
1036380889 8:8235860-8235882 CTCCCACAGCACCACGGGTCTGG + Intergenic
1037285521 8:17294558-17294580 TGCCTACACCACCAGGGGCCCGG - Intronic
1038496582 8:28007628-28007650 GTCCCAAATGACCACGGGACTGG - Intergenic
1040507060 8:48058424-48058446 GGCGCACACCACCACAGGCCCGG - Intronic
1040982141 8:53254855-53254877 GCCCCACACCACCACGTGTCAGG - Intergenic
1043511289 8:80952699-80952721 TGCCTACACCACCAAGGCACTGG + Intergenic
1046219895 8:111200669-111200691 TGCCCACACCACCAGGGCCCTGG + Intergenic
1049260850 8:141638399-141638421 GGACCACACCGGCATGGGACTGG + Intergenic
1052382372 9:27785298-27785320 TGCCTACACCACCAGGGGCCTGG - Intergenic
1052956111 9:34254349-34254371 GGCCCCCACCATCTCGGCACAGG + Exonic
1055390993 9:75821866-75821888 TGCCTACACCACCAGGGGCCTGG - Intergenic
1057142984 9:92738702-92738724 GGCCTACACCACCAGGGCAGGGG + Intronic
1057554215 9:96074613-96074635 GGCACCCACCACCACGGGCCTGG + Intergenic
1060128748 9:121075146-121075168 GGCCCACACCACGCCCGGTCCGG - Intronic
1060317527 9:122526594-122526616 TGCCCACCCCACCACGGGTTCGG + Exonic
1061610310 9:131741108-131741130 GGCCAACCCCAGCCCGGGACAGG - Intergenic
1062697169 9:137881326-137881348 GGCCAGCTCCACCACAGGACAGG + Intronic
1186370063 X:8937504-8937526 GGCCTACACCACCAGGGCCCTGG - Intergenic
1187484760 X:19693097-19693119 GCCCCACATCCCCATGGGACTGG + Intronic
1189182647 X:39018320-39018342 GGGGCACACAACCAGGGGACTGG - Intergenic
1192884320 X:75320665-75320687 TGCCCACACCACCAGGGCCCTGG - Intergenic
1192964113 X:76159341-76159363 TGCCCACACCACCAAGGCCCTGG + Intergenic
1194800795 X:98269853-98269875 GGACCACAGGACCACAGGACCGG - Intergenic
1195820921 X:108944493-108944515 TGCCTACACCACCAGGGGCCTGG - Intergenic
1199308283 X:146292921-146292943 AGCCCACACCACCAGGGTATTGG - Intergenic
1199469862 X:148182176-148182198 TGCCTACACCACCAGGGGCCTGG - Intergenic