ID: 1161683893

View in Genome Browser
Species Human (GRCh38)
Location 19:5693817-5693839
Sequence CCGAGGGGTGGAGTGAGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161683893_1161683910 30 Left 1161683893 19:5693817-5693839 CCGGTGCTCACTCCACCCCTCGG 0: 1
1: 1
2: 0
3: 19
4: 236
Right 1161683910 19:5693870-5693892 GCATCTTGGTGCCCCTGGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 239
1161683893_1161683909 26 Left 1161683893 19:5693817-5693839 CCGGTGCTCACTCCACCCCTCGG 0: 1
1: 1
2: 0
3: 19
4: 236
Right 1161683909 19:5693866-5693888 TTTAGCATCTTGGTGCCCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 136
1161683893_1161683908 25 Left 1161683893 19:5693817-5693839 CCGGTGCTCACTCCACCCCTCGG 0: 1
1: 1
2: 0
3: 19
4: 236
Right 1161683908 19:5693865-5693887 GTTTAGCATCTTGGTGCCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 95
1161683893_1161683904 16 Left 1161683893 19:5693817-5693839 CCGGTGCTCACTCCACCCCTCGG 0: 1
1: 1
2: 0
3: 19
4: 236
Right 1161683904 19:5693856-5693878 CCTGCCCCAGTTTAGCATCTTGG 0: 1
1: 0
2: 3
3: 25
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161683893 Original CRISPR CCGAGGGGTGGAGTGAGCAC CGG (reversed) Intronic