ID: 1161684064

View in Genome Browser
Species Human (GRCh38)
Location 19:5694501-5694523
Sequence CAGCGGCGAGGCCGAGTCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161684064_1161684069 11 Left 1161684064 19:5694501-5694523 CCACGGACTCGGCCTCGCCGCTG 0: 1
1: 0
2: 0
3: 16
4: 185
Right 1161684069 19:5694535-5694557 GGCCGATTTCCGTAACACCTGGG 0: 1
1: 0
2: 0
3: 2
4: 15
1161684064_1161684074 20 Left 1161684064 19:5694501-5694523 CCACGGACTCGGCCTCGCCGCTG 0: 1
1: 0
2: 0
3: 16
4: 185
Right 1161684074 19:5694544-5694566 CCGTAACACCTGGGCGGTCAGGG 0: 1
1: 0
2: 0
3: 1
4: 33
1161684064_1161684071 14 Left 1161684064 19:5694501-5694523 CCACGGACTCGGCCTCGCCGCTG 0: 1
1: 0
2: 0
3: 16
4: 185
Right 1161684071 19:5694538-5694560 CGATTTCCGTAACACCTGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 24
1161684064_1161684066 -10 Left 1161684064 19:5694501-5694523 CCACGGACTCGGCCTCGCCGCTG 0: 1
1: 0
2: 0
3: 16
4: 185
Right 1161684066 19:5694514-5694536 CTCGCCGCTGACAATCTTGTAGG 0: 1
1: 0
2: 0
3: 0
4: 22
1161684064_1161684072 19 Left 1161684064 19:5694501-5694523 CCACGGACTCGGCCTCGCCGCTG 0: 1
1: 0
2: 0
3: 16
4: 185
Right 1161684072 19:5694543-5694565 TCCGTAACACCTGGGCGGTCAGG 0: 1
1: 0
2: 0
3: 1
4: 23
1161684064_1161684068 10 Left 1161684064 19:5694501-5694523 CCACGGACTCGGCCTCGCCGCTG 0: 1
1: 0
2: 0
3: 16
4: 185
Right 1161684068 19:5694534-5694556 AGGCCGATTTCCGTAACACCTGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161684064 Original CRISPR CAGCGGCGAGGCCGAGTCCG TGG (reversed) Exonic
900013602 1:135160-135182 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
900043670 1:491143-491165 CTGCTGTGAGGCCGAGGCCGAGG + Intergenic
900065108 1:726146-726168 CTGCTGTGAGGCCGAGGCCGAGG + Intergenic
900537508 1:3186183-3186205 CAGCGCGGAGGACGAGGCCGAGG + Exonic
902249790 1:15146797-15146819 CAGCAGCAAGGCGGAGTACGCGG + Intergenic
902451494 1:16499341-16499363 CGGAGGCGAGGCCGGGGCCGAGG + Intergenic
904199790 1:28812293-28812315 GAGCGGCAAGGCAGAGGCCGCGG - Exonic
906062481 1:42958038-42958060 CGGTGACGAGGCCGAGGCCGAGG - Intronic
906766078 1:48435720-48435742 GGGCGGCGAGGCCGCGACCGGGG - Intronic
907011488 1:50968133-50968155 CAGGTGCGAGGCCGAGGCCAGGG + Exonic
913254941 1:116944769-116944791 CAGCGGCGAGGCGGAGGCGGCGG - Exonic
913565637 1:120069719-120069741 AGGCGGCGGGGCCGAGGCCGCGG - Intergenic
913632492 1:120723834-120723856 AGGCGGCGGGGCCGAGGCCGCGG + Intergenic
914286233 1:146229093-146229115 AGGCGGCGGGGCCGAGGCCGCGG - Intergenic
914547261 1:148679835-148679857 AGGCGGCGGGGCCGAGGCCGCGG - Intergenic
914619242 1:149390508-149390530 AGGCGGCGGGGCCGAGGCCGCGG + Intergenic
919878752 1:201888900-201888922 CTGCGGCGGGGCCCAGCCCGCGG - Exonic
922100215 1:222472983-222473005 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
922169582 1:223143328-223143350 CTGCGGCGTGGCCGAGACGGGGG - Intergenic
924421863 1:243917312-243917334 CAGCGGCGAGGTCGGGGCTGGGG + Intergenic
1064011759 10:11741831-11741853 CACCGACGAGGCCGAGCACGGGG - Intergenic
1065034569 10:21624819-21624841 CAGCAGAGAGGCCGTGGCCGTGG - Intronic
1066733276 10:38451744-38451766 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
1066746094 10:38604908-38604930 CAGCAGCGCAGCCGAGTCCCAGG + Intergenic
1067024988 10:42836937-42836959 CAGCGGCGGGCGCGGGTCCGAGG - Intergenic
1068216600 10:53990683-53990705 CAGAGTGGACGCCGAGTCCGAGG - Intronic
1071598111 10:86942623-86942645 GTGCTGCGAGGCCGAGGCCGGGG - Exonic
1071618097 10:87094680-87094702 CAGCAACGCGGCCGAGTCGGCGG + Exonic
1072059816 10:91798732-91798754 GAGCGCCGCGGCCGAGGCCGTGG + Exonic
1074516318 10:114173897-114173919 CGGGGGCGAGGGCGAGTGCGAGG - Intronic
1075522214 10:123149675-123149697 CCCCGGCGAGGGCGAGCCCGCGG - Exonic
1076792487 10:132784720-132784742 CAGGGGCGAAGCCGGGGCCGGGG + Intergenic
1076900915 10:133336946-133336968 CAGCTGCGAGACCGAGGCTGTGG + Intronic
1076969944 11:127374-127396 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
1077043727 11:535444-535466 CAGGGCCGGGGCCGAGGCCGGGG + Exonic
1077332889 11:1991052-1991074 CAGGCGGGAGGCCGGGTCCGCGG - Intergenic
1077492759 11:2869786-2869808 CAGCGGCGGGGCCGGCTCTGCGG + Intergenic
1080283459 11:30584715-30584737 CAGCGCTGAGCCCGAGCCCGGGG + Intronic
1084295732 11:68212868-68212890 CAGCGTCGGGGCCGGGCCCGCGG - Intronic
1084372186 11:68751364-68751386 CAGAGCCGAGGCCCAGCCCGGGG + Intronic
1084679700 11:70659727-70659749 CAGCCACGAGGCCCAGTCTGGGG - Intronic
1091274591 11:134341976-134341998 CAAGGGCGTGGCTGAGTCCGGGG - Intronic
1091292280 11:134447830-134447852 CAGCGGAAGGGCCGAGTCCGAGG - Intergenic
1202815872 11_KI270721v1_random:46228-46250 CAGGCGGGAGGCCGGGTCCGCGG - Intergenic
1099775633 12:87124519-87124541 CATCTGCGAGGCTGAGTCTGGGG - Intergenic
1101612378 12:106303213-106303235 CAGCGGCGAAGCGGCCTCCGAGG - Intronic
1102000380 12:109554123-109554145 GAGTGACGAGGCCGCGTCCGGGG + Exonic
1105389046 13:19958691-19958713 CGGCGGCGCGGCCGAGCCCGGGG - Exonic
1105979424 13:25503231-25503253 CAGCATCGAGACCGAGTCCAAGG + Intronic
1109024654 13:57142569-57142591 CGGCGGCCAGGGCGAGGCCGTGG + Exonic
1109025641 13:57149139-57149161 CGGCGGCCAGGGCGAGGCCGTGG + Exonic
1109026631 13:57155712-57155734 CGGCGGCCAGGGCGAGGCCGTGG + Exonic
1109027623 13:57162283-57162305 CGGCGGCCAGGGCGAGGCCGTGG + Exonic
1109028609 13:57168848-57168870 CGGCGGCCAGGGCGAGGCCGTGG + Exonic
1111468858 13:88649784-88649806 CATCTGCGAGGCTGAGTCCAGGG - Intergenic
1111530456 13:89530005-89530027 CAGCTGAGAGGCTGAGTCCAGGG - Intergenic
1112637208 13:101227986-101228008 CAGAGGCAAGGCCGATTCCCAGG - Intronic
1113888019 13:113671176-113671198 AAGGGGCCAGGCCGAGGCCGAGG - Intronic
1117478511 14:56119453-56119475 CATCAGCGAGGCCGGGACCGGGG - Intronic
1119219364 14:72893587-72893609 CAGCGGCGGGGCGGGGGCCGCGG + Intronic
1121201583 14:92122227-92122249 AAGCGGCGGGGGCGAGTCCTCGG - Intronic
1121711082 14:96039584-96039606 CAGCGTGGAGGGCGAGACCGTGG - Intronic
1122632329 14:103112637-103112659 CAGAGGCGGGGCTGAGACCGGGG + Intergenic
1124848104 15:33311105-33311127 CCGCGGCGGGGGCGAGGCCGTGG + Intronic
1128149871 15:65356001-65356023 GAGGGACGAGGGCGAGTCCGGGG - Intronic
1128944017 15:71809539-71809561 GAGCTGTGAGGCCGAGTTCGGGG + Intronic
1131055307 15:89371364-89371386 CAGCGTCGCGGCTGAGTCCTAGG - Intergenic
1132657477 16:1047272-1047294 CATCGGGGAGGCCCTGTCCGTGG + Intergenic
1133257163 16:4524086-4524108 CAGCGGCGAGGCAGGGTCCCAGG - Intronic
1133270014 16:4606535-4606557 CTGGGCCGAGGCCGAGGCCGAGG - Intergenic
1138898922 16:61244679-61244701 CATCTGTGAGGCTGAGTCCGGGG + Intergenic
1142216174 16:88831211-88831233 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216184 16:88831247-88831269 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216194 16:88831283-88831305 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216204 16:88831319-88831341 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216214 16:88831355-88831377 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216224 16:88831391-88831413 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216234 16:88831427-88831449 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216244 16:88831463-88831485 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216254 16:88831499-88831521 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216264 16:88831535-88831557 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216274 16:88831571-88831593 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216284 16:88831607-88831629 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216294 16:88831643-88831665 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216304 16:88831679-88831701 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216314 16:88831715-88831737 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216324 16:88831751-88831773 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216334 16:88831787-88831809 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142450736 16:90171758-90171780 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
1142456829 17:61933-61955 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
1143452223 17:7042930-7042952 CAGCGAGGAGGCCCAGGCCGAGG + Exonic
1143750114 17:9021685-9021707 CGGCGGCGGGGCCGGGACCGGGG + Intronic
1147110462 17:38257425-38257447 GAGCGGCGAGGACGAGGGCGCGG + Intergenic
1147193372 17:38749439-38749461 TAGCGGTGAGGCCGACGCCGGGG + Exonic
1147968607 17:44207465-44207487 CAGCAGCGAGGACGAGAGCGAGG - Exonic
1148122518 17:45221572-45221594 CCGAGGCGAGGCCGAGGCGGCGG - Intronic
1148419045 17:47531006-47531028 GAGCGGCGAGGACGAGGGCGCGG - Intronic
1149350676 17:55783850-55783872 CAGCGACGGTGCCGAGTCCCTGG + Intronic
1149598728 17:57879608-57879630 CACCGGGGAGGCGGAGTCGGGGG + Exonic
1151812539 17:76453004-76453026 CGGCCCGGAGGCCGAGTCCGAGG + Exonic
1157288140 18:46391382-46391404 CAGAGGCGAGGCCTAGTACGGGG + Intronic
1157473731 18:48008422-48008444 CAGCTGCGAGGCGGGGGCCGGGG - Intergenic
1160266538 18:77343739-77343761 CAGCTGCGAGGCTGAGTCTGAGG + Intergenic
1160505511 18:79424146-79424168 CAGCGGCCAGGCCCAGCCAGAGG + Intronic
1160521809 18:79512164-79512186 CTGGGGCGAGGCCGTGTCCTGGG - Intronic
1160521821 18:79512200-79512222 CTGGGGCGAGGCCGTGTCCTGGG - Intronic
1160646746 19:197292-197314 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
1160699133 19:497732-497754 CAGAGGCGGGGCGGGGTCCGGGG + Intronic
1161487443 19:4543696-4543718 CAGCGGCGAGGCCCGGCCTGGGG - Exonic
1161501511 19:4618539-4618561 CAGAGGAGAGGCTGAGTCAGAGG - Intergenic
1161501516 19:4618573-4618595 CAGAGGAGAGGCCGAGTCAGAGG - Intergenic
1161501646 19:4619506-4619528 CAGAGGAGAGGCGGAGTCAGAGG - Intergenic
1161684064 19:5694501-5694523 CAGCGGCGAGGCCGAGTCCGTGG - Exonic
1161779130 19:6279680-6279702 GAGCGGGGAGGCCGGGACCGGGG + Intronic
1161949911 19:7462253-7462275 CAGCCCCGAGGCCTATTCCGTGG + Exonic
1162131107 19:8526674-8526696 CAGGGGCGGGGCCGCGGCCGGGG + Intronic
1165243013 19:34482139-34482161 CAGCGGCGGCCCCGAGGCCGGGG + Exonic
1165454022 19:35900474-35900496 CAGCGCCGAGGCCGCGGCCCTGG - Exonic
1165924887 19:39320807-39320829 CGGCGGCGGGGCCGGGCCCGGGG - Intergenic
1166528439 19:43527333-43527355 CTGGGGCGAGGGCGAGACCGAGG + Intronic
1166873888 19:45885885-45885907 CGGCGGGGAGGCCGAGCCGGAGG - Exonic
1167648919 19:50719352-50719374 CAGCTGCGGGGCCGGGGCCGCGG - Intronic
925006244 2:445066-445088 CGGCGGGGAGGCCCAGGCCGTGG - Intergenic
927869705 2:26615714-26615736 CAGCGGCAAGGCCGAGGCAGGGG + Intronic
928346122 2:30498178-30498200 CAGCTATGAGGCTGAGTCCGGGG + Intronic
928518323 2:32064130-32064152 CGGCGCCGGGGCCGAGGCCGAGG - Exonic
929667220 2:43842386-43842408 CAGCGGAGAGGGCGAGTGAGGGG + Intronic
933908161 2:86914573-86914595 CAAGGCCGAGGCCGAGGCCGAGG - Intronic
934011416 2:87824693-87824715 GAGAGGTGAGGCCGAGGCCGAGG + Intronic
935844015 2:107144972-107144994 CAGCAGCGAGGCCGAGGGAGGGG - Intergenic
937951071 2:127388174-127388196 CGGGGGCGGGGCCGAGGCCGGGG - Intronic
938115786 2:128602250-128602272 CAGCAGCGAGGCTGAGGCCCAGG + Intergenic
940640777 2:156342446-156342468 TGGCCGCGGGGCCGAGTCCGCGG - Intergenic
942346237 2:175005378-175005400 CAGCGGCGCGGCCGAGCTCGTGG - Intergenic
942429664 2:175897481-175897503 CAGCGGCAAGTCCGAGTCTCGGG + Intergenic
943658699 2:190534909-190534931 CAAGGCCGAGGCCGAGGCCGAGG - Intergenic
944615107 2:201451787-201451809 GGGCGGCGAGGCCGCGACCGGGG - Exonic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1174494615 20:50930922-50930944 CAGCGGGGAGGGCGCGCCCGGGG + Exonic
1175443780 20:59007210-59007232 CTGGGCCGAGGCCGAGGCCGGGG - Exonic
1178351003 21:31873247-31873269 CGGCGGCGAGGCGGAGGCTGCGG + Intergenic
1179461257 21:41536773-41536795 CAGAGGTGAGGCTGAGGCCGAGG - Intergenic
1179595224 21:42438670-42438692 CAGCGAGGAGGCCGAGCACGGGG + Intronic
1180559045 22:16601351-16601373 CAGCGGCGGCGGCGCGTCCGCGG + Intergenic
1180960709 22:19761110-19761132 CAGCGCCGCCGCCGAGCCCGAGG + Exonic
1181945361 22:26512639-26512661 CGGCAGGGAGGCCGATTCCGCGG - Intergenic
1182294924 22:29307025-29307047 CGGCGGCGAGGAGGAGGCCGCGG + Exonic
1183661180 22:39222366-39222388 CAGCAGCGCAGCAGAGTCCGTGG - Intergenic
1184033980 22:41910041-41910063 CAGCGGCGCAGGCAAGTCCGGGG + Exonic
949129368 3:482784-482806 CAGCGGCGAGGCTGAGGCGCGGG + Intergenic
950006194 3:9692581-9692603 CAGAGCAGAGGCCGAGGCCGAGG - Intronic
953657020 3:44862107-44862129 CGGCAGCGAGGTCGAGCCCGGGG + Exonic
957704996 3:83769884-83769906 CAGCAGCGAGGCCGTGGCTGGGG + Intergenic
964282217 3:155079607-155079629 CAGCGGCGAGGCGGGGTAGGGGG + Intronic
965913615 3:173814020-173814042 AAGCGGCGAGGCCGAGGGCTAGG + Intronic
967851769 3:194087964-194087986 CAGAGGCAAGGCCCAGTGCGTGG + Intergenic
968370935 3:198222230-198222252 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
968514853 4:1011722-1011744 AGGCGGCGGGGGCGAGTCCGCGG - Intronic
969714057 4:8860064-8860086 CAGGGGCGAAGCCGAGTTCGTGG + Intronic
969873111 4:10116735-10116757 CCTCGCCGAGGCCGAGCCCGGGG + Exonic
979055309 4:115986269-115986291 CATCTGCGAGGCTGAGTCCTGGG - Intergenic
979259621 4:118634718-118634740 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
979328752 4:119405906-119405928 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
979785561 4:124712383-124712405 AAGCTGGGAGGCCGAGGCCGTGG - Intronic
982892853 4:160877561-160877583 CAGCTGTGAGGCTGAGTCCGGGG - Intergenic
988727122 5:33936941-33936963 CAGCGGCGGGGCAGAGAGCGCGG + Exonic
992105510 5:73447172-73447194 CACCGGCGAGGGCGAGGGCGAGG + Exonic
992533432 5:77673605-77673627 CAGCGGCCAGACTGAGTCCCCGG + Intergenic
1001644721 5:173271530-173271552 CAGCAGCAAGGCCGAGGCCCAGG + Intergenic
1002621985 5:180494505-180494527 CAGCGAGGAGGGCGAGGCCGGGG + Intronic
1002730173 5:181327786-181327808 CTGCTGTGAGGCCGAGGCCGAGG - Intergenic
1004442049 6:15662994-15663016 CGGCGGCGAGGACCAGACCGGGG - Exonic
1017935211 6:158999536-158999558 CAGCGCTGAGGCCATGTCCGGGG + Exonic
1019491378 7:1315056-1315078 CAGAGGGGAGGCCGGGTCCCAGG + Intergenic
1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG + Intergenic
1023881609 7:44324467-44324489 CAGGGGCAAAGCCGGGTCCGGGG + Intronic
1024531125 7:50393446-50393468 CAGAGGCAAGGCCAAGTCCTGGG + Intronic
1029240755 7:99160311-99160333 CAGAGGAGAGGCCGGGTGCGTGG - Intergenic
1034618274 7:152436656-152436678 CAGCGGCGGCGGCGCGTCCGCGG - Intergenic
1035228038 7:157444312-157444334 CAGCAGCGAGGCAGAGCCAGCGG + Intergenic
1037262728 8:17026917-17026939 CTGAGGCGCGGCCGAGTGCGGGG - Intergenic
1039136012 8:34323402-34323424 CTGCGACGAGGCCAAGGCCGTGG - Intergenic
1049668511 8:143859327-143859349 CCGGGCCGAGGCCGAGGCCGAGG - Exonic
1050343290 9:4662368-4662390 CAGCTGCGATGCCAAGTCCCCGG + Exonic
1050898206 9:10910823-10910845 CAGAGCAGAGGCCGAGGCCGAGG - Intergenic
1054905910 9:70413589-70413611 CGGCGGCGCGGCGGAGCCCGGGG - Exonic
1056746799 9:89310597-89310619 CCGCGGCGTGGCTGTGTCCGGGG - Intergenic
1057245531 9:93451678-93451700 CCGCTGCGAGGCCGAGGCCGAGG - Intronic
1057592367 9:96383604-96383626 CGGCGGCCAGGCCGAGGCCGAGG - Exonic
1057596409 9:96418742-96418764 CAGCGGCGGGGCGGGGTCGGGGG + Intergenic
1059375183 9:113876045-113876067 CAGCGCGGAGGCCGAGGCCGAGG + Intergenic
1062436663 9:136549383-136549405 CTGAGGCGGGGCCGAGTGCGGGG + Intergenic
1062556265 9:137114597-137114619 CAGAGGCGGGGCCGGGACCGGGG + Intronic
1062627146 9:137448459-137448481 CAGCTGCGCGGCCGGGTCCAGGG + Exonic
1062754584 9:138280300-138280322 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
1203578490 Un_KI270745v1:24460-24482 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
1187464427 X:19515099-19515121 CAGCGGCGAGGGCGAGAGTGGGG - Exonic
1187950420 X:24465328-24465350 CGGCGCCGAGGCCGAGATCGAGG + Intronic
1191251617 X:58262672-58262694 AAGCGGCGAGGCCGAGGGCTAGG + Intergenic
1191251906 X:58263838-58263860 CAGCAGCGAGGCCGAGTGCTAGG + Intergenic
1191252882 X:58267789-58267811 AAGCGGTGAGGCCGAGGACGAGG - Intergenic
1200093873 X:153648220-153648242 GCGCGGGGAGGCCGAGGCCGAGG + Exonic