ID: 1161686175

View in Genome Browser
Species Human (GRCh38)
Location 19:5703778-5703800
Sequence TGGTGACACGCAGGTACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161686172_1161686175 -7 Left 1161686172 19:5703762-5703784 CCTGCTGCAGGCATCTTGGTGAC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1161686175 19:5703778-5703800 TGGTGACACGCAGGTACTGAGGG 0: 1
1: 0
2: 1
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161686175 Original CRISPR TGGTGACACGCAGGTACTGA GGG Intronic
905788616 1:40777970-40777992 TGGTGGCAAGCAGGAATTGAAGG - Intergenic
912050657 1:105524733-105524755 TGGTCGCAAGCAGGTGCTGAAGG - Intergenic
912455385 1:109793260-109793282 GGGTGCCACGCAGTGACTGAGGG + Intergenic
917277188 1:173343327-173343349 AGGTGACATGCAAGTCCTGAAGG + Intergenic
919317996 1:195999578-195999600 TGGTCTCAAGCAGGTCCTGAGGG + Intergenic
921275793 1:213518639-213518661 AGGTCACAGGTAGGTACTGAAGG - Intergenic
923054867 1:230418439-230418461 TGGGGACAGGGAGGTACTGATGG + Intronic
1072687296 10:97545747-97545769 CAGAGACACGCAGGTGCTGAAGG - Intronic
1072809450 10:98447465-98447487 AGGTGGCACCCAGGCACTGAGGG - Intergenic
1075841911 10:125512035-125512057 TGGAGAAATGAAGGTACTGAGGG - Intergenic
1076792003 10:132781762-132781784 TGGTGAGACGCAGGGTCTGGGGG + Intronic
1077301360 11:1848632-1848654 TGGGCACACGCAGGTGCTGGAGG - Intergenic
1080703241 11:34663828-34663850 TGGTGAAACAGAGGTACTGGTGG + Intergenic
1082000012 11:47389128-47389150 TGGTGACAGGCAAGCACTGGAGG + Intergenic
1089647525 11:119889946-119889968 TGGTGACTCGCAGGTGCAGGTGG - Intergenic
1089903632 11:122013798-122013820 TGGGCTCAAGCAGGTACTGAAGG + Intergenic
1091808445 12:3374888-3374910 TCGTGACACTCTGTTACTGATGG + Intergenic
1099232366 12:80041713-80041735 AGGTGATAGGCAGCTACTGAAGG - Intergenic
1108681573 13:52785142-52785164 TGGAGACACGCAGGCACTGGAGG + Intergenic
1114558720 14:23576812-23576834 TGGGGACAGGCAGGTAGAGAGGG + Intronic
1118454748 14:65934307-65934329 TGGTGACTCCCAAGTATTGATGG - Intergenic
1121610253 14:95273760-95273782 TGGAGACACTCAGGCACGGAAGG - Intronic
1127864100 15:63017653-63017675 TGTTGATACTCAGGTACCGATGG + Intergenic
1129661617 15:77555991-77556013 AGGTCACAGGCAGGTCCTGATGG + Intergenic
1132257209 15:100386015-100386037 TGTTGACACCCAGGTGCAGAAGG - Intergenic
1133440519 16:5817333-5817355 TGCTGACAAGCAGGTACTGATGG + Intergenic
1134304760 16:13022117-13022139 TTGAGACACGCAGATACAGAAGG - Intronic
1135301695 16:21334315-21334337 TGGTGACACGCAGGCAAACAGGG - Intergenic
1138517525 16:57544545-57544567 TGGTTCCAGGCAGGCACTGAGGG - Intronic
1139848371 16:69936037-69936059 GGGTGGGAAGCAGGTACTGATGG + Intronic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1143972728 17:10807127-10807149 TGGGGACACGGAGGTGCTGTTGG + Intergenic
1155803888 18:30142254-30142276 GGATTACACCCAGGTACTGAAGG - Intergenic
1156155079 18:34291963-34291985 AGGAGATATGCAGGTACTGAGGG - Intergenic
1156559243 18:38103363-38103385 TGGTGACAAGAAGGGACTGATGG + Intergenic
1157329689 18:46694646-46694668 TGGTAACACTCAGCTCCTGAAGG - Intronic
1157470304 18:47983257-47983279 TGATGAAACGCAGGCACTGATGG - Intergenic
1157520320 18:48341022-48341044 TGGTGGCACTGTGGTACTGAAGG - Intronic
1157870910 18:51229395-51229417 TGGTCTCAAGCAGGTCCTGATGG - Intergenic
1160767372 19:814413-814435 TGGTGAGTGGCAGGTTCTGATGG - Exonic
1161686175 19:5703778-5703800 TGGTGACACGCAGGTACTGAGGG + Intronic
1163934031 19:20425038-20425060 TTCTGTCACTCAGGTACTGAGGG - Intergenic
1164091053 19:21952512-21952534 TGGTGATACCCAGGCACTCAGGG + Intronic
1164542818 19:29133445-29133467 TGGTGACACCCAGGTAAACAGGG + Intergenic
1164980644 19:32611251-32611273 TCGCCACACACAGGTACTGAGGG + Intronic
1167288440 19:48611968-48611990 GGGGGACACGGAGGTGCTGAAGG + Intronic
1168449740 19:56456986-56457008 TGGTGACGTCCAGGTTCTGAGGG - Intronic
926639122 2:15216416-15216438 TGGTGAAACGCAGATACACATGG + Intronic
926977691 2:18531709-18531731 TGGTGACCCACAGCTAGTGAAGG + Intergenic
928399073 2:30965057-30965079 TGGGGACATGGAGGTACTGGGGG + Intronic
934538544 2:95156881-95156903 TGGGGACAAGCAGGTTCTGAGGG - Intronic
934811669 2:97284172-97284194 TGGTAACACATAGGAACTGAGGG + Intergenic
934826022 2:97423768-97423790 TGGTAACACATAGGAACTGAGGG - Intergenic
936995598 2:118410422-118410444 TGGTGATACCCAGGTAAAGAGGG + Intergenic
937398676 2:121562255-121562277 TGGTCACAGGCAGGCCCTGAGGG - Intronic
939288596 2:140164475-140164497 TGGGGAAAGGCAGGTACAGAAGG - Intergenic
940043450 2:149385064-149385086 TGGTCCCACGAAGCTACTGAAGG - Intronic
942431198 2:175913600-175913622 TGGTGACACCCAGGTAAACAGGG - Intergenic
944383744 2:199141479-199141501 TGATGACACCCAGGTTCTGCCGG - Intergenic
1173586854 20:44188873-44188895 TGGTGAAACGCAGATATAGAAGG - Intergenic
1175581978 20:60106852-60106874 TGGTGTCACGGAGTTACTTATGG + Intergenic
1175585440 20:60135631-60135653 TGGTGACATGCAGGTACCTGAGG + Intergenic
1176090108 20:63314909-63314931 TGGGGACACGCATGTCCTGGGGG - Intronic
1177541083 21:22494329-22494351 TGGTGATACCCAGGTAAAGAGGG + Intergenic
1179272525 21:39862408-39862430 AGGTGACACGCAGGCTCTGCAGG + Intergenic
1179710126 21:43208524-43208546 GGGTGACCCCCAGGTCCTGAAGG - Intergenic
1181769330 22:25113946-25113968 TGGTGACAGGCAGGCTCTGTTGG + Intronic
1185212321 22:49577309-49577331 TGGGGGCACGCTGGGACTGAGGG - Intronic
1185212332 22:49577359-49577381 TGGGGGCACGCTGGGACTGAGGG - Intronic
949596744 3:5555799-5555821 AGGAGACACTCAGGTTCTGAAGG - Intergenic
949949382 3:9216663-9216685 TGAGGAAACGGAGGTACTGAGGG + Intronic
950461491 3:13124908-13124930 TGGTGGCACGGAGGTGGTGAGGG - Intergenic
954618783 3:51984112-51984134 TGCGGATACGCAGGTACTGGCGG - Exonic
955001170 3:54929146-54929168 TGGAGACACGCAGCTGGTGATGG - Intronic
955457918 3:59145022-59145044 TAGTTACACGCAGTTACTGCTGG + Intergenic
978078814 4:104567609-104567631 TGGTGATACCCAGGCACAGAGGG - Intergenic
980171200 4:129292242-129292264 TGGTGACACCCAGGCAAAGAGGG - Intergenic
994066534 5:95549507-95549529 TGGAGACATACAGATACTGAAGG - Intronic
999188502 5:149730408-149730430 CGCTGACACGCAGGTACGGCCGG + Exonic
999543805 5:152604488-152604510 AGGTGAGAAGCAGGTACTGTGGG - Intergenic
1010781312 6:79947998-79948020 TGGTGACAGGCATGTGCTGGTGG - Intergenic
1012870977 6:104671907-104671929 TGGTGACACCCAGGTAAACAGGG + Intergenic
1017164267 6:151392110-151392132 TGGTGACACAAAGATACTGCTGG - Intergenic
1017510598 6:155111512-155111534 CAGTGACATGCAGGTAATGAAGG + Intronic
1018767599 6:166946025-166946047 TGGTTACACACAGGAACTGTTGG + Intronic
1019123732 6:169825441-169825463 TGGAGAGACGCAGGTGCTGATGG - Intergenic
1023853208 7:44162314-44162336 TGGTGCCCAGCTGGTACTGAGGG - Intronic
1026350001 7:69507565-69507587 TGTTCACAAGCAGTTACTGATGG - Intergenic
1033237748 7:139651507-139651529 TGGTGACACACACGTGCAGAGGG - Intronic
1034677746 7:152903559-152903581 AGGTGACAGGCAGGTGCGGAAGG - Intergenic
1035562164 8:613903-613925 AGGTGACAGGCAGGTGGTGATGG + Intergenic
1037483631 8:19327575-19327597 GGGTGACACCCAGGGAATGATGG - Intronic
1037617706 8:20534329-20534351 TGGTGACACGTAGGTACAGCTGG - Intergenic
1040315595 8:46259230-46259252 GGGTGGGCCGCAGGTACTGAGGG + Intergenic
1049513777 8:143043066-143043088 TGGTGACGCACAGGGACAGAGGG + Exonic
1050528283 9:6564748-6564770 TGGGGACCAGCAGGTACTAATGG - Intronic
1057290437 9:93802857-93802879 TGGTGACTTCCAGGAACTGAAGG + Intergenic
1057827170 9:98380203-98380225 TGGTGACTCGCAGAGGCTGAGGG + Intronic
1060439922 9:123628688-123628710 TGGTGACGTCCAGGTACTGCTGG - Intronic
1061842487 9:133367430-133367452 TTGTGACACGGAGGAACTGCAGG + Exonic
1186073729 X:5852939-5852961 GGGTGACAGACAGGTACAGATGG - Intronic
1186341321 X:8649223-8649245 TGGTGAGAGGCAGGTATGGATGG + Intronic
1186354308 X:8773780-8773802 TGGTGACACCCAGGCAAAGAGGG + Intergenic
1195814560 X:108870731-108870753 TGGTGATGAGCAGGAACTGAGGG - Intergenic
1196094593 X:111785250-111785272 TGGGGACACGCAGGTAAACAGGG + Intronic
1196430869 X:115623781-115623803 TGGTGAGCCACAGTTACTGATGG - Intronic
1202065068 Y:20930236-20930258 TGGTGACACCCAGGAAAAGAGGG + Intergenic