ID: 1161687753

View in Genome Browser
Species Human (GRCh38)
Location 19:5711788-5711810
Sequence CGTTGTCCACGAGGACTTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161687753_1161687764 23 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687764 19:5711834-5711856 CTCAGCCGGGAGCTCAGGGGTGG 0: 1
1: 0
2: 6
3: 39
4: 303
1161687753_1161687756 9 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687756 19:5711820-5711842 TCCACCATGAGCACCTCAGCCGG 0: 1
1: 0
2: 1
3: 22
4: 153
1161687753_1161687760 18 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687760 19:5711829-5711851 AGCACCTCAGCCGGGAGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 196
1161687753_1161687765 24 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687765 19:5711835-5711857 TCAGCCGGGAGCTCAGGGGTGGG 0: 1
1: 0
2: 2
3: 24
4: 259
1161687753_1161687762 20 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687762 19:5711831-5711853 CACCTCAGCCGGGAGCTCAGGGG 0: 1
1: 0
2: 1
3: 25
4: 274
1161687753_1161687761 19 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687761 19:5711830-5711852 GCACCTCAGCCGGGAGCTCAGGG 0: 1
1: 0
2: 3
3: 17
4: 235
1161687753_1161687758 10 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687758 19:5711821-5711843 CCACCATGAGCACCTCAGCCGGG 0: 1
1: 1
2: 2
3: 28
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161687753 Original CRISPR CGTTGTCCACGAGGACTTCC AGG (reversed) Exonic