ID: 1161687753

View in Genome Browser
Species Human (GRCh38)
Location 19:5711788-5711810
Sequence CGTTGTCCACGAGGACTTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161687753_1161687764 23 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687764 19:5711834-5711856 CTCAGCCGGGAGCTCAGGGGTGG 0: 1
1: 0
2: 6
3: 39
4: 303
1161687753_1161687760 18 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687760 19:5711829-5711851 AGCACCTCAGCCGGGAGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 196
1161687753_1161687761 19 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687761 19:5711830-5711852 GCACCTCAGCCGGGAGCTCAGGG 0: 1
1: 0
2: 3
3: 17
4: 235
1161687753_1161687756 9 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687756 19:5711820-5711842 TCCACCATGAGCACCTCAGCCGG 0: 1
1: 0
2: 1
3: 22
4: 153
1161687753_1161687765 24 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687765 19:5711835-5711857 TCAGCCGGGAGCTCAGGGGTGGG 0: 1
1: 0
2: 2
3: 24
4: 259
1161687753_1161687758 10 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687758 19:5711821-5711843 CCACCATGAGCACCTCAGCCGGG 0: 1
1: 1
2: 2
3: 28
4: 283
1161687753_1161687762 20 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687762 19:5711831-5711853 CACCTCAGCCGGGAGCTCAGGGG 0: 1
1: 0
2: 1
3: 25
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161687753 Original CRISPR CGTTGTCCACGAGGACTTCC AGG (reversed) Exonic
900463225 1:2811206-2811228 TCTTGTCCCCGAGGAATTCCTGG - Intergenic
900893438 1:5466195-5466217 AGTAGTCAAAGAGGACTTCCTGG + Intergenic
902775955 1:18675165-18675187 TGTAGTGCACGATGACTTCCTGG + Intronic
918335837 1:183511891-183511913 AGTTGTCATGGAGGACTTCCAGG + Intronic
918451267 1:184661413-184661435 CGTTCTTCAAGAGGACTTCATGG - Intergenic
919377138 1:196808851-196808873 TGTGGGCCAGGAGGACTTCCAGG + Intergenic
919386846 1:196933752-196933774 TGTGGGCCAGGAGGACTTCCGGG + Intronic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
924585370 1:245356887-245356909 CCTTTTCAACGAGGCCTTCCTGG - Intronic
1063619792 10:7635860-7635882 CCTGGTCCAAGAAGACTTCCTGG + Intronic
1069728955 10:70598964-70598986 CGTTGTCCGTGAGCCCTTCCAGG + Exonic
1083991088 11:66246224-66246246 AAGTGCCCACGAGGACTTCCCGG + Intergenic
1089462905 11:118663101-118663123 GTTTGTCCACGAACACTTCCAGG - Exonic
1089655891 11:119946698-119946720 AGGAGTCCAGGAGGACTTCCAGG + Intergenic
1090738404 11:129633090-129633112 GGATGTCCTCTAGGACTTCCTGG + Intergenic
1094199433 12:27780918-27780940 CGTGGCCCTCGGGGACTTCCTGG + Exonic
1098973406 12:76878702-76878724 CCTTGTCCCCGAGGCCGTCCAGG - Intronic
1105773151 13:23632073-23632095 CCTTTTCCAAGAGGACTTCCTGG + Intronic
1121453440 14:94023874-94023896 CATTGTCCATGAGGCCTTCCCGG - Intergenic
1122093703 14:99356218-99356240 CCCTGTCCAAGAGGCCTTCCTGG - Intergenic
1122177492 14:99931880-99931902 CGTTGACCGCGACGACTGCCCGG - Intronic
1125057601 15:35380449-35380471 TGTTGTCCATAAAGACTTCCAGG + Intronic
1132845374 16:1998800-1998822 CCTAGTCCCCGAGAACTTCCGGG - Exonic
1138389629 16:56660957-56660979 ATTTGTCCACGTGCACTTCCTGG + Intronic
1142769884 17:2089053-2089075 CTTGGTCTAGGAGGACTTCCTGG + Intronic
1144605521 17:16662271-16662293 AGTAGTACAGGAGGACTTCCTGG - Intergenic
1145222313 17:21099515-21099537 CGTTTTCCCCAAGGACTTGCTGG - Intergenic
1145921759 17:28614962-28614984 CGTTATCCACGAGGATTTGTGGG - Exonic
1147649573 17:42054231-42054253 CTTTGTCCACAGGGACCTCCAGG + Intronic
1150097580 17:62391222-62391244 CGTGATCCACGAGGATCTCCTGG + Intronic
1152234239 17:79130256-79130278 ACTTCTCCACGAAGACTTCCTGG + Intronic
1152367370 17:79864286-79864308 CGTTGTGCAGGAGGTCTTCCTGG - Intergenic
1156352126 18:36310757-36310779 CCTTCTCCACGAGGCTTTCCAGG - Intronic
1161258739 19:3323831-3323853 CCTAGTCCAGGAGGGCTTCCTGG - Intergenic
1161543536 19:4866786-4866808 CTCTGTCCACCATGACTTCCTGG + Intronic
1161687753 19:5711788-5711810 CGTTGTCCACGAGGACTTCCAGG - Exonic
1165354594 19:35295803-35295825 AGTAGTCCACGAGAGCTTCCAGG + Exonic
1166876390 19:45900429-45900451 GGTGGTCCAGGAGGGCTTCCTGG - Intronic
934188859 2:89767251-89767273 CGATGTCCAGGATGGCTTCCAGG + Intergenic
934307734 2:91840702-91840724 CGATGTCCAGGATGGCTTCCAGG - Intergenic
935868445 2:107417896-107417918 AGATGTCCAGGAGGCCTTCCAGG + Intergenic
948768844 2:240236999-240237021 AGGTGTCCATGAGGGCTTCCAGG - Intergenic
1169571623 20:6912721-6912743 CTTCCTCCAGGAGGACTTCCTGG - Intergenic
1171218915 20:23375829-23375851 AGGTGGCCACGAGGACTTGCAGG - Exonic
1172618365 20:36305076-36305098 CGCTGCCCAAGAGGGCTTCCTGG - Intergenic
1176140165 20:63541486-63541508 CGTCGTCCACGAGCACGTTCCGG + Exonic
1180534813 22:16387784-16387806 CGATGTCCAGGATGGCTTCCAGG - Intergenic
1183736041 22:39645508-39645530 CCTTGTCCACAAGCATTTCCTGG - Intronic
1184871156 22:47239309-47239331 CGTTGTCCACGGGGAGTCACAGG + Intergenic
954746572 3:52790845-52790867 CTCGGTCCACCAGGACTTCCTGG + Exonic
961364401 3:126390104-126390126 CGCTGTTGACGAGGACTTTCGGG - Intergenic
962916009 3:139904332-139904354 GGATGTCAAGGAGGACTTCCTGG + Intergenic
966224370 3:177582246-177582268 TGTTGCCCAAGAGAACTTCCAGG + Intergenic
968655335 4:1776111-1776133 CTTTTTCCTGGAGGACTTCCTGG - Intergenic
970464835 4:16312049-16312071 TGTTCTCCATGAGGACTTTCTGG + Intergenic
980093400 4:128465368-128465390 CCTTGTACATGAGGACTTCAGGG + Intergenic
982688390 4:158520316-158520338 CATTGTTAACGAGTACTTCCTGG + Intronic
988609646 5:32712430-32712452 GGGGGTCCACGAGGTCTTCCAGG + Exonic
997595062 5:135101779-135101801 CCTTCTCCAGGAGGGCTTCCAGG - Intronic
998286005 5:140861542-140861564 GCTTGTCCACGATCACTTCCAGG - Intronic
999217077 5:149944298-149944320 TGCTGTCCTCGAGGACTGCCTGG - Exonic
1008374314 6:50773845-50773867 CATTGGCCACCAGCACTTCCAGG - Intergenic
1014432627 6:121388684-121388706 TGTGGTCCAGGAGGGCTTCCTGG - Intergenic
1027280879 7:76608717-76608739 TGTTGCCCACGAGGACTGGCAGG + Intergenic
1029383964 7:100231474-100231496 CGTGGTCATGGAGGACTTCCTGG - Intronic
1031575489 7:123410854-123410876 CATTGTCAAGGAGGACTTCAGGG - Intergenic
1031752782 7:125597891-125597913 ACTTGCCCACGAGCACTTCCTGG - Intergenic
1034846862 7:154454465-154454487 CATTCTCCACGAAGCCTTCCAGG - Intronic
1037193352 8:16155072-16155094 AGTGGTCCACGAGGATTTCCAGG - Exonic
1044438627 8:92196250-92196272 CGTTGTCCATGGGTACTTCTGGG + Intergenic
1045664019 8:104466860-104466882 CGTGGTCAACGATGACTTCTCGG - Exonic
1047195275 8:122715481-122715503 GGTTGTCAGGGAGGACTTCCTGG - Intergenic
1049090039 8:140507699-140507721 TGTTGTCCTTGAGAACTTCCTGG - Intergenic
1058923964 9:109643569-109643591 CTTTGTTCACAAGGAGTTCCAGG - Intronic
1059044697 9:110853601-110853623 CATAGTTCACGTGGACTTCCCGG + Intergenic
1059421807 9:114196882-114196904 GGTGCTCCAGGAGGACTTCCTGG - Intronic
1190217483 X:48489500-48489522 CGTGGCCCACGAGGCCCTCCGGG - Intergenic
1190232156 X:48590514-48590536 CGTGGCCCACGAGGCCCTCCGGG - Intronic
1195790364 X:108577958-108577980 CCTGGTCCACCAGGACTTCCAGG + Exonic
1195792717 X:108606772-108606794 CCTGGGCCACCAGGACTTCCAGG + Exonic
1200799948 Y:7377410-7377432 TGTTGTCAACAAGGAATTCCTGG - Intergenic