ID: 1161687760

View in Genome Browser
Species Human (GRCh38)
Location 19:5711829-5711851
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161687753_1161687760 18 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687760 19:5711829-5711851 AGCACCTCAGCCGGGAGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 196
1161687749_1161687760 30 Left 1161687749 19:5711776-5711798 CCTCCTCCGTGACCTGGAAGTCC 0: 1
1: 0
2: 1
3: 17
4: 134
Right 1161687760 19:5711829-5711851 AGCACCTCAGCCGGGAGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 196
1161687754_1161687760 9 Left 1161687754 19:5711797-5711819 CCTCGTGGACAACGTTCTCTACC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1161687760 19:5711829-5711851 AGCACCTCAGCCGGGAGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 196
1161687750_1161687760 27 Left 1161687750 19:5711779-5711801 CCTCCGTGACCTGGAAGTCCTCG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1161687760 19:5711829-5711851 AGCACCTCAGCCGGGAGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 196
1161687751_1161687760 24 Left 1161687751 19:5711782-5711804 CCGTGACCTGGAAGTCCTCGTGG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1161687760 19:5711829-5711851 AGCACCTCAGCCGGGAGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type