ID: 1161687761

View in Genome Browser
Species Human (GRCh38)
Location 19:5711830-5711852
Sequence GCACCTCAGCCGGGAGCTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161687751_1161687761 25 Left 1161687751 19:5711782-5711804 CCGTGACCTGGAAGTCCTCGTGG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1161687761 19:5711830-5711852 GCACCTCAGCCGGGAGCTCAGGG 0: 1
1: 0
2: 3
3: 17
4: 235
1161687753_1161687761 19 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687761 19:5711830-5711852 GCACCTCAGCCGGGAGCTCAGGG 0: 1
1: 0
2: 3
3: 17
4: 235
1161687754_1161687761 10 Left 1161687754 19:5711797-5711819 CCTCGTGGACAACGTTCTCTACC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1161687761 19:5711830-5711852 GCACCTCAGCCGGGAGCTCAGGG 0: 1
1: 0
2: 3
3: 17
4: 235
1161687750_1161687761 28 Left 1161687750 19:5711779-5711801 CCTCCGTGACCTGGAAGTCCTCG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1161687761 19:5711830-5711852 GCACCTCAGCCGGGAGCTCAGGG 0: 1
1: 0
2: 3
3: 17
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161687761 Original CRISPR GCACCTCAGCCGGGAGCTCA GGG Exonic