ID: 1161687762

View in Genome Browser
Species Human (GRCh38)
Location 19:5711831-5711853
Sequence CACCTCAGCCGGGAGCTCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 274}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161687754_1161687762 11 Left 1161687754 19:5711797-5711819 CCTCGTGGACAACGTTCTCTACC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1161687762 19:5711831-5711853 CACCTCAGCCGGGAGCTCAGGGG 0: 1
1: 0
2: 1
3: 25
4: 274
1161687750_1161687762 29 Left 1161687750 19:5711779-5711801 CCTCCGTGACCTGGAAGTCCTCG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1161687762 19:5711831-5711853 CACCTCAGCCGGGAGCTCAGGGG 0: 1
1: 0
2: 1
3: 25
4: 274
1161687755_1161687762 -10 Left 1161687755 19:5711818-5711840 CCTCCACCATGAGCACCTCAGCC 0: 1
1: 0
2: 6
3: 86
4: 523
Right 1161687762 19:5711831-5711853 CACCTCAGCCGGGAGCTCAGGGG 0: 1
1: 0
2: 1
3: 25
4: 274
1161687753_1161687762 20 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687762 19:5711831-5711853 CACCTCAGCCGGGAGCTCAGGGG 0: 1
1: 0
2: 1
3: 25
4: 274
1161687751_1161687762 26 Left 1161687751 19:5711782-5711804 CCGTGACCTGGAAGTCCTCGTGG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1161687762 19:5711831-5711853 CACCTCAGCCGGGAGCTCAGGGG 0: 1
1: 0
2: 1
3: 25
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161687762 Original CRISPR CACCTCAGCCGGGAGCTCAG GGG Exonic