ID: 1161687765

View in Genome Browser
Species Human (GRCh38)
Location 19:5711835-5711857
Sequence TCAGCCGGGAGCTCAGGGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 259}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161687755_1161687765 -6 Left 1161687755 19:5711818-5711840 CCTCCACCATGAGCACCTCAGCC 0: 1
1: 0
2: 6
3: 86
4: 523
Right 1161687765 19:5711835-5711857 TCAGCCGGGAGCTCAGGGGTGGG 0: 1
1: 0
2: 2
3: 24
4: 259
1161687754_1161687765 15 Left 1161687754 19:5711797-5711819 CCTCGTGGACAACGTTCTCTACC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1161687765 19:5711835-5711857 TCAGCCGGGAGCTCAGGGGTGGG 0: 1
1: 0
2: 2
3: 24
4: 259
1161687753_1161687765 24 Left 1161687753 19:5711788-5711810 CCTGGAAGTCCTCGTGGACAACG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1161687765 19:5711835-5711857 TCAGCCGGGAGCTCAGGGGTGGG 0: 1
1: 0
2: 2
3: 24
4: 259
1161687757_1161687765 -9 Left 1161687757 19:5711821-5711843 CCACCATGAGCACCTCAGCCGGG 0: 1
1: 0
2: 1
3: 25
4: 141
Right 1161687765 19:5711835-5711857 TCAGCCGGGAGCTCAGGGGTGGG 0: 1
1: 0
2: 2
3: 24
4: 259
1161687751_1161687765 30 Left 1161687751 19:5711782-5711804 CCGTGACCTGGAAGTCCTCGTGG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1161687765 19:5711835-5711857 TCAGCCGGGAGCTCAGGGGTGGG 0: 1
1: 0
2: 2
3: 24
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161687765 Original CRISPR TCAGCCGGGAGCTCAGGGGT GGG Exonic