ID: 1161690092

View in Genome Browser
Species Human (GRCh38)
Location 19:5727273-5727295
Sequence TTGTTGTAGGATGAAAATAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161690092_1161690095 26 Left 1161690092 19:5727273-5727295 CCTGTATTTTCATCCTACAACAA 0: 1
1: 0
2: 2
3: 6
4: 212
Right 1161690095 19:5727322-5727344 AAAAATATAGCACTATATCTAGG 0: 1
1: 1
2: 2
3: 37
4: 442
1161690092_1161690096 27 Left 1161690092 19:5727273-5727295 CCTGTATTTTCATCCTACAACAA 0: 1
1: 0
2: 2
3: 6
4: 212
Right 1161690096 19:5727323-5727345 AAAATATAGCACTATATCTAGGG 0: 1
1: 0
2: 2
3: 20
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161690092 Original CRISPR TTGTTGTAGGATGAAAATAC AGG (reversed) Exonic
901737754 1:11323117-11323139 TGGTTGTAGGAGGAAGACACTGG - Intergenic
902539300 1:17141524-17141546 TTCTTGTAGGATGAAAGCAGAGG - Intergenic
904885169 1:33732263-33732285 TTGTTGAAGGAATGAAATACTGG + Intronic
905491210 1:38345304-38345326 TTGGTGTTGGATGAGAATAGAGG + Intergenic
907710825 1:56879261-56879283 TTTTTGTAAGAGGAAAATATGGG - Intronic
907865989 1:58399733-58399755 TTGTTGTAGGATTAAAGTGTTGG - Intronic
908141586 1:61190475-61190497 CTGTTTTAGAAGGAAAATACTGG - Intronic
908712844 1:67037003-67037025 TTGTTGTCAGCTTAAAATACTGG - Intronic
908821069 1:68087175-68087197 TTGTTTGAAGCTGAAAATACTGG - Intergenic
910016965 1:82536852-82536874 TTGATGTAAGAAAAAAATACTGG + Intergenic
910709488 1:90164972-90164994 TTGTTGTAGGGTGACAAGGCAGG + Intergenic
911735070 1:101328128-101328150 TTGTGGTAGGAATAAAATAGGGG + Intergenic
911787144 1:101965299-101965321 ATGTTGTAGAATTAAAATGCGGG + Intronic
911971780 1:104447926-104447948 AAGTTTTAGGATGAAAATATAGG + Intergenic
913332528 1:117679232-117679254 CGGTTGTAGAATGAAAATGCTGG + Intergenic
913543986 1:119848549-119848571 TTGTTTTTTAATGAAAATACAGG + Intergenic
913671826 1:121104443-121104465 TTGTTGTAGTGTGAAAGCACAGG - Intergenic
914023604 1:143891888-143891910 TTGTTGTAGTGTGAAAGCACAGG - Intergenic
914662076 1:149799833-149799855 TTGTTGTAGTGTGAAAGCACAGG - Intronic
915398450 1:155604569-155604591 ATTTTGTACGTTGAAAATACTGG + Intergenic
915415886 1:155742687-155742709 ATTTTGTACGTTGAAAATACTGG + Intergenic
917215547 1:172674701-172674723 TTGTTTCAGGATTAAAATATAGG - Intergenic
917567462 1:176227706-176227728 TTATTGTAGGATTAAAACAGAGG + Intergenic
918137144 1:181683906-181683928 TTGTTCTACGATAAAAACACAGG - Intronic
918186870 1:182135404-182135426 TTGTTCTAGCATTAAAATTCTGG + Intergenic
918312557 1:183295625-183295647 TTTTTAGGGGATGAAAATACTGG - Intronic
922147265 1:222959747-222959769 TTGTTATAGGCTCAAAATAAAGG + Intronic
924181851 1:241446777-241446799 TTGTTGTAGTATTAAAAGATGGG + Intergenic
1063047394 10:2406211-2406233 TTGCTGTAGGATGACATCACAGG + Intergenic
1064750815 10:18526716-18526738 TTGTTGTGGAAAGAACATACAGG - Intronic
1068423433 10:56824004-56824026 TTGTTGTTCAAGGAAAATACTGG - Intergenic
1069394680 10:67975948-67975970 TTCTTTTAGGATGAAAATTTTGG - Intronic
1070154630 10:73825781-73825803 GTGTTGTAAGAAGGAAATACAGG - Intronic
1071337248 10:84611038-84611060 TTGTTGGAGGATGAAAAGGTAGG - Intergenic
1073883569 10:108010968-108010990 TTATTTTAGGATAAAAAAACAGG + Intergenic
1075771080 10:124936482-124936504 TTGTTGTGAGAAGAAAATAAGGG + Intergenic
1075951970 10:126486535-126486557 TATTTCTAAGATGAAAATACAGG - Intronic
1079011157 11:16829460-16829482 TTCCAGTAGGAGGAAAATACGGG + Intronic
1080631914 11:34085462-34085484 TTATTTTAGGATGTAAACACAGG + Intronic
1081163266 11:39777579-39777601 TGGATGTGGGATGAAAATATGGG - Intergenic
1087137051 11:94731493-94731515 TTGAAGTAGGATGAGGATACTGG + Intronic
1088573835 11:111250451-111250473 TTGTTTTTGGTTGAAAATAATGG - Intergenic
1088633910 11:111800648-111800670 GTGTTGTAAGAGGAAAGTACAGG - Intronic
1091504716 12:1055774-1055796 TTTTTGTAAAATGAAAATAATGG + Intronic
1092067171 12:5600464-5600486 TTGGTGTAGAATGATAATAATGG + Intronic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1094585134 12:31770920-31770942 TTGTTGAACAAAGAAAATACAGG + Intergenic
1095428212 12:42101973-42101995 TTTATGTAGAATGAAAAGACAGG - Intronic
1097698329 12:62796152-62796174 TTGTTGTGGGATGAGAACAGAGG - Intronic
1099647525 12:85378326-85378348 TAGTTGTAGGAAGTAAAAACAGG + Intergenic
1099907390 12:88788622-88788644 TTTTTGTATGAGGATAATACTGG - Intergenic
1101390523 12:104295650-104295672 TTGTGGTAGGAAGAGAAGACAGG - Intronic
1106931069 13:34666136-34666158 TTGAGGAATGATGAAAATACTGG - Intergenic
1108786918 13:53914931-53914953 TGTTTGTCAGATGAAAATACTGG + Intergenic
1108954983 13:56141951-56141973 TTTTTCTAGGATGAAAACAGTGG - Intergenic
1109255292 13:60073006-60073028 TTGTGTTATGATGAAAATATAGG + Intronic
1109999410 13:70175384-70175406 TCATTGAAGGATGAAAGTACAGG + Intergenic
1110823508 13:79944509-79944531 TTTTTGTATTATGAAAATCCTGG - Intergenic
1112868638 13:103940472-103940494 CTGATGTAGGCTGAAAATAATGG + Intergenic
1117144546 14:52823862-52823884 TTGTTTTAAGATAAAAATTCTGG + Intergenic
1119627598 14:76193535-76193557 TTATTGAAGGATAAACATACAGG + Intronic
1120267820 14:82274104-82274126 GTGATGTAAGATGAAAATATTGG + Intergenic
1121063952 14:90943590-90943612 GTGTTGTAGGATGAAAAACAAGG - Intronic
1126045549 15:44636185-44636207 ATGTTGGAGGAAGAAAAAACAGG + Intronic
1127056126 15:55133950-55133972 GTGTGGCAGGATGAGAATACTGG - Intergenic
1130484001 15:84387406-84387428 ATGTTGTGGGAGGGAAATACAGG - Intergenic
1132493876 16:250666-250688 TTGTGGGATGATGAAAATAGTGG - Intronic
1135394742 16:22122624-22122646 TTGGTGGAGGATGAAAAAACAGG + Intronic
1138078021 16:54062000-54062022 CTGTTGTGGGATCAAAATAAAGG + Intronic
1139124828 16:64065578-64065600 TTTTTGAAGGAAGAAAATAAGGG + Intergenic
1140525572 16:75620022-75620044 TGGTTTGAGCATGAAAATACTGG + Intronic
1140867133 16:79072762-79072784 ATGTTGTATGATAAATATACAGG - Intronic
1149463866 17:56858160-56858182 TTTTTGGAAGATGACAATACAGG - Intronic
1150313786 17:64151462-64151484 GGGGTGTAGGATGAAAAAACAGG - Intronic
1150582914 17:66491718-66491740 TTGTTGAAAGAGGAAAAGACTGG - Intronic
1151543871 17:74780047-74780069 TTGTTGTGTGATCAAAATACAGG + Intronic
1156632774 18:38990104-38990126 TTCCTGTAGGAAGAAAATGCAGG - Intergenic
1157079065 18:44501719-44501741 TTTTTTTAAGATGAAAAAACTGG - Intergenic
1158475376 18:57774960-57774982 TTGTTGTATGATGAACACCCAGG + Intronic
1158748783 18:60234131-60234153 ATGATGAAGGAAGAAAATACTGG - Intergenic
1161690092 19:5727273-5727295 TTGTTGTAGGATGAAAATACAGG - Exonic
925724780 2:6862375-6862397 TTGGTGCAGGATGCAAATGCAGG + Intronic
925858113 2:8149947-8149969 TTGTTCCAGGAGGAAAATCCTGG + Intergenic
926822153 2:16864073-16864095 TTGCTGGAGGATGTAAAAACTGG + Intergenic
927803485 2:26123088-26123110 TTGTTGAATGATCAAAAAACTGG - Intronic
931606739 2:64060417-64060439 ATGTTCTAGTATGAAAATTCTGG + Intergenic
932046733 2:68357557-68357579 TTGCTGTAGGAAAAAAAAACCGG + Intergenic
934991676 2:98925976-98925998 TTTTTGTAGCATATAAATACTGG - Intronic
936855476 2:116952882-116952904 TTGTTTTAGGAAAAAAATAAGGG + Intergenic
936956806 2:118030607-118030629 TTGTTGTAGGGTTAAAACAGAGG + Intergenic
938656528 2:133440387-133440409 CTGTTGTTGAATGAAAACACTGG + Intronic
942617207 2:177805271-177805293 TTCTTGTAAGGAGAAAATACAGG - Intronic
942812677 2:180017328-180017350 TTCCTGTAGGGTGAAAATCCAGG + Intergenic
943427677 2:187757005-187757027 TTGTTATAAGCTGAAAATAATGG - Intergenic
945454457 2:210034095-210034117 TTGTTGTTGGATGAATAAAAGGG - Intronic
945813928 2:214580755-214580777 TTGTTGGAGGAAGAAAAAAAAGG + Intergenic
1169545539 20:6646716-6646738 TTGGTCTAGGAGGAAAATAAGGG + Intergenic
1169572982 20:6926782-6926804 TGGTTGAATGAGGAAAATACAGG + Intergenic
1170417533 20:16160291-16160313 TTGTTGCTGGATGCAAAGACAGG - Intergenic
1172187252 20:33038667-33038689 ATGTTGTTGGATGAAAAAGCAGG - Intronic
1173732556 20:45338907-45338929 TTGCTGTAGGAGGGAAATCCTGG - Intronic
1177354135 21:19984785-19984807 TTGTGGGAGGATAAAAATAGTGG + Intergenic
1177830952 21:26138356-26138378 ATGTTATAGGATCAAAATATGGG + Intronic
1178009707 21:28270149-28270171 GTGTTGTAGGAGGAAACTAGTGG - Intergenic
1181502393 22:23324048-23324070 TTTTTGGAGGAAAAAAATACTGG - Intergenic
1181653258 22:24272793-24272815 TTTTTGGAGGAAAAAAATACTGG - Intronic
949182211 3:1145922-1145944 TTGTTTTAGGAAGAAAATTTTGG + Intronic
952109219 3:30103606-30103628 TTGTTGAAGGATGAAGATGAAGG + Intergenic
952600775 3:35079545-35079567 TTGTTTTACAATGAAAGTACTGG + Intergenic
953942743 3:47115194-47115216 TTGCTGGAGGATGAAAAGACAGG + Intronic
954925703 3:54232415-54232437 TTATTGTAGGATTACTATACTGG + Intronic
955371084 3:58352593-58352615 TTGATGTAAGATGGAATTACTGG + Intronic
955934119 3:64086497-64086519 TTCTTCTAGGATGAAAAGTCTGG - Intergenic
957267981 3:77992022-77992044 TTGTTATCGGATTAAAATAATGG - Intergenic
958930992 3:100208008-100208030 TTCTTGTGGGAAGAAAATAAGGG - Intergenic
959852034 3:111098783-111098805 ATATTGCAGGTTGAAAATACAGG - Intronic
960023793 3:112986443-112986465 TTGTATTAGGAAGAAAATATTGG - Intergenic
960179428 3:114557737-114557759 TTGGTGTAGTATGCAATTACAGG - Intronic
960189107 3:114681707-114681729 TTGTTGTAGGATTAAATGATTGG - Intronic
960319160 3:116213244-116213266 ATGTTGTAGGAGGAACATAGTGG + Intronic
962038500 3:131680370-131680392 TTGTTGTCAGTTGAAAATAATGG - Intronic
963499095 3:146102048-146102070 TTGTTGTGGGAAGAAAATACTGG - Intronic
963507929 3:146210692-146210714 TTCTGGTATGATGAAAATTCTGG - Intronic
963572847 3:147019382-147019404 TTGGTGTAGGATATAAAGACTGG - Intergenic
965147080 3:164920013-164920035 TTTCTGAAGGATGAAAATAAAGG + Intergenic
965960260 3:174421137-174421159 ATGTAGTAGGATGAGAAAACAGG - Intergenic
967491820 3:190100780-190100802 TTTTTGAAGTATGTAAATACAGG + Intronic
967681442 3:192368742-192368764 TTGTTGTAGCATGAAAGCAGAGG - Intronic
969120395 4:4904497-4904519 TTATTGTAGTAGGAAAATCCGGG - Intergenic
971529775 4:27672100-27672122 TTAGTGTTGTATGAAAATACTGG + Intergenic
971702196 4:29992828-29992850 TTTATGTAGGAGGAAATTACAGG + Intergenic
972379848 4:38509657-38509679 TTGTTGTGGGGTGAAACTAGAGG + Intergenic
972994271 4:44860853-44860875 TTGTTATTTGATTAAAATACAGG - Intergenic
974285482 4:59860882-59860904 TTTTGGTAGCAGGAAAATACTGG + Intergenic
974449652 4:62036991-62037013 TGGTTGTAGTATAAAATTACAGG - Intronic
979903796 4:126257770-126257792 TTGTAGGAGGATGAAAATTTGGG + Intergenic
979994428 4:127413566-127413588 TTGTTGTTGGCTTAAAATATAGG - Intergenic
981469794 4:145119131-145119153 GTGTTCTAGGATGAGGATACAGG + Intronic
981647203 4:147012901-147012923 TTGTTTTTGGATTAAAATATAGG - Intergenic
981900921 4:149861775-149861797 TTGTCGTAAGAAAAAAATACTGG - Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
983117701 4:163839684-163839706 TAGTTGGAGGAGGCAAATACTGG + Intronic
984476481 4:180241912-180241934 TTGTTGTCGAATGAATATAAGGG - Intergenic
984870480 4:184320363-184320385 TTGTTGTAGGCTGAATATTAAGG - Intergenic
984977441 4:185242184-185242206 TTGTTGTGGTATGAAAGTAGAGG - Intronic
986354045 5:6906602-6906624 CTGTTGTAAGATGAGAAAACTGG + Intergenic
988427183 5:31077356-31077378 TTGTTGCACGTTGAAAATAAGGG - Intergenic
990752128 5:59028221-59028243 TCCTTGAAGGATGAAAATAAAGG + Intronic
991963741 5:72070880-72070902 TTATTTTAGGACGAAAATAAGGG + Intergenic
992809039 5:80367809-80367831 TTTTTTTAGGAGAAAAATACTGG + Intergenic
993190719 5:84676695-84676717 TTGTTTTAGGAAAAAAATAGAGG - Intergenic
993464471 5:88228147-88228169 TAGTTGTAGGATAAAGATATGGG + Intronic
993574267 5:89581945-89581967 ATTTTGTAGGAGGAAAATATTGG - Intergenic
994141869 5:96350502-96350524 TTGTTTTAGGGTGAAGATATTGG + Intergenic
994381355 5:99075560-99075582 TTGTAATATGATGAAAATAATGG + Intergenic
995242439 5:109900358-109900380 TTGTTGGAAGTTGAAAATATTGG + Intergenic
996468856 5:123835997-123836019 TTCTTATTGTATGAAAATACTGG - Intergenic
998085868 5:139322104-139322126 TTTTTGTATGCTAAAAATACAGG + Intronic
998238287 5:140419355-140419377 TTGTTTTAGGAAAAAAATTCTGG + Intronic
1001983218 5:176051092-176051114 GTGTTGTATGCTGAAGATACTGG + Intronic
1002234247 5:177792960-177792982 GTGTTGTATGCTGAAGATACTGG - Intronic
1004793892 6:19059737-19059759 TTTTTGTAGAATGAAATTATTGG + Intergenic
1004889219 6:20082555-20082577 AAGTTGTAGTATGAAAATATAGG - Intergenic
1005658719 6:27970846-27970868 TTGTTATATGATGAAAAGATAGG - Intergenic
1008345409 6:50421019-50421041 TTGTTGTAGCCTCAAAAAACAGG + Intergenic
1009056705 6:58344987-58345009 TTGTTGTACAATTAAAAGACTGG - Intergenic
1009815279 6:68725333-68725355 TTGTTGTAGAAAGAGAATCCAGG + Intronic
1010674793 6:78729831-78729853 TTATTGTAGGAAGACAAAACTGG - Intergenic
1012051020 6:94344052-94344074 TTGTTACATGATGAAAAAACTGG + Intergenic
1012867805 6:104638999-104639021 ATGTTTGAGGATTAAAATACTGG + Intergenic
1013164929 6:107581177-107581199 TTGGTGTGGAATGGAAATACAGG + Intronic
1013827028 6:114225461-114225483 TTATTTTAGGATGAAGAAACAGG + Intronic
1014996671 6:128154770-128154792 GTGATGAAAGATGAAAATACAGG + Intronic
1020397876 7:7737497-7737519 ATGTTGTAGGATTAAAAGCCTGG + Intronic
1020999298 7:15308189-15308211 TTGTTAAGGGATGAACATACAGG - Intronic
1021515576 7:21481116-21481138 ATGTGGCATGATGAAAATACTGG - Intronic
1022393813 7:29967140-29967162 TTGTTAAAGGATGAAAAATCTGG - Intronic
1022556222 7:31300174-31300196 TTGTTGTAAGATAAAAACAGAGG - Intergenic
1023146045 7:37152026-37152048 TTGATGAAGGATGAAAGTATTGG + Intronic
1026519299 7:71102473-71102495 TTGGTGGAGGATGAAATCACAGG + Intergenic
1028164863 7:87526777-87526799 TTGTTGTACAACCAAAATACTGG + Intronic
1028604960 7:92645379-92645401 TTCTTGTACGATGGAAATGCTGG - Intronic
1029821046 7:103147984-103148006 TTTTTGTTGCAAGAAAATACTGG - Intronic
1029895651 7:103980922-103980944 TATTTGCAGGATGAGAATACAGG + Intronic
1030976072 7:116125012-116125034 TTGTTGAAGTATGAAAATTCAGG - Intronic
1032812506 7:135435063-135435085 TAATTGTAAAATGAAAATACCGG + Intronic
1034572169 7:151964850-151964872 TTGTTCTGGGATGAGAAGACAGG - Intronic
1036199096 8:6751829-6751851 ATGTTGTAATATGAAAATACTGG - Intronic
1039011858 8:33102364-33102386 TTGTTTTAGGATGAAATGAGAGG + Intergenic
1040442361 8:47457074-47457096 TTGTTACAGGAAAAAAATACTGG - Intronic
1040497475 8:47979304-47979326 TTTTAGTAGAATGAAAATAATGG + Intergenic
1041611411 8:59854233-59854255 TTGTTGTACAACCAAAATACTGG + Intergenic
1044054022 8:87545637-87545659 TTCTTGTAGGATGTAGATGCAGG + Intronic
1044832552 8:96263602-96263624 TGATTGTTGGATAAAAATACTGG - Intronic
1045191322 8:99887426-99887448 TTGTGGTAAAATGCAAATACAGG - Intronic
1046073640 8:109289273-109289295 ATGTTTTAGCATGAAAAGACTGG - Intronic
1046270439 8:111889622-111889644 TTGTTGTACAGTGAAAAGACTGG + Intergenic
1048649563 8:136460010-136460032 TCTTTTTAGGATGAATATACTGG - Intergenic
1051284946 9:15486520-15486542 GTGTTGTAGGATGGATGTACTGG - Intronic
1051287874 9:15514348-15514370 ATCCTTTAGGATGAAAATACAGG + Intergenic
1054853200 9:69870613-69870635 TAGATGTAGGATGAAGATCCTGG - Intronic
1056213798 9:84389874-84389896 CTGTTGTGGGATGCAAAAACTGG - Intergenic
1058500759 9:105613251-105613273 TTGTTGTAGTAGGAAAAGCCTGG - Intronic
1058612986 9:106794775-106794797 TTTTTTTAGGAAGAAAATCCTGG + Intergenic
1059060706 9:111032949-111032971 TTGTTGTATTATGAAAATAAAGG - Intronic
1059120420 9:111637367-111637389 TTGTTTTAGGAAGAAAACTCTGG + Intronic
1060092142 9:120752732-120752754 TTTTTGTAGGAGGAAAATGAAGG - Intronic
1060242819 9:121919037-121919059 TTGTCATAGAATGAACATACTGG - Intronic
1187957253 X:24531466-24531488 TTTTTGCAGGGTGAAAATAAAGG + Intronic
1191943443 X:66503943-66503965 TTGTTGTGGTGTGAAAATAGAGG + Intergenic
1193922069 X:87441089-87441111 TTGTTGTAAGATTAAAATACAGG - Intergenic
1193986617 X:88250455-88250477 TTGTTATCAGATTAAAATACTGG - Intergenic
1194291510 X:92078173-92078195 TTCTTTTAAGATGAAGATACTGG + Intronic
1194553329 X:95328341-95328363 TTGTTGTAAGGTTAAAATAATGG - Intergenic
1196285920 X:113880263-113880285 ATGATGTATGAAGAAAATACAGG + Intergenic
1196374173 X:115013581-115013603 TGGTTTTAGGATGTAGATACTGG - Intronic
1197388701 X:125833052-125833074 TTTTTGTATGACGTAAATACAGG - Intergenic
1198550608 X:137741583-137741605 TTGTTGCAAGAGGAAAATATGGG + Intergenic
1200609028 Y:5302755-5302777 TTCTTTTAAGATGAAGATACTGG + Intronic
1201612356 Y:15857586-15857608 TTGTTGTCGTATGAAAGTAGAGG - Intergenic
1202031141 Y:20575590-20575612 TTGCTGCAGGATGAATAAACAGG - Intergenic