ID: 1161690528

View in Genome Browser
Species Human (GRCh38)
Location 19:5730703-5730725
Sequence GGCTGGTGGTATTGAACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 7, 2: 19, 3: 66, 4: 333}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161690528_1161690536 -6 Left 1161690528 19:5730703-5730725 CCAGGAGTTCAATACCACCAGCC 0: 1
1: 7
2: 19
3: 66
4: 333
Right 1161690536 19:5730720-5730742 CCAGCCTGGGCGGCTGGGCACGG 0: 1
1: 0
2: 32
3: 690
4: 3181
1161690528_1161690540 25 Left 1161690528 19:5730703-5730725 CCAGGAGTTCAATACCACCAGCC 0: 1
1: 7
2: 19
3: 66
4: 333
Right 1161690540 19:5730751-5730773 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1161690528_1161690539 24 Left 1161690528 19:5730703-5730725 CCAGGAGTTCAATACCACCAGCC 0: 1
1: 7
2: 19
3: 66
4: 333
Right 1161690539 19:5730750-5730772 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
1161690528_1161690537 -3 Left 1161690528 19:5730703-5730725 CCAGGAGTTCAATACCACCAGCC 0: 1
1: 7
2: 19
3: 66
4: 333
Right 1161690537 19:5730723-5730745 GCCTGGGCGGCTGGGCACGGTGG 0: 1
1: 1
2: 21
3: 204
4: 1553
1161690528_1161690542 28 Left 1161690528 19:5730703-5730725 CCAGGAGTTCAATACCACCAGCC 0: 1
1: 7
2: 19
3: 66
4: 333
Right 1161690542 19:5730754-5730776 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161690528 Original CRISPR GGCTGGTGGTATTGAACTCC TGG (reversed) Intronic
900132928 1:1096946-1096968 TGTTGCTGGTCTTGAACTCCTGG + Intronic
900389968 1:2429523-2429545 GGCTGGTGGGACGGAACCCCTGG + Intronic
900671699 1:3858369-3858391 GGATGGTGGTGTTCAGCTCCTGG + Intronic
901101417 1:6722009-6722031 TGCAGCTGGTCTTGAACTCCTGG + Intergenic
902344325 1:15804874-15804896 GGCTGCTGGTCTCGAACTCCTGG - Intergenic
903519873 1:23938900-23938922 GGCTGGTGGTCTTGAATTCCTGG - Intergenic
903800128 1:25961013-25961035 GCCAGGTGGTCTTGAACTCCTGG + Exonic
904056758 1:27675903-27675925 GCCAGGTGGTCTCGAACTCCTGG + Intergenic
904132359 1:28284397-28284419 CGAGGGTGGTCTTGAACTCCTGG + Intergenic
904634212 1:31867260-31867282 GGCTGGTCTCATGGAACTCCTGG - Intergenic
904638571 1:31903835-31903857 GGAGGCTGGTCTTGAACTCCTGG + Intergenic
904768478 1:32868337-32868359 GGGTGGTGGTGTTCACCTCCTGG + Exonic
906032777 1:42734252-42734274 GGCTTTTGGTCTTGAAGTCCAGG - Exonic
906439419 1:45828038-45828060 GGAGGCTGGTCTTGAACTCCTGG + Intronic
909626838 1:77726433-77726455 CGCAGTTGGTCTTGAACTCCTGG - Intronic
911204862 1:95081873-95081895 GCCAGCTGGTCTTGAACTCCTGG - Intergenic
913284910 1:117217380-117217402 GTCAGGTTGTCTTGAACTCCTGG + Intergenic
914000148 1:143686997-143687019 GGCTTCTGGCCTTGAACTCCTGG - Intergenic
914262565 1:146011403-146011425 GCCAGCTGGTCTTGAACTCCTGG + Intergenic
914503665 1:148269724-148269746 GGCTTCTGGCCTTGAACTCCTGG + Intergenic
914807606 1:151002931-151002953 GACTGGTGGGATTGAACACATGG + Intronic
915209891 1:154300665-154300687 GGGGGCTGGTCTTGAACTCCTGG + Intergenic
915223286 1:154392053-154392075 GCCAGCTGGTCTTGAACTCCTGG - Intergenic
915272190 1:154761253-154761275 GGCTGGTGGTCTGCAGCTCCTGG - Intronic
915430605 1:155863575-155863597 CCCAGGTGGTCTTGAACTCCTGG - Intronic
917338962 1:173954748-173954770 GGCTGGTGGTCTCAAACTCGTGG - Intronic
917345660 1:174025500-174025522 GCCAGGTGGTCTTGAACTCTTGG - Intergenic
917350470 1:174072002-174072024 CGAGGGTGGTCTTGAACTCCTGG + Intergenic
917868825 1:179223916-179223938 CCATGGTGGTTTTGAACTCCTGG - Intronic
918731373 1:188001393-188001415 CCCTGCTGGTCTTGAACTCCTGG + Intergenic
920497875 1:206468343-206468365 GGCTGGGGGAATGGAATTCCAGG - Intergenic
920700792 1:208216932-208216954 GGCTGGTGATATTGAAGGCCTGG + Exonic
921085810 1:211791533-211791555 GGCTGCTGGTCTCAAACTCCTGG - Intronic
921168004 1:212521033-212521055 TGTTGCTGGTCTTGAACTCCTGG - Intergenic
921380520 1:214519838-214519860 CCCAGGTGGTTTTGAACTCCTGG - Intronic
922533190 1:226360209-226360231 AGGTGCTGGTCTTGAACTCCTGG + Intergenic
922931463 1:229393254-229393276 GGCTGGTGGTCTCGAACTCCTGG - Intergenic
923687929 1:236166859-236166881 TGAGGGTGGTCTTGAACTCCTGG + Intronic
924133682 1:240939859-240939881 CCATGGTGGTCTTGAACTCCTGG - Intronic
924725418 1:246665158-246665180 AGAGGGTGGTCTTGAACTCCTGG - Intronic
1063001825 10:1932065-1932087 GCAGGCTGGTATTGAACTCCTGG + Intergenic
1063582126 10:7317431-7317453 GTCGGCTGGTCTTGAACTCCTGG - Intronic
1064058029 10:12114503-12114525 GACAGGTGGTCTGGAACTCCTGG + Intronic
1068371120 10:56116767-56116789 AGCTTCTGGTATTGAGCTCCAGG + Intergenic
1068450034 10:57174306-57174328 GGCTGCTGGCCTTGAACTCCAGG + Intergenic
1069427092 10:68298054-68298076 GGGGGGTGGTCTTGAACTCCTGG - Intronic
1071738511 10:88329260-88329282 CCCAGGTGGTCTTGAACTCCTGG + Intronic
1071873694 10:89820882-89820904 ACCAGGTGGTCTTGAACTCCTGG - Intergenic
1073197035 10:101700106-101700128 GGAGGCTGGTCTTGAACTCCTGG - Intergenic
1073355633 10:102851699-102851721 GGCTGCTGATATTGAACTCCTGG + Intergenic
1073355829 10:102853389-102853411 GGCTGCTGATACTGAACTCCTGG + Intergenic
1073575995 10:104623994-104624016 CACTGCTGGTCTTGAACTCCTGG + Intergenic
1073679906 10:105691745-105691767 GGAAGGTTGTATTTAACTCCAGG - Intergenic
1073862190 10:107759249-107759271 GGCTGGGGGTAAGGAACACCTGG + Intergenic
1073906043 10:108280876-108280898 CGATGCTGGTCTTGAACTCCAGG - Intergenic
1074064539 10:110002081-110002103 GCCAGATGGTCTTGAACTCCTGG - Intronic
1074871910 10:117583574-117583596 GGGTGGTGGTCTTGAACTCTTGG + Intergenic
1075011318 10:118872693-118872715 GGCTACTGGTCTTGAACTCCTGG + Intergenic
1076392526 10:130113845-130113867 GCCAGCTGGTCTTGAACTCCTGG - Intergenic
1078781738 11:14445232-14445254 GCCGGCTGGTCTTGAACTCCTGG - Intronic
1079277255 11:19052815-19052837 CTCTGCTGGTCTTGAACTCCTGG - Intergenic
1080322815 11:31033933-31033955 GCCAGCTGGTCTTGAACTCCTGG - Intronic
1080594419 11:33757607-33757629 GGCTAGTGGTATTTAACTCCTGG - Intronic
1081188158 11:40070624-40070646 GGCAGTTAGTACTGAACTCCAGG + Intergenic
1081549419 11:44097578-44097600 GCCAGCTGGTCTTGAACTCCTGG - Intronic
1081681259 11:45005973-45005995 GGTGGGTGGTCTTGAACTCCTGG + Intergenic
1083722604 11:64610875-64610897 GGCTGGTGGTATGGACCAGCAGG - Intronic
1084639350 11:70415277-70415299 GGCTGGTGGGAGTGCACCCCTGG + Intronic
1084849424 11:71927040-71927062 TGTTGCTGGTCTTGAACTCCTGG - Intronic
1086255533 11:84871768-84871790 GGATCGTGGTACTGCACTCCAGG - Intronic
1089250275 11:117154651-117154673 GGCTGATGATCTTGAACTCTCGG + Intronic
1089426113 11:118376838-118376860 GGTTGGTGGTCTTAAACTTCTGG - Intronic
1089486050 11:118846902-118846924 TGTTGCTGGTATTAAACTCCTGG - Intergenic
1089523681 11:119082661-119082683 GGTGGCTGGTCTTGAACTCCTGG - Intergenic
1089565864 11:119371301-119371323 GGCTGGTGCTGTTCAACCCCAGG - Intronic
1089837629 11:121384891-121384913 TGTTGCTGGTTTTGAACTCCTGG + Intergenic
1092896527 12:13016610-13016632 CCCAGGTGGTCTTGAACTCCTGG + Intergenic
1093210018 12:16297153-16297175 GCCAGGTGGTCTTGATCTCCTGG - Intergenic
1093321751 12:17722071-17722093 GGGAGGTGGGATTGAAGTCCAGG + Intergenic
1094013603 12:25836636-25836658 CCCTGGTGGTCTTGAACTCCTGG - Intergenic
1094203650 12:27817892-27817914 GGCTGGTGGTTTTGAACTTTAGG - Intergenic
1094545607 12:31401832-31401854 GGCTGGTCGTCTCAAACTCCTGG + Intronic
1095195226 12:39306809-39306831 TGTTGCTGGTCTTGAACTCCTGG - Intronic
1096162750 12:49393889-49393911 GGCTGGTGGTGTTGAACTCCTGG + Intronic
1096460015 12:51817053-51817075 GGCTTGTGGTAATGGACTCTGGG + Intergenic
1096875278 12:54625068-54625090 GCAGGCTGGTATTGAACTCCTGG + Intergenic
1097554222 12:61116922-61116944 GGCTGATGGTCTCTAACTCCTGG - Intergenic
1098260862 12:68669397-68669419 GGATGTTGGTCTTGAACTCCTGG + Exonic
1098367387 12:69719084-69719106 GGCTGGTGGAAAAGAACACCTGG - Intergenic
1100195295 12:92238536-92238558 GGCTGGTGCCACTGTACTCCTGG + Intergenic
1100291297 12:93217242-93217264 GCCTGCTGGTCTTGAACTCCTGG - Intergenic
1100291872 12:93223274-93223296 CCATGGTGGTCTTGAACTCCTGG + Intergenic
1100861633 12:98812784-98812806 GGCTGGTGGTCTCAAACGCCTGG + Intronic
1100862400 12:98820230-98820252 GGCTGCTGGCATTGGAATCCTGG + Intronic
1101494503 12:105240884-105240906 CCATGGTGGTCTTGAACTCCTGG - Intronic
1101990516 12:109480436-109480458 GGTTGGTGGTCTCAAACTCCTGG - Intronic
1102097907 12:110255021-110255043 CCAGGGTGGTATTGAACTCCTGG + Intergenic
1102493037 12:113300288-113300310 GGCCAGTGGTCTCGAACTCCTGG - Intronic
1103619012 12:122174555-122174577 GGCCGCTGGCCTTGAACTCCTGG - Intronic
1103692920 12:122790451-122790473 GGCTGGTCTTCTTGAAGTCCTGG - Intronic
1104705081 12:130938527-130938549 GGCTGCTGGTCTTGCACTCCTGG + Intergenic
1105369385 13:19789286-19789308 GCCAGCTGGTCTTGAACTCCTGG - Intergenic
1105613530 13:21991022-21991044 GGCTGGTGGTCTTGAACTCCTGG + Intergenic
1106105758 13:26732202-26732224 GTCCAGTGGTCTTGAACTCCTGG + Intergenic
1106664248 13:31835182-31835204 GGCTGATGATCTTGAACTCCTGG + Intergenic
1108225009 13:48280291-48280313 GGCTGGTGGTCTCAAACTCCTGG + Intergenic
1108366456 13:49720545-49720567 GCCAGCTGGTCTTGAACTCCTGG - Intronic
1108896071 13:55330536-55330558 GGCTGGTGGTGTTAGAGTCCAGG + Intergenic
1112055193 13:95684296-95684318 GACTGGTGGCATTGTACCCCTGG + Intronic
1112268189 13:97945141-97945163 CCCAGGTGGTCTTGAACTCCTGG - Intergenic
1112323791 13:98430027-98430049 GGCTGGTGGTCTCAAACTCCTGG - Intronic
1112709940 13:102115900-102115922 GTCAGCTGGTCTTGAACTCCCGG - Intronic
1113118034 13:106894728-106894750 TGAGGGTGGTCTTGAACTCCTGG + Intergenic
1113678493 13:112225228-112225250 CCCGGCTGGTATTGAACTCCTGG + Intergenic
1113840032 13:113353858-113353880 GGGTTTTGGTCTTGAACTCCCGG - Intronic
1114462442 14:22895577-22895599 CCCAGGTGGTCTTGAACTCCTGG - Intergenic
1116421849 14:44742419-44742441 TGCTGCTGGTCTTGAACTCCTGG - Intergenic
1117991887 14:61441857-61441879 TCCAGGTGGTCTTGAACTCCTGG + Intronic
1118566265 14:67144025-67144047 CCCAGGTGGTCTTGAACTCCTGG - Intronic
1119814546 14:77554025-77554047 CCCAGCTGGTATTGAACTCCTGG + Intronic
1119832669 14:77717195-77717217 GCAGGGTGGTGTTGAACTCCTGG + Intronic
1120762022 14:88293613-88293635 GTTTGGAGGTATTGAAGTCCAGG - Intronic
1121387608 14:93542997-93543019 GGCTGGCCGCCTTGAACTCCTGG + Intronic
1123677724 15:22727929-22727951 GGCTCCTGGTCTTGAACTCCTGG + Intergenic
1124329926 15:28802193-28802215 GGCTCCTGGTCTTGAACTCCTGG + Intergenic
1125077539 15:35636907-35636929 GGATGGTGGTATTGTACAGCTGG + Intergenic
1125637148 15:41198480-41198502 TCCAGGTGGTCTTGAACTCCTGG - Intronic
1127083556 15:55404720-55404742 GGCTGGTCTCTTTGAACTCCTGG - Intronic
1127598622 15:60512497-60512519 GGCTTGAGGTCTGGAACTCCAGG + Intronic
1128042873 15:64591123-64591145 GGAGGCTGGTCTTGAACTCCTGG - Intronic
1128130231 15:65222365-65222387 GGAGGCTGGTCTTGAACTCCTGG + Intergenic
1128912400 15:71527923-71527945 GGCTGGTGGTCTCAAACTCCTGG + Intronic
1130065527 15:80600528-80600550 TGATGTTGGTTTTGAACTCCTGG - Intergenic
1130533745 15:84768099-84768121 CCCAGCTGGTATTGAACTCCTGG + Intronic
1130991543 15:88878832-88878854 GGCTGGTGCTCTTGGCCTCCAGG + Intronic
1131848224 15:96510670-96510692 GGCTGGTGGCATTTAACACCAGG + Intergenic
1132562428 16:602777-602799 GGCTAGTGGTCTTGAACTCCTGG + Intronic
1133217434 16:4301483-4301505 AACTGCTGGTCTTGAACTCCTGG + Intergenic
1133909563 16:10052604-10052626 GGCTGGCGGTAAAGACCTCCCGG + Intronic
1134056851 16:11175415-11175437 TGCTGGTGTTTTTGAACTCTAGG - Intronic
1134184909 16:12077062-12077084 GACTGGTGGTGTTGAACTCCCGG - Intronic
1134216535 16:12321057-12321079 GGATGGTGGTAAGGACCTCCTGG - Intronic
1134650139 16:15902149-15902171 CCAAGGTGGTATTGAACTCCTGG + Intergenic
1135018267 16:18942351-18942373 CCAGGGTGGTATTGAACTCCTGG - Intergenic
1135515698 16:23131365-23131387 CCCTGGCGGTCTTGAACTCCTGG + Intronic
1136418741 16:30118927-30118949 GGCTGGTGGTCTCAAACTCCTGG - Intronic
1136637439 16:31533729-31533751 GGCTGGTGTCTTAGAACTCCTGG - Intergenic
1137241163 16:46655682-46655704 GCCAGCTGGTCTTGAACTCCTGG + Intergenic
1137660427 16:50201008-50201030 CCCAGGTGGTCTTGAACTCCTGG + Intronic
1137667249 16:50258794-50258816 GCCGGCTGGTCTTGAACTCCTGG + Intronic
1137788663 16:51155979-51156001 TGCTGCTGGTATTGAACTGCTGG - Intergenic
1138568302 16:57850188-57850210 GGCTGGTGGTCTGGAACTTCTGG - Intronic
1139423422 16:66863559-66863581 CGGAGGTGGTCTTGAACTCCTGG - Intronic
1139622138 16:68154127-68154149 TGTTGCTGGTCTTGAACTCCTGG + Intronic
1139642598 16:68303360-68303382 GTCTTATGGTCTTGAACTCCTGG - Intronic
1139786738 16:69399105-69399127 TGCTGCTGGTCTTGAACTCCTGG + Intronic
1140401907 16:74678572-74678594 GCCAGCTGGTTTTGAACTCCTGG - Intronic
1141425912 16:83944358-83944380 CGCTGGTGGTCTCAAACTCCTGG - Intronic
1142403969 16:89875884-89875906 GGTTGCTGGTCTTGAACTCCTGG + Intronic
1143642283 17:8205966-8205988 GTCCGCTGGTCTTGAACTCCTGG + Intronic
1143716226 17:8771629-8771651 GGCTGGTGGTCTCAAACTCCTGG + Intergenic
1143766431 17:9140782-9140804 GGCCGGTGGTAATGAATTCTAGG - Intronic
1143965046 17:10751047-10751069 GGCTGGTGGTCTTGAACTCCTGG - Intergenic
1145255871 17:21322040-21322062 GGGTGGGGGTATTGCACTCCTGG + Intergenic
1145320750 17:21765906-21765928 GGGTGGGGGTATTGCACTCCCGG - Intergenic
1146354360 17:32121375-32121397 CCAGGGTGGTATTGAACTCCTGG - Intergenic
1146680210 17:34801706-34801728 GGGTTGTGGTACTGACCTCCAGG - Intergenic
1146976194 17:37114330-37114352 CTCTGTTGGTCTTGAACTCCTGG - Intronic
1147018506 17:37511828-37511850 GTCTTCTGGTCTTGAACTCCTGG + Intronic
1147226794 17:38985403-38985425 TGAGGGTGGTGTTGAACTCCTGG + Intergenic
1147953566 17:44120292-44120314 GCATGGTGGTACTGGACTCCAGG - Intronic
1147983245 17:44288261-44288283 TGTTGCTGGTCTTGAACTCCTGG + Intergenic
1148942461 17:51226839-51226861 TGAGGATGGTATTGAACTCCTGG + Intronic
1149560100 17:57602562-57602584 GCCAGGTGGTCTAGAACTCCTGG + Intronic
1150016228 17:61560173-61560195 CGCCGCTGGTCTTGAACTCCTGG + Intergenic
1150164403 17:62927585-62927607 GCCAGGTGGTCTTGAACTCCTGG + Intergenic
1150678465 17:67265002-67265024 CCATGCTGGTATTGAACTCCTGG - Intergenic
1150935094 17:69626765-69626787 CCATGCTGGTATTGAACTCCTGG + Intergenic
1150961215 17:69914449-69914471 GGTTGGTCGTCTTGAACTCCTGG - Intergenic
1151296089 17:73187185-73187207 GCCAGGTGGTCTCGAACTCCTGG + Intergenic
1151728679 17:75898560-75898582 GCCAGCTGGTCTTGAACTCCTGG + Intergenic
1152774090 17:82189055-82189077 GGCTGGTGGTCTTCAACTCCTGG - Intronic
1152839483 17:82557860-82557882 TGATGCTGGTCTTGAACTCCTGG + Intronic
1153277441 18:3381456-3381478 GGATGGTGCTACTGTACTCCAGG + Intergenic
1153752776 18:8250568-8250590 GGAGGCTGGTCTTGAACTCCTGG - Intronic
1153853715 18:9123699-9123721 GGCTGGTGGTTGTGAAATCCTGG + Intronic
1153865100 18:9260333-9260355 TCCTGTTGGTCTTGAACTCCTGG - Intronic
1154006225 18:10529542-10529564 GCCAGGTGGTCTCGAACTCCTGG - Intronic
1156723736 18:40102270-40102292 CCTTGGTGGTCTTGAACTCCTGG + Intergenic
1158722136 18:59935130-59935152 GCCAGGTGGTCTTGAACTCTTGG + Intergenic
1161690528 19:5730703-5730725 GGCTGGTGGTATTGAACTCCTGG - Intronic
1161700874 19:5794415-5794437 GGCTGCTGGTCTGGAACTGCTGG - Intergenic
1161713971 19:5865233-5865255 GGAAGGTGGTAGTGAATTCCAGG - Intergenic
1161939529 19:7394300-7394322 GACTGGTGGTCCTGAACTCCTGG + Intronic
1162048644 19:8018527-8018549 AGCTGGTTTTATTGAACTCCTGG + Intronic
1162338604 19:10077637-10077659 AGCTGCTGGTCTTGAATTCCTGG + Intergenic
1163051491 19:14688066-14688088 GGCTGGTCATCTGGAACTCCTGG + Intronic
1163452257 19:17385387-17385409 GGCTGGAGGCTTTGAACCCCAGG - Intergenic
1163798529 19:19350989-19351011 GGCTGGTGGTCTTGAACTCCTGG - Intronic
1164229217 19:23273498-23273520 GGAAGGTGGTCTGGAACTCCTGG - Intergenic
1164280439 19:23763674-23763696 GGAAGGTGGTCTGGAACTCCTGG + Intronic
1164805906 19:31116499-31116521 TGTTGCTGGTCTTGAACTCCTGG + Intergenic
1165350255 19:35271369-35271391 GGCTGGTGATCTTGAATTCATGG + Intronic
1165499179 19:36174112-36174134 GTATGCTGGTCTTGAACTCCTGG + Intergenic
1165500515 19:36185555-36185577 GGCTGGTGGTTTTGTACACTGGG - Intronic
1165559681 19:36668155-36668177 GGCTGGTGGTCTCGAACTCCTGG + Intergenic
1165944667 19:39434766-39434788 GGATTGTGCTATTGCACTCCAGG + Intronic
1166384049 19:42370506-42370528 AGGTGGGGGTCTTGAACTCCTGG + Intronic
1166468163 19:43053030-43053052 TGAGGGTGGTTTTGAACTCCTGG + Intronic
1166498245 19:43321306-43321328 TGTTGCTGGTCTTGAACTCCTGG + Intergenic
1166565997 19:43765931-43765953 AGATGCTGGTCTTGAACTCCTGG - Intergenic
1166685478 19:44793784-44793806 GGCTGGGGGTCCTGGACTCCTGG + Intronic
1167165110 19:47793872-47793894 CCCAGGTGGTCTTGAACTCCTGG + Intergenic
1167201911 19:48071656-48071678 GCTTGCTGGTCTTGAACTCCTGG + Intronic
1167297270 19:48658813-48658835 GTTTGCTGGTCTTGAACTCCTGG + Intergenic
1167373051 19:49095734-49095756 GGCTGGTCTTCTTGAACTCTTGG + Intronic
1167946946 19:52995746-52995768 GCCAGGTGGTCTGGAACTCCTGG - Intergenic
1168149205 19:54435904-54435926 GGCGGGGGGTCCTGAACTCCTGG + Intronic
926269089 2:11351604-11351626 GGCTGGTAGTATGGGGCTCCTGG - Intergenic
927800077 2:26090722-26090744 GGAGGCTGGTCTTGAACTCCTGG - Intronic
927937482 2:27083857-27083879 GGCTGGTGGTGTTGGTTTCCCGG - Exonic
928524910 2:32130084-32130106 CCAGGGTGGTATTGAACTCCTGG - Intronic
929130554 2:38565494-38565516 GGCTGGTGGTCTTGAACTCCTGG - Intronic
930364977 2:50428202-50428224 CCCAGGTGGTCTTGAACTCCTGG - Intronic
930504810 2:52269839-52269861 GGCATGTGGTCTTGATCTCCTGG - Intergenic
931293188 2:60895388-60895410 CGAGGGTGGTCTTGAACTCCTGG + Intronic
931767227 2:65467442-65467464 TCAGGGTGGTATTGAACTCCTGG + Intergenic
932767386 2:74479821-74479843 CCCTGGTGGTCTCGAACTCCTGG + Intronic
934530300 2:95082520-95082542 CGATGCTGGTTTTGAACTCCTGG - Intergenic
935230171 2:101089138-101089160 GGGTGGTGGTCTTGAACTCCTGG - Intronic
935627457 2:105183245-105183267 TGTTGCTGGTGTTGAACTCCTGG + Intergenic
937181495 2:119999970-119999992 CCATGCTGGTATTGAACTCCTGG - Intergenic
938964650 2:136377523-136377545 GGGTGCTGGTCTTGAACTCTTGG + Intergenic
940542545 2:155039645-155039667 GACTGGTATTATTGAACACCAGG - Intergenic
941486660 2:166090238-166090260 CCCAGGTGGTCTTGAACTCCTGG + Intronic
944548407 2:200821606-200821628 CGATGCTGGTCTTGAACTCCTGG + Intronic
945066092 2:205949068-205949090 GGCTGGTAGTATGGGGCTCCTGG - Intergenic
945294772 2:208159799-208159821 GGCTGGTAGTGTTGATCTCCTGG + Intergenic
947397204 2:229697978-229698000 TGTTGCTGGTCTTGAACTCCTGG - Intronic
947843729 2:233226952-233226974 AGGTGGTGGTATTGCCCTCCAGG + Intronic
1169300374 20:4437030-4437052 GCCAGCTGGTCTTGAACTCCTGG + Intergenic
1169892104 20:10464469-10464491 GGCTGCTGGTCTCTAACTCCTGG - Intronic
1169894237 20:10485391-10485413 GCCAGCTGGTCTTGAACTCCTGG - Intronic
1172806847 20:37618241-37618263 GCCAGCTGGTCTTGAACTCCTGG + Intergenic
1174213722 20:48900081-48900103 TTCTGATGGTATTGAGCTCCTGG - Intergenic
1175282082 20:57810741-57810763 GGCTGCTGGTAATAAACACCAGG + Intergenic
1175700300 20:61131963-61131985 GGCTGCTGGTCTTTATCTCCAGG + Intergenic
1176689119 21:9882417-9882439 GACTGGTGGCATTGTGCTCCAGG - Intergenic
1176939894 21:14911628-14911650 GGCTGGTGGTAAGTAATTCCTGG + Intergenic
1177167528 21:17619349-17619371 TCCTGTTGGTCTTGAACTCCTGG - Intergenic
1177668993 21:24200889-24200911 GGCTGGTCTTGATGAACTCCAGG + Intergenic
1178623595 21:34197604-34197626 GGCTGGTCTTGCTGAACTCCTGG - Intergenic
1178847792 21:36187808-36187830 TGTTGCTGGTCTTGAACTCCTGG + Intronic
1179676892 21:42989186-42989208 TGTTGCTGGTTTTGAACTCCTGG + Intronic
1180193274 21:46179334-46179356 TGTTGCTGGTCTTGAACTCCTGG - Intronic
1181490798 22:23259728-23259750 GGCTGGTGATCTCGAACTCCTGG + Intronic
1182016714 22:27046408-27046430 GGATGGTGGTTTGGAATTCCAGG + Intergenic
1182498142 22:30725293-30725315 GGCTGCTGGTGTTGAACTCCTGG - Intronic
1182879114 22:33718200-33718222 GCCTGTTGGTATTGATCCCCAGG - Intronic
949106565 3:206518-206540 TGTTGCTGGTCTTGAACTCCTGG - Intronic
949540771 3:5030597-5030619 GGCTGGTTGTCTTGAACGCCTGG - Intergenic
949595293 3:5538162-5538184 GCCTCCTGGTATTGAACTCCTGG + Intergenic
950221391 3:11199148-11199170 GGAGGCTGGTCTTGAACTCCTGG + Intronic
950769109 3:15296904-15296926 CCAGGGTGGTATTGAACTCCTGG + Intronic
950798359 3:15529700-15529722 GCCAGCTGGTACTGAACTCCTGG + Intergenic
950807392 3:15618174-15618196 GGCTGGTGGTCTCAAACTCCTGG + Intronic
951009705 3:17662100-17662122 GGTTGGTGGTCTCTAACTCCTGG + Intronic
951888006 3:27542834-27542856 GGCTGGTGGTAGTTAACTGTAGG + Intergenic
953789613 3:45937342-45937364 GGCTGGTGGCATTCAGCTCCTGG - Intronic
954074651 3:48168859-48168881 GCCAGATGGTCTTGAACTCCTGG + Intronic
954886010 3:53874513-53874535 GCCAGCTGGTCTTGAACTCCTGG - Intronic
955467530 3:59252603-59252625 GGCTGGTCCTATTCAACTGCTGG + Intergenic
956147616 3:66206949-66206971 AGGTGCTGGTCTTGAACTCCTGG + Intronic
956204674 3:66742891-66742913 GCCTGGTGCTATGGAACGCCAGG + Intergenic
956671213 3:71692802-71692824 GTAGGGTGGTTTTGAACTCCTGG + Intronic
958115268 3:89208160-89208182 GGCCAGTGATCTTGAACTCCTGG - Intronic
959286052 3:104412530-104412552 GACTGGTGGGATTTCACTCCTGG - Intergenic
959539042 3:107520072-107520094 AACTGTTGGTCTTGAACTCCTGG + Intergenic
959763351 3:109995005-109995027 GCCAGCTGGTCTTGAACTCCTGG + Intergenic
961054341 3:123775240-123775262 GGCTGGTGGTCTCGAACTGCTGG + Intronic
961154978 3:124671851-124671873 GGCTGGTGGTATTCAAACCCTGG - Intronic
961699645 3:128732617-128732639 TGAAGGTGGTCTTGAACTCCTGG - Intronic
962033248 3:131623625-131623647 GGCTGTTGTTATTCAAATCCTGG + Intronic
963697794 3:148583821-148583843 GACTGGTGGTCTCTAACTCCTGG - Intergenic
963948721 3:151174902-151174924 GGCTGGTGGTCTTGAACTCCTGG + Intronic
964246145 3:154656305-154656327 TGCTGGTGGCATTGATGTCCTGG + Intergenic
965338890 3:167461827-167461849 TCCTGCTGGTCTTGAACTCCTGG + Intronic
965369781 3:167847572-167847594 GCCTGCTGGTCTTGAACTCCTGG - Intergenic
965557055 3:170029319-170029341 TGTTGCTGGTCTTGAACTCCTGG + Intergenic
966212532 3:177468257-177468279 GGCTGGTCTTCTTGAACTCCTGG + Intergenic
966997340 3:185296030-185296052 TGTTGCTGGTCTTGAACTCCTGG - Intronic
967041842 3:185701137-185701159 GCCTGCTGGTCTTGAACTCCTGG + Intronic
967821323 3:193841958-193841980 GCCTGGTAGTCTAGAACTCCAGG + Intergenic
967972190 3:195007220-195007242 TGATGCTGGTCTTGAACTCCTGG - Intergenic
968214382 3:196875931-196875953 GGCAGGTGATCTTGAAATCCTGG + Intronic
969434440 4:7179052-7179074 GGCAGGTGGTCTCAAACTCCTGG + Intergenic
971039876 4:22740086-22740108 GGGTGGTGGTACTGAAGTCATGG + Intergenic
975133662 4:70852870-70852892 GTTTGGTGGTATGGAACTTCAGG - Intergenic
975141803 4:70926192-70926214 TCCAGGTGGTCTTGAACTCCTGG + Intronic
976149612 4:82078806-82078828 GGCTGGAGGGCTTGATCTCCAGG + Intergenic
976670142 4:87643219-87643241 GGGGGCTGGTCTTGAACTCCTGG - Intergenic
976709800 4:88057197-88057219 CCAGGGTGGTATTGAACTCCAGG + Intronic
978441844 4:108741501-108741523 GGAGGCTGGTCTTGAACTCCTGG - Intergenic
978785186 4:112601199-112601221 TGCTGCTGGTTTTGAACTCCTGG - Intronic
978868344 4:113543428-113543450 GCAGGCTGGTATTGAACTCCTGG + Intronic
979298177 4:119056341-119056363 GGCTGGTGGTATTAGACTCCTGG - Intronic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
982360420 4:154513420-154513442 GGAGGCTGGTCTTGAACTCCTGG - Intergenic
982677080 4:158388306-158388328 CCCTGCTGGTCTTGAACTCCTGG - Intronic
983058132 4:163123590-163123612 GGTTGGTGGTCTTGAACTCCTGG + Intronic
983237614 4:165197538-165197560 GCCAGCTGGTCTTGAACTCCCGG + Intronic
983562044 4:169111096-169111118 TGTTGGTGGTCCTGAACTCCTGG - Intronic
983606447 4:169591362-169591384 GGCTAGTGGTCTTGAACTCCTGG + Intronic
984607042 4:181797269-181797291 GGCTTTCGGTATTGAACTGCAGG + Intergenic
984794394 4:183644885-183644907 GGCTGCTGGTCCCGAACTCCTGG - Intronic
985123734 4:186669610-186669632 TGGTGGTGGTTTTGAAATCCTGG - Intronic
985992921 5:3578180-3578202 TGCTGCTGGCATTGATCTCCTGG - Intergenic
987107148 5:14650871-14650893 GGCTGCTGGTCTTGAACTCCTGG - Intergenic
988531938 5:32035543-32035565 GGCTGCTGATGTTGACCTCCTGG + Intronic
988540358 5:32102857-32102879 TGAGGCTGGTATTGAACTCCTGG - Intronic
988864026 5:35315387-35315409 CCCTGCTGGTCTTGAACTCCTGG + Intergenic
992241403 5:74773423-74773445 GCCTGCTGGTCTTGGACTCCTGG - Intronic
992900564 5:81290948-81290970 CCCAGGTGGTCTTGAACTCCTGG - Intergenic
993892831 5:93494420-93494442 GGCTGGTGGTCTTGAACTGCTGG - Intergenic
995178132 5:109202353-109202375 GGCTGGTGGTCTCCAACTCATGG - Intergenic
996383245 5:122883862-122883884 CCCAGCTGGTATTGAACTCCTGG + Intronic
998030509 5:138863453-138863475 CCCTGCTGGTCTTGAACTCCTGG + Intronic
998223502 5:140307260-140307282 GGCTGGTCTTGTTCAACTCCTGG - Intergenic
998268086 5:140681453-140681475 GGTTGGTGGTCTTGAATTCCTGG - Intronic
998550895 5:143077265-143077287 GGCTGGTGGAATTGTGTTCCAGG + Intronic
998905964 5:146905451-146905473 GGCTGGTGGTCTTGAACTCCAGG + Intronic
999186329 5:149712802-149712824 GGATGGTGGTCTCGAACTCCTGG + Intergenic
999724127 5:154420861-154420883 GGCTGGTGGTCTTGAGCTTTTGG - Exonic
999775282 5:154807761-154807783 CCATGGTGGTCTTGAACTCCTGG + Intronic
1001344351 5:170877469-170877491 CTGTGGTGGTCTTGAACTCCTGG + Intronic
1002073685 5:176695829-176695851 GCCGGCTGGTCTTGAACTCCTGG + Intergenic
1002295709 5:178230031-178230053 GGCTGTTGGTGTTGAGCACCTGG + Exonic
1002693465 5:181067579-181067601 GGCTGGTCAACTTGAACTCCTGG + Intergenic
1005325690 6:24698475-24698497 AGATGGGGGTCTTGAACTCCAGG - Intronic
1006587265 6:35124001-35124023 CCCTGCTGGTCTTGAACTCCTGG + Intronic
1006690114 6:35876425-35876447 GGCTGGTCTTCTTGAACTCCTGG - Intronic
1006849635 6:37088681-37088703 GATTGCTGGTCTTGAACTCCTGG + Intergenic
1006903175 6:37516090-37516112 GTCTGTTGGTATTGAAGTCTGGG + Intergenic
1009994218 6:70880876-70880898 GGCTGGTGGTCTCAAACTCCTGG + Intronic
1011818317 6:91220136-91220158 GGCTGGTGGTCTTGAACTCTTGG - Intergenic
1013133528 6:107257824-107257846 GGTCAGTGGTATTAAACTCCTGG + Intronic
1013150067 6:107437310-107437332 GGCTGCTGGTCTTAGACTCCTGG - Intronic
1013809829 6:114032144-114032166 GGCTGGTCTCAATGAACTCCTGG + Intergenic
1014166471 6:118230772-118230794 CCCAGGTGGTCTTGAACTCCTGG - Intronic
1016219285 6:141646713-141646735 GGCTGGTGGTTTTCACCCCCTGG - Intergenic
1016354600 6:143204429-143204451 GGCTGGTGGAATTCACCTCCTGG - Intronic
1016449752 6:144169885-144169907 TGTTGCTAGTATTGAACTCCTGG + Intronic
1017160463 6:151360821-151360843 GGCTAGTGGTCTCCAACTCCTGG + Intergenic
1017865560 6:158440114-158440136 TGTTGCTGGTCTTGAACTCCTGG - Intronic
1018154712 6:160975008-160975030 GGCTGGTGGGAGTGAACTGAGGG - Intergenic
1020036093 7:4963889-4963911 TGCTGCTGGTCTTGAACTCCTGG - Intergenic
1020258712 7:6518020-6518042 TGTTGCTGGTCTTGAACTCCTGG - Intronic
1020427154 7:8080881-8080903 GCCAGGTGGTCTCGAACTCCTGG + Intronic
1020807528 7:12808763-12808785 TGAGGGTGGTCTTGAACTCCTGG + Intergenic
1020972740 7:14966511-14966533 GGCTGCTGGTCTCGAACTCCTGG + Intronic
1021649521 7:22820123-22820145 GGCTGGTGGTCTTGAACTTCTGG - Intronic
1021950297 7:25767716-25767738 CCCAGGTGGTCTTGAACTCCTGG - Intergenic
1022411465 7:30141730-30141752 ACCAGGTGGTCTTGAACTCCTGG + Intronic
1022788123 7:33659532-33659554 AGCAGCTGGTCTTGAACTCCTGG + Intergenic
1023030609 7:36087592-36087614 GTCTTGAGGTCTTGAACTCCTGG + Intergenic
1023952286 7:44856104-44856126 GGCAGCTGGTCTCGAACTCCTGG - Intergenic
1026662381 7:72313605-72313627 GGCTGGTGGTCTCAAACTCCTGG + Intronic
1026809772 7:73453773-73453795 TGTTGCTGGTCTTGAACTCCTGG - Intronic
1026810002 7:73455570-73455592 GCCGGCTGGTCTTGAACTCCTGG - Intronic
1026961615 7:74411866-74411888 CCAGGGTGGTATTGAACTCCTGG - Intergenic
1027053688 7:75035790-75035812 CCAGGGTGGTATTGAACTCCTGG - Intronic
1027471627 7:78581407-78581429 CCCTGGTGGTATTAAACTACTGG - Intronic
1028610277 7:92702771-92702793 TGCTGGTGGAAGTGAATTCCTGG + Intronic
1029642328 7:101828965-101828987 GGCTGGTGGGAGGGAATTCCAGG + Intronic
1029648062 7:101870485-101870507 GGGTGGTGCTATTTATCTCCAGG + Intronic
1033445933 7:141422216-141422238 GCCTGGTGTTATTGCTCTCCGGG + Intronic
1033541380 7:142358866-142358888 GGCTGGTGCTAGTAGACTCCAGG - Intergenic
1034645305 7:152641090-152641112 GGAGGCTGGTCTTGAACTCCTGG - Intergenic
1035424034 7:158755138-158755160 CGCTGGTGGCAATGCACTCCTGG + Intronic
1037543880 8:19898993-19899015 GGCTGGTCATCTTGAACTCCTGG + Intergenic
1038064805 8:23952412-23952434 GGCTGATGGTATAGAATTGCTGG - Intergenic
1038179927 8:25218070-25218092 GGCTGATGGGACTGAAATCCTGG + Intronic
1038344981 8:26724361-26724383 GCCAGGTGGTCTTGAACTCCTGG + Intergenic
1039558465 8:38494250-38494272 AACTGCTGGTCTTGAACTCCTGG - Intergenic
1041192390 8:55366757-55366779 AGCAGGTGGTAGTGGACTCCAGG - Intronic
1041915425 8:63134074-63134096 GCCAGGTGGTCTCGAACTCCTGG + Intergenic
1042063711 8:64849681-64849703 GGCTGGTGGTCTTAAACTCTTGG + Intergenic
1042529870 8:69803776-69803798 CCCAGGTGGTCTTGAACTCCTGG - Intronic
1043658999 8:82710976-82710998 AGAAGCTGGTATTGAACTCCTGG - Intergenic
1044346789 8:91113928-91113950 GGAGGTTGGTCTTGAACTCCTGG - Intronic
1044597998 8:93977224-93977246 GCCAGCTGGTCTTGAACTCCTGG - Intergenic
1047481033 8:125283336-125283358 CCATGGTGGTTTTGAACTCCTGG - Intronic
1047988969 8:130265663-130265685 GGTCGCTGGTCTTGAACTCCTGG - Intronic
1048758838 8:137768805-137768827 GACAGAAGGTATTGAACTCCTGG + Intergenic
1049824126 8:144656281-144656303 GCAGGGTGGTTTTGAACTCCTGG - Intergenic
1050539246 9:6656103-6656125 GGAGGCTGGTCTTGAACTCCTGG + Intergenic
1051074356 9:13212761-13212783 ACCAGGTGGTCTTGAACTCCTGG - Intronic
1051932466 9:22402780-22402802 CCCAGGTGGTCTTGAACTCCTGG - Intergenic
1055050427 9:71974450-71974472 GCCAGGTGGTCTCGAACTCCTGG + Intronic
1055469184 9:76594565-76594587 GTCTGCTGGTCTTGAGCTCCTGG + Intergenic
1055614895 9:78061562-78061584 CCATGGTGGTCTTGAACTCCTGG - Intergenic
1055630467 9:78218610-78218632 GTTTGGTGGTATAGAACTCCAGG + Intergenic
1055917608 9:81421708-81421730 TCCTGGTGGTATAGAATTCCAGG - Intergenic
1056335675 9:85566308-85566330 CCCAGGTGGTTTTGAACTCCTGG - Intronic
1056627404 9:88264954-88264976 GGCTGATGGAATTGGACCCCTGG - Intergenic
1058022346 9:100102701-100102723 GCCTGGTGGTCTTCTACTCCTGG - Intronic
1058565405 9:106279120-106279142 GGCTGGTGGTCTCTAACTCCTGG + Intergenic
1059238848 9:112785740-112785762 GGTTGTTGGTCTTGAACTCCTGG + Intronic
1061558365 9:131386324-131386346 TGCTGCTGGTCTTGAACTCCTGG + Intergenic
1185529700 X:807624-807646 CCCGGCTGGTATTGAACTCCTGG - Intergenic
1185818420 X:3178992-3179014 GGCTGGTGGTCTTGAATTCCCGG - Intergenic
1186181770 X:6980417-6980439 CGAGGGTGGTCTTGAACTCCTGG + Intergenic
1186248139 X:7636745-7636767 GGAGGCTGGTCTTGAACTCCTGG - Intergenic
1187075158 X:15927562-15927584 GGCTGCTGGCCTTGAACTCCTGG - Intergenic
1187862508 X:23695825-23695847 GCCAGGAGGTCTTGAACTCCTGG + Intergenic
1187927253 X:24261594-24261616 GGCTGGTGGTCTCCAGCTCCTGG - Intergenic
1188317108 X:28688417-28688439 GGCTAGTAGTGTTGAACTCCTGG + Intronic
1188482116 X:30646878-30646900 GCAGGGTGGTCTTGAACTCCTGG - Intergenic
1190759966 X:53430961-53430983 GGCTGCTGGTGTTAAACTGCTGG - Exonic
1194239724 X:91429839-91429861 GGCTGCTGCTGTTGAACTCCTGG + Intergenic
1195042160 X:101024484-101024506 CCCAGGTGGTCTTGAACTCCTGG - Intronic
1195232312 X:102861938-102861960 GGCTGGTGGTCTCGAACTCCTGG + Intergenic
1196851722 X:119944526-119944548 CCCAGGTGGTCTTGAACTCCTGG + Intergenic
1198278770 X:135121862-135121884 AACTGGAGGTCTTGAACTCCTGG - Intergenic
1198292191 X:135250654-135250676 AACTGGAGGTCTTGAACTCCTGG + Intronic
1201261850 Y:12166270-12166292 GACTGGTGGTTTTGAATTCCTGG + Intergenic