ID: 1161694439

View in Genome Browser
Species Human (GRCh38)
Location 19:5758150-5758172
Sequence CCCAGCCCGGGGAGGGTAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 7, 3: 20, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161694431_1161694439 5 Left 1161694431 19:5758122-5758144 CCGGATGGCATGACAGGGAGGAG 0: 1
1: 0
2: 4
3: 19
4: 208
Right 1161694439 19:5758150-5758172 CCCAGCCCGGGGAGGGTAGCCGG 0: 1
1: 0
2: 7
3: 20
4: 291
1161694430_1161694439 6 Left 1161694430 19:5758121-5758143 CCCGGATGGCATGACAGGGAGGA 0: 1
1: 0
2: 0
3: 23
4: 217
Right 1161694439 19:5758150-5758172 CCCAGCCCGGGGAGGGTAGCCGG 0: 1
1: 0
2: 7
3: 20
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161694439 Original CRISPR CCCAGCCCGGGGAGGGTAGC CGG Intronic
900110174 1:1001952-1001974 CTCAGGCCGGGGAGGGACGCGGG - Intergenic
900393301 1:2443185-2443207 CCCAGCCCCAAGAGGGTGGCAGG - Intronic
900457387 1:2783841-2783863 CCCAGCCCGGGGAGGGCAGAGGG + Intronic
900521838 1:3109663-3109685 TCCATCCCGGGGAGTGTGGCAGG + Intronic
900935522 1:5764098-5764120 CCCAGCCCAAGGAGGGAAACTGG + Intergenic
901026693 1:6282163-6282185 CCCAGGCCGGGGAGGGTGGTGGG - Intronic
901756370 1:11443906-11443928 ACCAGCCTGGGCAGGGCAGCGGG + Intergenic
901881981 1:12199372-12199394 CCCAGCCCAGGGAGGGTGTGGGG + Intronic
902090424 1:13898559-13898581 CCCAGCTCGTGGAGGGTGGAAGG + Intergenic
902336907 1:15759107-15759129 CCCAGCCCGGGAGCGGGAGCCGG + Intronic
902471011 1:16647595-16647617 ACCAGGCCTGGGAGGGTACCTGG + Intergenic
902487793 1:16759853-16759875 ACCAGGCCTGGGAGGGTACCTGG - Intronic
902535276 1:17116169-17116191 CACAGCCCGTGGATGGAAGCTGG + Intronic
902657470 1:17879245-17879267 TCCAGCCCGGAGAGGGGAGTTGG - Intergenic
903538437 1:24082548-24082570 CCCAGCCCAGGGAGGTTTGCAGG + Intronic
904498417 1:30900652-30900674 CCCAGCCCAGGGAGGGGGACAGG + Intronic
904611936 1:31730851-31730873 CCGAGCCAGGGGAGCGCAGCCGG - Exonic
904827079 1:33280626-33280648 CCCAGTTCGGGGAGGGCTGCTGG + Intronic
905312126 1:37056610-37056632 CCCAGCAGGGGGAGGGCAGAAGG - Intergenic
906411778 1:45584493-45584515 CCCAGCCCGGGGCGGTTGGCCGG + Intronic
907860254 1:58345884-58345906 CCCAGGACGGGGAGGGAGGCAGG - Intronic
910387974 1:86705112-86705134 CCGGGCCCGGGGAGGGGACCAGG - Intronic
912517971 1:110227744-110227766 CACAGCCCAGGGAGGAAAGCAGG - Intronic
912576388 1:110675373-110675395 TACAGCCCGGGGAGGGCAGGCGG + Intergenic
913209352 1:116570450-116570472 CACCGCGCGGGGAGGGCAGCAGG + Intronic
913240438 1:116825511-116825533 CCCAGCTCGGTGGGGGCAGCTGG + Intergenic
915021714 1:152786097-152786119 CTCAGCCTGGGGAGGGAGGCAGG + Intronic
915511929 1:156391254-156391276 CCCTGCCAGGGGAGGGTGGGTGG + Intergenic
915613503 1:157015459-157015481 CCCAGCCAGGGGAGGAGAGTGGG - Intronic
915913930 1:159930251-159930273 CCCAGCCCTGGGAGCCTTGCCGG + Exonic
917423777 1:174892209-174892231 CCCAGGCGGGAGAGGGCAGCTGG - Intronic
919907088 1:202085567-202085589 CCCACCCCGGGTAGGGAAGGGGG + Intergenic
920195058 1:204221469-204221491 ACCTGCCCCGGGAGGGCAGCGGG - Exonic
922729137 1:227940936-227940958 TCCAGGCCGGGCAGGGTGGCAGG - Intronic
1063098976 10:2933329-2933351 CCCAGTCTGGGGAGGGTTCCTGG - Intergenic
1063429560 10:5977247-5977269 CCCAGGCCGGGGAGGGGACGCGG - Intronic
1064279891 10:13942022-13942044 CCCACACCAAGGAGGGTAGCTGG - Intronic
1064350529 10:14572327-14572349 TCCAGCCCTGGGTGGGTACCAGG + Intronic
1064442946 10:15370533-15370555 CCGAGCCCGGCGTGGGGAGCCGG + Intronic
1064981685 10:21173126-21173148 CCCTGCCCGGGAAGGGCAGGGGG + Intronic
1065419143 10:25522283-25522305 CCAAGCACTGGGAGGGTAACGGG - Intronic
1066220556 10:33334243-33334265 CCCGGTCCGGGGCGGGCAGCTGG + Intronic
1067033796 10:42898465-42898487 CCCAGCCCGCGGAGGGAAGAGGG + Intergenic
1067346600 10:45442752-45442774 CCCAGCCACAGGAGGGCAGCAGG - Intronic
1069780720 10:70953710-70953732 CACAGCCCTGGGAGGTGAGCTGG + Intergenic
1069895748 10:71679157-71679179 CCCAGCACATGGAGGGGAGCAGG + Intronic
1070290683 10:75111586-75111608 CGGAGCCCGGGGCGGGGAGCCGG - Intronic
1070727164 10:78800295-78800317 CCCAGCACAGGGATGGCAGCAGG + Intergenic
1073425515 10:103453185-103453207 CCCAGCTCAGGGAGGCCAGCGGG - Intergenic
1073643795 10:105278859-105278881 CCCATCTCTGGGAGGGAAGCAGG - Intergenic
1075517093 10:123118012-123118034 CCCAGTGCGGTGAGGGTAGGGGG + Intergenic
1075735431 10:124661920-124661942 CCCAGACCTGGGATGGCAGCAGG - Intronic
1078498282 11:11842138-11842160 CCCTGCCGGGGGAGGGTGGAGGG - Exonic
1078673336 11:13385098-13385120 CTCAGCCAGGGGAAGGCAGCTGG + Intronic
1078858135 11:15223289-15223311 CCCAGCCTGGGCAGTGAAGCAGG - Intronic
1080386319 11:31813072-31813094 CCCAGCCCGGGGAGGGGAGAGGG - Intronic
1083174173 11:60938986-60939008 CCCAGCCCGGGGAAGGGGGTTGG + Intronic
1083702678 11:64490117-64490139 CCCAGCCAGAGGAGGGTCTCAGG + Intergenic
1084516220 11:69639262-69639284 CCCAGCCCGAGGCGCGAAGCGGG - Intergenic
1084785336 11:71438667-71438689 GCCAGCCCTGGGAGGGGAGGAGG - Intronic
1086871455 11:92042294-92042316 CCGAGTCTGGGGAGGGTAGAGGG - Intergenic
1089494033 11:118899547-118899569 CCCAGCTCGGGGAGGGTGCAGGG + Intronic
1089497207 11:118913815-118913837 CCCTACCTGGGGAGGGTAGAGGG + Intronic
1089604825 11:119635752-119635774 CAGAGCCCGGGGAGGGAAGGCGG + Intronic
1090002908 11:122977623-122977645 GCCAGGCTGGGGAGGGTAGTAGG - Exonic
1090788328 11:130069484-130069506 CCCAGCAGGGGCAGGGGAGCGGG + Intergenic
1092192953 12:6533701-6533723 CCCAGCCCGGAGAGAGCCGCTGG + Intergenic
1092230120 12:6771484-6771506 CCCAGCCCAGGGAGAGTTGGAGG - Intergenic
1096386314 12:51197335-51197357 GCCAGGCCTGGGAGGGTAGAAGG + Intronic
1096521391 12:52186682-52186704 GCCAGCCCATGAAGGGTAGCTGG - Intronic
1096681631 12:53259310-53259332 CCCTGCCCTGGGAGGGGAGGGGG + Intergenic
1097177113 12:57149632-57149654 GCCAGGCAGGGGAAGGTAGCAGG + Intronic
1099439820 12:82686768-82686790 TCCAGGCCGGGGAGGGTGGGAGG + Intergenic
1102258771 12:111430866-111430888 CCCATCCCGGGGAGGGACCCTGG - Intronic
1102693635 12:114781178-114781200 TCCAGCCCAGGGAGGGGAACGGG + Intergenic
1102756782 12:115347981-115348003 CCCAGCAGGTGGAGGGTAGGTGG + Intergenic
1103522709 12:121547085-121547107 TCCAGTCCTGGGAGGGGAGCAGG - Intronic
1104089469 12:125503216-125503238 CACAGCCCGGGGAGGGGAGGGGG - Intronic
1104689357 12:130813714-130813736 CAGAGCCCAGGGAGGGTGGCAGG + Intronic
1104748829 12:131225601-131225623 CCCAGCCTGGGCAGGGACGCAGG - Intergenic
1104784294 12:131439963-131439985 CCCAGCCTGGGCAGGGACGCAGG + Intergenic
1104906331 12:132215392-132215414 TGCAGCCCGGGGAGGATTGCTGG + Intronic
1106141368 13:27014980-27015002 CCCAGTGCTGGGAGGGGAGCGGG - Intergenic
1106408460 13:29494614-29494636 CACAGCCTGGGCAGTGTAGCAGG - Intronic
1113750986 13:112776290-112776312 CCCAGTCCGGGGATGGAAGGAGG - Intronic
1114674360 14:24430698-24430720 CCCAGCCCTGGAAGGGGAGAAGG - Exonic
1115907634 14:38218226-38218248 CCCAGAAATGGGAGGGTAGCAGG + Intergenic
1116481344 14:45394354-45394376 CTCAGCACGGGGAGTGCAGCAGG - Intergenic
1116972572 14:51081955-51081977 CCCAGGGCAGGGAGGGTGGCTGG - Intronic
1118185487 14:63533828-63533850 CTCAGCCTGCGGAGAGTAGCTGG - Intronic
1119781064 14:77277226-77277248 CCCAGCTCTGGGAGTGCAGCTGG - Exonic
1121796506 14:96740520-96740542 CCCAGCCTGGGCATTGTAGCTGG - Intergenic
1121820523 14:96962181-96962203 CCCAGCCCTGGGAGGGTGTTAGG - Intergenic
1122455176 14:101844529-101844551 TCCAGCCCGGGGATGACAGCAGG - Intronic
1122971479 14:105154039-105154061 CCCAGAGCGGGGAGGCAAGCAGG - Intronic
1123035854 14:105471681-105471703 CACAGCCCAGGGAGGGTGGGTGG - Intergenic
1125508533 15:40281098-40281120 CCCAGCGAGGGGAGGGGGGCCGG + Intronic
1127953495 15:63833424-63833446 CCCAGCCGGGGCAGAGGAGCTGG + Intronic
1131927525 15:97401921-97401943 CAAAGCAAGGGGAGGGTAGCAGG + Intergenic
1132405466 15:101539638-101539660 CCCAGCGCCCGGAGGGCAGCAGG - Intergenic
1132980908 16:2738272-2738294 CCCAGCACGGGGATGGAGGCTGG + Intergenic
1133026809 16:2992163-2992185 CCCAGCCAGGTGAGGGCAGCTGG + Intergenic
1133027869 16:2996523-2996545 TCCAGCCAGGTGAGGGCAGCTGG + Intergenic
1134680525 16:16121910-16121932 CCCTGCCCTGGGAGGATGGCAGG + Intronic
1136911387 16:34147173-34147195 CCCAGCCAGGGGAGGGTGGCGGG - Intergenic
1137252011 16:46747687-46747709 TCCAGCCAGGGCAGGGAAGCAGG + Intronic
1137772055 16:51024315-51024337 CCCAGGCCTGGGAGGTTGGCCGG + Intergenic
1138282700 16:55784092-55784114 CCCAGCCCGAGGCAGGAAGCCGG - Intergenic
1138540097 16:57682666-57682688 CTCAGCCGAGGGAGGGGAGCCGG - Intronic
1139646982 16:68338575-68338597 CACAGCCTGGGGAAGGCAGCGGG + Intronic
1140039799 16:71398689-71398711 CCCAGCCCAGGGACTGGAGCAGG + Intergenic
1140480285 16:75258803-75258825 CCAAGCCTGAGGAGGGTAGAGGG - Intronic
1141431392 16:83971995-83972017 CCCAGCCCGGGGAGGGGGAGAGG + Intronic
1142031160 16:87839213-87839235 CCCAGCCCTGGGAGGGCAGTGGG + Intronic
1142070862 16:88090785-88090807 CCCAGCCCGCGGGGGGTCGGGGG + Intronic
1142173602 16:88634993-88635015 CCCAGCCGAGGGAGGGAGGCCGG + Intergenic
1142566104 17:841336-841358 CCCAGCCCTGGCAGGGTTGGCGG - Intronic
1142671280 17:1488389-1488411 CCCCGGGCGGGGAGGGAAGCGGG + Intronic
1143411321 17:6711177-6711199 CACAGCACGGGCAGGGCAGCTGG - Intronic
1144941646 17:18946420-18946442 CCCTGTCCTGGGAGGGTGGCAGG - Intergenic
1144941656 17:18946462-18946484 CCCTGTCCTGGGAGGGTGGCAGG - Intergenic
1144998937 17:19290065-19290087 GCCAGCCTTGGGAGGGCAGCTGG - Intronic
1146445217 17:32927905-32927927 GCCAGCCCGGGGCGGGGCGCAGG + Intronic
1147595275 17:41712641-41712663 CCCAGCCCTGGGAGGTGAGGAGG + Intronic
1147651256 17:42063179-42063201 CCCAGCCCGAGGATGGTGGAAGG + Intronic
1148715126 17:49710624-49710646 CCCAGCCCCAGGTGGGTAGTGGG - Exonic
1148807660 17:50272384-50272406 CCCAGCCTGGGCAGGATAGCAGG + Intronic
1149486364 17:57045993-57046015 CCCAGGCTGGGGATGGTGGCGGG - Intergenic
1149685671 17:58533153-58533175 CTCAGCCAGGGGAGGGAAGAGGG + Intronic
1151448281 17:74181489-74181511 CCCAGCCTGGGGTGGGGAGTGGG - Intergenic
1151550167 17:74818162-74818184 CTCAGCCCAGGGAGAGGAGCTGG - Intronic
1151662247 17:75525279-75525301 CCCAGCCCAGAGAGGGTGACCGG - Intronic
1151943447 17:77306631-77306653 CCCAGCCCTGGGAGTGAAGGGGG + Intronic
1151948333 17:77331512-77331534 CCCAGCCTGGGCAGGGAGGCGGG + Intronic
1152293503 17:79453932-79453954 CTCAGCCCGGGGTGGACAGCAGG + Intronic
1152360686 17:79831923-79831945 CCCAGCATGGGGAGGGGAGGGGG - Intergenic
1152472682 17:80499174-80499196 CCCTGCCAGGGGTGGGAAGCAGG - Intergenic
1152577515 17:81149376-81149398 CACAGGCCGGGGAGGGCAGGAGG - Intronic
1152618075 17:81346819-81346841 CCCAGCCCGGGCAGGGTTCGTGG + Intergenic
1152811512 17:82384873-82384895 CCCTGGCCGGGGAGGATGGCTGG + Intergenic
1152895376 17:82907882-82907904 CCCTGCCTGGGGAGGGTGGGAGG - Intronic
1153927009 18:9843160-9843182 CCCACCCCCAGTAGGGTAGCAGG + Intronic
1154074154 18:11182774-11182796 CCCAGCCAAGGGAGGGCAGGTGG + Intergenic
1154367914 18:13727753-13727775 CACAGACTGGGAAGGGTAGCAGG - Intronic
1156727571 18:40148002-40148024 CGCAGCCGGAGGTGGGTAGCAGG - Intergenic
1157274048 18:46297754-46297776 CCCAGCCTGGGGTGGGGAGGGGG - Intergenic
1157595718 18:48862512-48862534 CACATCCCGTGGAGGGTGGCGGG - Intronic
1159770381 18:72541754-72541776 CCCAGCCCGGGGAGAGGGGCGGG - Intronic
1160205091 18:76824847-76824869 TCCAGCCCGGAGAGGGAGGCTGG - Intronic
1160733226 19:650240-650262 CCCAGGCTGGGGATGGTGGCGGG + Exonic
1161155889 19:2731790-2731812 CCCAGACCCGGCAGGGTTGCCGG + Intronic
1161161157 19:2762492-2762514 CCCAGCCCCGTGAGTGCAGCGGG - Exonic
1161459808 19:4389906-4389928 CCCGGCCCAGGGAGGGGAGTGGG + Intronic
1161583001 19:5090914-5090936 CACAGCCCGGTGGGGGCAGCTGG + Intronic
1161694439 19:5758150-5758172 CCCAGCCCGGGGAGGGTAGCCGG + Intronic
1162909107 19:13840017-13840039 CCCAGCCCTGGGTGGGCAGCGGG - Intergenic
1162909886 19:13842961-13842983 CCCGGCCCGGGGAGGGGGGGAGG - Intergenic
1163248260 19:16110766-16110788 GCCAGCCCGGGGATGGTGGGGGG - Intergenic
1163688660 19:18726340-18726362 CCCAGGCCCGGGAGGGGAGCTGG + Intronic
1163724265 19:18913587-18913609 CCCAGGCCAGGGAGGGAGGCTGG + Intronic
1163764085 19:19152864-19152886 CCCAGCCCAGAGAGGGCAGAGGG - Intronic
1164069172 19:21750675-21750697 CCCTGCCCGGGGCGGGTCGCGGG + Intronic
1165154186 19:33777465-33777487 CCCGGCCCGGGCAGGGCAGTGGG - Intergenic
1166046770 19:40234649-40234671 CCCAGCCCAGGTAGGGTGGGCGG - Intronic
1166677198 19:44747538-44747560 CCCACCCCGGGGCGGGGAGAGGG + Intergenic
1167154525 19:47730091-47730113 CCCAGCCCGGCGGGGGCACCAGG - Intronic
1167260741 19:48456261-48456283 CCCAGGCTGGGGAGGGCTGCAGG + Exonic
1167288944 19:48614298-48614320 GCCAGCCTGAGGAGGGTGGCTGG - Intronic
1168293738 19:55369288-55369310 CGCGGCCCGGGGCGGGTAGACGG + Intronic
1168325295 19:55535955-55535977 CCCAGGCTGGGGAGGCTGGCAGG - Intronic
1168351521 19:55678864-55678886 ACCTGCCCGGGGAGGAGAGCAGG - Intronic
1168494867 19:56840029-56840051 CCCCGCCCCCAGAGGGTAGCCGG + Intronic
1168702905 19:58452080-58452102 CCCTGCCCTGGGGGGGTTGCGGG + Intronic
1168705396 19:58467602-58467624 CCCTGCCCTGGGGGGGTTGCGGG + Exonic
1202703407 1_KI270713v1_random:4387-4409 ACCAGGCCTGGGAGGGTACCTGG + Intergenic
926038565 2:9654597-9654619 CCCAGCCCAGGCAGGGGAGACGG + Intergenic
932374786 2:71226509-71226531 TCCAGCCCGGGGAGAGGGGCGGG + Intronic
935419346 2:102851173-102851195 CCCAGCCCAGGGACTGCAGCCGG - Intergenic
937256399 2:120559062-120559084 CCCAGCCCCAGGGGGGTTGCAGG + Intergenic
937986872 2:127641939-127641961 CCCAGCCCAGGGCGGGTGGCTGG - Intronic
938127830 2:128687131-128687153 CCCAGCCAGGGGAGGCTTGGGGG + Intergenic
938539667 2:132275673-132275695 GCCAGCTGTGGGAGGGTAGCGGG + Intergenic
940833318 2:158492556-158492578 CAAAGCCCGGGCAGGGTGGCAGG - Intronic
941003076 2:160221584-160221606 AGCAGCCCGGGGAGGGAACCAGG + Intronic
941934756 2:170973950-170973972 CCAGCCCCGGGGAGGGAAGCCGG - Intergenic
942349484 2:175038073-175038095 CCCACCCCCGGGAAGGGAGCTGG - Intergenic
942454021 2:176125361-176125383 CCCAGCTCGGTGGGGCTAGCTGG + Intergenic
942459041 2:176157137-176157159 CCCAGCCCGGCGCGGGGGGCAGG - Intronic
946366906 2:219254058-219254080 CGCAGCTTGGGGAGGGTACCAGG - Intronic
947636161 2:231681542-231681564 CGCAGCCCGGGAAGGGAAGGTGG - Intergenic
948653446 2:239463054-239463076 GTCAGCCAGGGGAGGGTGGCAGG + Intergenic
948874925 2:240821063-240821085 CCCAGCCCTGGGACGGTGGAGGG - Intergenic
1168854912 20:1001844-1001866 CCCAGAAGGGAGAGGGTAGCAGG - Intronic
1171769788 20:29313682-29313704 GCCAGCCAGGGGAGGGTGGAGGG + Intergenic
1171868596 20:30508582-30508604 GCCAGCTGTGGGAGGGTAGCGGG + Intergenic
1172655121 20:36532135-36532157 CCCAGGCCGGGCACGGTGGCTGG + Intergenic
1173540437 20:43847127-43847149 TCCATCCCTGGGAGGGAAGCTGG - Intergenic
1173973169 20:47168052-47168074 ACCAGCCCGGGGACGTTGGCTGG - Intronic
1174165358 20:48580207-48580229 CCAGGCCCGGGGAGGGGAGGGGG - Intergenic
1174267914 20:49345260-49345282 CCCTGCCTCGGGAGGGAAGCGGG - Intergenic
1175200066 20:57270613-57270635 CCCAGCACTGGGAGGCCAGCAGG - Intergenic
1175532640 20:59684697-59684719 CCCAGCCCAGGGAAGGCATCAGG - Intronic
1175738658 20:61405178-61405200 CGCATCCCGGGGAGGGAGGCAGG - Intronic
1175998378 20:62821364-62821386 CCCAGCCCAGAGAGGGCACCAGG - Intronic
1176030225 20:63008034-63008056 CGCAGCCCCGGGAGGGGAGTGGG + Intergenic
1176551402 21:8224032-8224054 GCCAGCCGGGGGAGGGTAGCGGG - Intergenic
1176570311 21:8407031-8407053 GCCAGCCGGGGGAGGGTAGCGGG - Intergenic
1176578220 21:8451218-8451240 GCCAGCCGGGGGAGGGTAGCGGG - Intergenic
1177833821 21:26169663-26169685 CGCAGCCCCGGGAAGGGAGCCGG + Intronic
1178018949 21:28386974-28386996 CACAGCCTGGGAATGGTAGCTGG - Intergenic
1178623696 21:34198366-34198388 CCAGGCACGGGGAGGGTAGTAGG + Intergenic
1178695335 21:34787922-34787944 CCCAGCCTGAGCAGGGCAGCTGG - Exonic
1179947182 21:44686396-44686418 CACAGCCCTGGGTGGGCAGCAGG - Intronic
1180027809 21:45178308-45178330 TCCAGCCTGGGGAGGGGTGCAGG + Intronic
1180340142 22:11611530-11611552 GCCAGCCGGTGGAGGGTGGCTGG - Intergenic
1180949570 22:19715006-19715028 CCCATCCTGGGGAGGGGCGCAGG - Intronic
1181008291 22:20025015-20025037 CCCAGCCCTGGCAGGGAAGGAGG + Intronic
1181082596 22:20424846-20424868 CCCAGCCTGGGGAGGAGGGCTGG - Exonic
1181270970 22:21658187-21658209 CACAGCCTGGGGAGTGGAGCGGG + Intronic
1181334035 22:22116023-22116045 CCCGGCATGGGCAGGGTAGCAGG - Intergenic
1181465437 22:23108219-23108241 CCCAGCACGGGGTGGATGGCAGG - Intronic
1181573930 22:23782270-23782292 CCCAGCTCGGTGAGGGGTGCGGG - Exonic
1181624624 22:24114795-24114817 TCCAGCCAGGGGAGGCTGGCAGG - Intronic
1182261246 22:29073796-29073818 CCCGGCCCGGGAGGGGTCGCTGG - Intronic
1182683601 22:32102722-32102744 CCGAGGCCAGGAAGGGTAGCAGG - Intronic
1183219808 22:36505396-36505418 GCCATCCAGGGGAGGGCAGCTGG + Intronic
1183407855 22:37639374-37639396 CCCCGCCTGGGGCGGGTTGCGGG + Intronic
1183718445 22:39548144-39548166 CCCAGCCTGCAGAGGGGAGCAGG - Intergenic
1184033121 22:41906265-41906287 CCCAGCCCTGGGAGGCTGGTGGG + Exonic
1184491403 22:44811313-44811335 ACCAGCCCGGGGAAGGAGGCCGG + Intronic
1184715612 22:46280178-46280200 CCCAGGCTGGTGAGGGTAGGAGG + Intronic
1185213819 22:49587282-49587304 CCCACCTCGGGAAGGGTGGCCGG - Intronic
1203256424 22_KI270733v1_random:140976-140998 GCCAGCTGGGGGAGGGTAGCGGG - Intergenic
950445266 3:13033807-13033829 CCCAGCCTGGGGAGGGCAGTCGG + Intronic
950806690 3:15610200-15610222 CTCAGCCCCTGGAGGTTAGCTGG + Intronic
953622171 3:44542774-44542796 CCCAACTCTGAGAGGGTAGCAGG + Intergenic
953992812 3:47497219-47497241 TCCTGCCCTGGGAGGGAAGCTGG - Intronic
954298425 3:49686648-49686670 ACCAGGCCTGGGAGGGTACCTGG - Intronic
954423948 3:50433663-50433685 CCCATCCCAGGGAGAGTAGGTGG - Intronic
956779224 3:72591118-72591140 CCCACCCCGGGGAGCATAGAGGG + Intergenic
963123311 3:141794114-141794136 CCCATCCCGGGGAGGCAAGCAGG + Intronic
968288546 3:197522082-197522104 AGGAGCACGGGGAGGGTAGCGGG - Intronic
968425914 4:523224-523246 CTCAGCCCAGGCAGGGGAGCCGG - Intronic
969021452 4:4142765-4142787 CCCAGCCAGGAGAAGGGAGCGGG - Intergenic
969480227 4:7442963-7442985 CCCGGCCCGGGGAAGATTGCTGG - Intronic
969873115 4:10116746-10116768 CCGAGCCCGGGGACTGGAGCCGG + Exonic
974077909 4:57184481-57184503 CCCTGCACGGGGAGGGTCTCGGG + Intergenic
980988765 4:139719761-139719783 CCCAGCTTGAAGAGGGTAGCTGG + Exonic
984756204 4:183327942-183327964 CACATCCCGGGGAGGGTCCCGGG + Intergenic
985695158 5:1335948-1335970 TCCAGCACGTGGAGGGTGGCGGG - Intronic
986617264 5:9631066-9631088 TACAGCCTGGGGAGGGTATCTGG - Intronic
991950934 5:71946173-71946195 CACAGCCAGGGAAGGGTAGGAGG + Intergenic
992444201 5:76819620-76819642 CCAAGCCCGGGGAGGGGACTAGG - Intronic
992627761 5:78649581-78649603 CCCAGCCCTGGGGGCGGAGCTGG - Intronic
995148154 5:108810384-108810406 CCCAGCCTGGAGAGGTGAGCAGG - Intronic
995224820 5:109690198-109690220 CCGACCCCGGGGAGGGCGGCAGG + Exonic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
997605303 5:135171100-135171122 CACAGCCTGGGGAGTGAAGCTGG - Intronic
1000019155 5:157303833-157303855 CCCACCCAGGGGAGGAGAGCTGG - Intronic
1001328798 5:170747910-170747932 TCCACCCCAGGGAGGGGAGCTGG + Intergenic
1001571218 5:172731939-172731961 CACAGTGGGGGGAGGGTAGCAGG + Intergenic
1003595506 6:7470815-7470837 GCCAGCCAGGGGTGGGTCGCTGG - Intergenic
1003596285 6:7476941-7476963 GCCAGCCAGGGGTGGGTCGCTGG + Intergenic
1006091657 6:31632125-31632147 CCCACCCCGGGCAGTGAAGCGGG - Exonic
1006392079 6:33764398-33764420 CCCAGGCTGGGGAGGGCAGTGGG - Intergenic
1006439368 6:34043601-34043623 CCCAGCCATGGGAGGCTAGCTGG + Intronic
1006836679 6:37003039-37003061 CCCAGGCCAGGGAGGGCATCGGG + Intergenic
1018438025 6:163781138-163781160 GCCAGCCCTGGGTGGGCAGCTGG + Intergenic
1018859921 6:167704055-167704077 CTCAGCCCTGGGAGGGGAGGGGG + Intergenic
1019357164 7:586569-586591 CCCAGCCCGAGGAGGGTTCCAGG + Intronic
1019525974 7:1480747-1480769 CCCAGCCTGGGGAGGGGGACGGG - Intronic
1019666330 7:2253902-2253924 CCCTGGCCGGGGAGGGGTGCTGG - Exonic
1020137175 7:5593969-5593991 CCCAGCCCGGGGTGGGAGGTGGG - Intronic
1022046789 7:26628050-26628072 CCCAGGCCGGGGAGGGAGGGAGG + Intergenic
1024275181 7:47671538-47671560 CCCAGCCCCGGGGGGTTAGGCGG - Intergenic
1024663530 7:51522117-51522139 CCCACCCCAGGGAGGTTGGCAGG - Intergenic
1025011465 7:55402306-55402328 CCCCGTCCGGGGAGGGAGGCGGG - Intronic
1029424449 7:100487238-100487260 CCACGCCCGGGGAGGCTTGCCGG + Intronic
1029820164 7:103138996-103139018 TCCAGCCTGGGGAAGGCAGCTGG - Intronic
1034274354 7:149817555-149817577 CACAGCCCCGGGTGGGTGGCTGG + Intergenic
1034554851 7:151843895-151843917 CCCAGCCAGGGAAGGTGAGCAGG + Intronic
1035351288 7:158247952-158247974 CCCAGCCTGGAGAGAGGAGCGGG + Intronic
1035775223 8:2182528-2182550 CCCAGCCCAGGAAGGGGAACTGG + Intergenic
1035782512 8:2239655-2239677 CCCAGAGAGGGGAGGGTGGCAGG - Intergenic
1035809608 8:2479933-2479955 CCCAGAGAGGGGAGGGTGGCAGG + Intergenic
1036707500 8:11056181-11056203 CCCAGTCTGGGGAGCGCAGCAGG - Intronic
1037858714 8:22389649-22389671 GCCACCCCGGGGAGGGGAGGTGG - Intronic
1039561235 8:38514047-38514069 CCCAGCCCAGGGAGGGAGGGAGG - Intronic
1039579290 8:38650933-38650955 CCCAGCCTGGGAAGGGGCGCGGG + Intergenic
1039884817 8:41648806-41648828 CCCAGCCTGGCCAGGGCAGCAGG + Intronic
1040549343 8:48426689-48426711 CCCAGCCTGGGATGGGGAGCAGG - Intergenic
1040721400 8:50329162-50329184 AGCAGCCAGGGGAGGGTATCGGG - Intronic
1043502697 8:80873487-80873509 GCCAGCCCGGGGAGGGGGACGGG - Intronic
1045336010 8:101205283-101205305 CCCGGCCCGGGGCGGGCCGCGGG - Exonic
1047961979 8:130017187-130017209 CCCTGCCCGGGAGGGGCAGCGGG + Intergenic
1049094816 8:140542180-140542202 CCCAGCCCATGGAGGGAACCGGG + Intronic
1049343373 8:142125740-142125762 CCCAGCTGGAGGAGGGTAGATGG - Intergenic
1049508854 8:143017988-143018010 CCCAGCCTGGAGCGGGAAGCAGG + Intronic
1049823041 8:144647737-144647759 CCGTGCCAGGGGAGGGCAGCTGG + Intergenic
1056512794 9:87321682-87321704 CCAAGCCTGGGTAGGGTAGCTGG - Intergenic
1057072858 9:92115256-92115278 CCGGGCCCGGGGAGGGTGGGAGG - Intronic
1057600727 9:96454864-96454886 CCCAGCACTGGGAGGCTAGGCGG + Intronic
1059088762 9:111334133-111334155 TGCAGCCCAGGGAGGGGAGCCGG + Intergenic
1060974198 9:127755037-127755059 CCCAGCCCGGCGCGCGTGGCGGG + Intronic
1061061067 9:128250773-128250795 CCCAGCCCGGCCCGGGTCGCGGG + Exonic
1061856056 9:133442598-133442620 CGCAGCCCTGGGAGGGAAGAGGG - Exonic
1061893559 9:133635323-133635345 CCCAGCCTGGGGGGTGGAGCTGG + Intergenic
1062319377 9:135982931-135982953 CCCATCTCGGTGAGGATAGCAGG + Intergenic
1062601389 9:137320074-137320096 CCCAGGCCGGGGCGGGCAGGGGG + Intronic
1203472581 Un_GL000220v1:122676-122698 GCCAGCCGGGGGAGGGTAGCGGG - Intergenic
1185831815 X:3310208-3310230 CCCAGCCCCGGGAGGGGTGCAGG + Exonic
1186670630 X:11764231-11764253 CACAGGCCGGGGAGGGTGGAAGG + Intronic
1187927912 X:24266852-24266874 CCCAGCCTGGGCAACGTAGCAGG + Intergenic
1190106576 X:47565145-47565167 CCCAGCCTGGGGTGGGTGGGGGG + Intronic
1190107119 X:47568903-47568925 CCCAGCCTGGGGAGGGGTGGGGG + Intronic
1190890053 X:54560011-54560033 CCCAGCCTGGGGATGGTGGTTGG + Intronic
1192204673 X:69088154-69088176 CCCAGGCCAGGGAGGCTAGGGGG + Intergenic
1196840187 X:119852708-119852730 CGCAGCGCGGGGAGGATGGCTGG - Intronic
1201074816 Y:10178989-10179011 GCCAGCCAGAGGAGGGTGGCGGG - Intergenic