ID: 1161696430

View in Genome Browser
Species Human (GRCh38)
Location 19:5771166-5771188
Sequence TAGATCCCTCAAAATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 165}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161696416_1161696430 17 Left 1161696416 19:5771126-5771148 CCCTGGCCCTGGGGTACCAGCCT 0: 1
1: 0
2: 3
3: 17
4: 322
Right 1161696430 19:5771166-5771188 TAGATCCCTCAAAATGATGATGG 0: 1
1: 0
2: 2
3: 10
4: 165
1161696423_1161696430 -3 Left 1161696423 19:5771146-5771168 CCTGGCCCTCCAGGCTCCCCTAG 0: 1
1: 0
2: 3
3: 59
4: 565
Right 1161696430 19:5771166-5771188 TAGATCCCTCAAAATGATGATGG 0: 1
1: 0
2: 2
3: 10
4: 165
1161696422_1161696430 1 Left 1161696422 19:5771142-5771164 CCAGCCTGGCCCTCCAGGCTCCC 0: 2
1: 0
2: 16
3: 123
4: 1091
Right 1161696430 19:5771166-5771188 TAGATCCCTCAAAATGATGATGG 0: 1
1: 0
2: 2
3: 10
4: 165
1161696420_1161696430 10 Left 1161696420 19:5771133-5771155 CCTGGGGTACCAGCCTGGCCCTC 0: 1
1: 0
2: 2
3: 22
4: 342
Right 1161696430 19:5771166-5771188 TAGATCCCTCAAAATGATGATGG 0: 1
1: 0
2: 2
3: 10
4: 165
1161696419_1161696430 11 Left 1161696419 19:5771132-5771154 CCCTGGGGTACCAGCCTGGCCCT 0: 1
1: 0
2: 3
3: 36
4: 256
Right 1161696430 19:5771166-5771188 TAGATCCCTCAAAATGATGATGG 0: 1
1: 0
2: 2
3: 10
4: 165
1161696425_1161696430 -9 Left 1161696425 19:5771152-5771174 CCTCCAGGCTCCCCTAGATCCCT 0: 1
1: 0
2: 2
3: 30
4: 365
Right 1161696430 19:5771166-5771188 TAGATCCCTCAAAATGATGATGG 0: 1
1: 0
2: 2
3: 10
4: 165
1161696424_1161696430 -8 Left 1161696424 19:5771151-5771173 CCCTCCAGGCTCCCCTAGATCCC 0: 1
1: 0
2: 1
3: 25
4: 228
Right 1161696430 19:5771166-5771188 TAGATCCCTCAAAATGATGATGG 0: 1
1: 0
2: 2
3: 10
4: 165
1161696414_1161696430 26 Left 1161696414 19:5771117-5771139 CCTCATGCTCCCTGGCCCTGGGG 0: 1
1: 0
2: 4
3: 68
4: 534
Right 1161696430 19:5771166-5771188 TAGATCCCTCAAAATGATGATGG 0: 1
1: 0
2: 2
3: 10
4: 165
1161696417_1161696430 16 Left 1161696417 19:5771127-5771149 CCTGGCCCTGGGGTACCAGCCTG 0: 1
1: 0
2: 2
3: 36
4: 422
Right 1161696430 19:5771166-5771188 TAGATCCCTCAAAATGATGATGG 0: 1
1: 0
2: 2
3: 10
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161696430 Original CRISPR TAGATCCCTCAAAATGATGA TGG Intronic
903257719 1:22114049-22114071 TAGAACCCTCAAAACAAAGAAGG - Intergenic
903973188 1:27132576-27132598 AGGACCACTCAAAATGATGAAGG + Intronic
906754804 1:48300903-48300925 AACATACCTCAAAATGATAAGGG + Intronic
906872636 1:49500901-49500923 TAGTTCTGTAAAAATGATGATGG + Intronic
907366873 1:53968989-53969011 TGAACCCCTCAAAATCATGAGGG + Intergenic
908729359 1:67209582-67209604 GAGAGGCCTCAGAATGATGATGG - Intronic
911017530 1:93349777-93349799 TAGATCACTGGAAAAGATGAGGG + Intronic
911679741 1:100701641-100701663 TATAACCATCAAAAAGATGAGGG - Intergenic
916158049 1:161877777-161877799 TAGCTCCGGCAAAATGATGATGG + Intronic
917415969 1:174809571-174809593 CAGATGCCCCAAAATGGTGATGG - Intronic
919540585 1:198840356-198840378 TAGATCACTCTCAATGATCATGG - Intergenic
1065312335 10:24428393-24428415 TAGTTCCCTGAAAAAGCTGAGGG + Intronic
1066143393 10:32530372-32530394 TACATACCTCAAAATAATAAAGG + Intronic
1068821721 10:61384650-61384672 TAGTTCCATCAAAATTAAGAAGG - Intergenic
1070548727 10:77473998-77474020 TAGAGCAGTCACAATGATGAAGG + Intronic
1071042857 10:81335531-81335553 AACATACCTCAAAATGATAAGGG - Intergenic
1071749733 10:88461078-88461100 AAGCTCCCTGAAAAGGATGAAGG - Intronic
1072181367 10:92984319-92984341 TAGAACACTCAATATGATGAAGG - Intronic
1073993417 10:109289543-109289565 TCATTCCCTGAAAATGATGAAGG - Intergenic
1077387811 11:2280222-2280244 TATATACCTAAAAATGATTAAGG + Intergenic
1078817389 11:14839466-14839488 TAGATCCTGGAAAATGATGGTGG + Intronic
1078911435 11:15736358-15736380 TAGAACCCTTAAAATGTTGTGGG + Intergenic
1079763655 11:24361536-24361558 GAGAGCCCTCACAATCATGAAGG - Intergenic
1079794700 11:24786120-24786142 CAAATCCCTCAAAGTTATGAAGG + Intronic
1085232831 11:74987971-74987993 AAGAACTCACAAAATGATGAGGG - Intergenic
1086835709 11:91619273-91619295 AACATACCTCAACATGATGAAGG - Intergenic
1088040382 11:105374732-105374754 TAGAGCCCTCACAATTATGGTGG + Intergenic
1088856115 11:113755331-113755353 TAAACCCCTCAAAGTCATGAGGG - Intronic
1088875587 11:113933626-113933648 TAACCCCCTCAAAATTATGATGG + Intronic
1088951866 11:114579796-114579818 TAGAACCAGCAAAATGATTAAGG - Intronic
1089061732 11:115631438-115631460 TATCTCCCTCCAGATGATGAAGG - Intergenic
1091847034 12:3665087-3665109 TACATAACTCAAAATGATTAGGG - Intronic
1092792490 12:12082012-12082034 TAGATCACTCACTATGATCAAGG + Intronic
1093568560 12:20638418-20638440 TATATTCCTCAACATGGTGATGG - Intronic
1093890189 12:24510774-24510796 CAGATACCTCAAAATCATGCTGG - Intergenic
1095205459 12:39434949-39434971 TAGATCTCTCAATATGATGAAGG - Intronic
1095845953 12:46744876-46744898 TACATACTTCAAAATGATAAGGG + Intergenic
1097072292 12:56363963-56363985 TAGATTCGTCACAATGATGTTGG + Intergenic
1098357609 12:69626429-69626451 TATATCCCTCAGCATGGTGATGG - Intergenic
1099954488 12:89339943-89339965 GAGGTCCCTTAAAATGATTAGGG + Intergenic
1100475110 12:94928265-94928287 TAGATCCATCAAAACCAGGAAGG + Intronic
1101341349 12:103844340-103844362 TAGAACCCTCAGAATGTTGCTGG + Exonic
1103386513 12:120536636-120536658 TAGATCCCTCAAAAGATAGAAGG + Intronic
1105834410 13:24196220-24196242 TAAAGCCCTCATAATGATGGTGG + Intronic
1106440914 13:29769160-29769182 TTGCTATCTCAAAATGATGATGG - Intronic
1110245323 13:73317021-73317043 TTGCTCTCTCAAAATTATGAAGG + Intergenic
1111417309 13:87966163-87966185 TACATTTATCAAAATGATGATGG + Intergenic
1111738901 13:92177000-92177022 TAGATCAGTCAAAACAATGACGG - Intronic
1112251780 13:97788017-97788039 GAGATTCCTCAACATGATAAAGG - Intergenic
1115134618 14:30094168-30094190 GGGAGCCCTCAAAATCATGATGG + Intronic
1115808183 14:37075947-37075969 TTGGTGCCTCCAAATGATGAGGG + Intronic
1116321117 14:43464344-43464366 AACATACCTCAAAATAATGAAGG - Intergenic
1118680646 14:68238138-68238160 TAGAACCCTCAATATATTGATGG - Intronic
1118695518 14:68381342-68381364 TAGTTCCCTTAAACTGATCATGG + Intronic
1118768881 14:68928729-68928751 TAGCTCCCCCAAAATGATCCCGG + Intronic
1119501719 14:75134340-75134362 TATATCTCTTAAAATGGTGATGG - Exonic
1119808072 14:77495744-77495766 TATATGCCCCAAAATGACGAGGG + Intronic
1121689706 14:95868501-95868523 TAGATTCCTCTAAATGAATAAGG - Intergenic
1128923297 15:71631474-71631496 TAGAACTCTTAAAATGAAGAAGG + Intronic
1129164125 15:73766520-73766542 TATTTCCCTCCAAATGATGGTGG + Intergenic
1133477260 16:6135477-6135499 AATTTGCCTCAAAATGATGATGG - Intronic
1137828796 16:51524533-51524555 TAAATCTCTAAAAATGAGGATGG - Intergenic
1140905408 16:79405151-79405173 TAAATCCCTCAGAGTGCTGATGG - Intergenic
1141065395 16:80909740-80909762 TAGATCCCAGAAAAGGAAGAAGG - Intergenic
1143227940 17:5323198-5323220 AACATACCTCAAAATAATGAAGG + Intronic
1145262930 17:21365454-21365476 TGGATCCCACAAAACGAGGAAGG - Intergenic
1149548831 17:57524697-57524719 TAAAATCCTAAAAATGATGATGG - Intronic
1151262341 17:72926157-72926179 TAGATGGCTCACAAAGATGATGG - Intronic
1155070637 18:22312965-22312987 TAGATCCCCCAAAGTGCTGTTGG + Intergenic
1159754632 18:72349144-72349166 TAGAGCCCTCATAATGATGAAGG + Intergenic
1161696430 19:5771166-5771188 TAGATCCCTCAAAATGATGATGG + Intronic
1166076759 19:40418010-40418032 GAGATCCCTGAAAATGTTGTAGG + Intergenic
925967856 2:9083068-9083090 TAGATGTTTCAAAATGATAATGG + Intergenic
926851979 2:17208734-17208756 GAAATTCCTCAAAATGATGAAGG + Intergenic
926977026 2:18525552-18525574 TGGATACCTCAAATTGCTGAAGG + Intergenic
929338879 2:40787860-40787882 TAGAGTCCACTAAATGATGACGG + Intergenic
934953599 2:98597192-98597214 TAAATCCCTTAAAATGGTTAAGG - Intergenic
938800297 2:134756861-134756883 AACATACCTCAACATGATGAAGG + Intergenic
939346921 2:140977327-140977349 TAGAAGCCTCACAATCATGATGG - Intronic
940756489 2:157688883-157688905 TAAATCCCTCAAAGCTATGAGGG + Intergenic
941568852 2:167143459-167143481 TAGATCCTGCAAAACCATGAAGG + Intronic
943606690 2:189984831-189984853 TAGATCCCCCAAAATGTTGCAGG - Intronic
944217553 2:197271122-197271144 TAGATCCCACAAATTGAGGCTGG + Intronic
945428143 2:209733229-209733251 TGGATACCTCATAATGATGCAGG + Exonic
945708356 2:213264707-213264729 TATAACCCTCAAATAGATGATGG + Intergenic
945955580 2:216082908-216082930 TAGGTCCAACAAAAGGATGATGG - Intronic
947322504 2:228937772-228937794 TAGAATCATAAAAATGATGAAGG + Intronic
948104733 2:235404496-235404518 TAGATCCTTAAATATGATGTAGG - Intergenic
948713709 2:239843955-239843977 TATGTCCCTCAACATGATAAAGG - Intergenic
1169418995 20:5443982-5444004 TTTATCCCTAAAGATGATGAAGG - Intergenic
1169659262 20:7960038-7960060 TAGATCCCTCAGTATGAATATGG + Intergenic
1175063444 20:56264651-56264673 AAGATCTCTCAAAATAATCATGG + Intergenic
1177135478 21:17302200-17302222 TAAAGCCATCAAAAAGATGAAGG + Intergenic
1177392686 21:20496763-20496785 CACATGCCTCAAAATGTTGAAGG - Intergenic
1178528710 21:33356434-33356456 ATGATCCCTAAAAATGTTGAGGG + Exonic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
954967989 3:54627857-54627879 TACATCACTCAGAATGTTGAAGG - Exonic
955713571 3:61805100-61805122 AAGTTCCCTTAGAATGATGAAGG - Intronic
956555111 3:70512830-70512852 TATGTCCCTCAGCATGATGAGGG - Intergenic
959265789 3:104136721-104136743 TGGACACCTCAAAATGCTGAAGG + Intergenic
959871397 3:111332633-111332655 TATATCCATCAAAATGATTGAGG + Intronic
961970836 3:130965430-130965452 AAGATCCCTCAAACTGCTTATGG - Intronic
963784672 3:149522313-149522335 TATATCCTTCCAAATGATGAAGG + Intronic
964000500 3:151765802-151765824 TAGATTCCTTAACATGATGAAGG + Intergenic
964022059 3:152024327-152024349 AAGGTCCCTATAAATGATGAAGG + Intergenic
964950214 3:162282115-162282137 AACATACCTCAAAATAATGAGGG - Intergenic
965094928 3:164213836-164213858 AACATACCTCAAAATGATAAAGG + Intergenic
966583542 3:181595789-181595811 TAGATGTTTCAAAACGATGATGG + Intergenic
967307468 3:188073090-188073112 TAAATCCCTCAAAGGGTTGAAGG + Intergenic
968637961 4:1692128-1692150 GAGATCCCTCCAAGTGATGCTGG - Intergenic
970048588 4:11884475-11884497 TAGAGACCTGAAAATGAGGAAGG + Intergenic
971819696 4:31535562-31535584 AATATACCTCAAAATAATGAAGG - Intergenic
971936632 4:33157789-33157811 TAGATGTCTCAAAATGACCATGG - Intergenic
972581016 4:40395780-40395802 GAGATTCCTCAAAATTAAGAAGG + Intergenic
976839622 4:89416654-89416676 TGGATTCCTGAAAGTGATGATGG + Intergenic
977933961 4:102779758-102779780 AAGTTACCTGAAAATGATGACGG - Intergenic
978237091 4:106472696-106472718 TAAATCCTTAAAAAAGATGAGGG - Intergenic
978452285 4:108847502-108847524 TAGATCCCTAAAAATAATCCAGG - Intronic
979883553 4:125993913-125993935 GAAATCCCTCACAATGAGGAAGG + Intergenic
983378107 4:166956143-166956165 CATAACCCTCAAAATAATGAGGG - Intronic
986148704 5:5106789-5106811 AAGAGCCCTTAAAATCATGAAGG + Intergenic
987501568 5:18717033-18717055 TTTATCCCACAAGATGATGATGG + Intergenic
988392855 5:30658316-30658338 TTGATTCCTCAAAATGAACAAGG + Intergenic
989763157 5:45045526-45045548 TAGTACCCTTAAAAAGATGAAGG + Intergenic
990016315 5:51066665-51066687 TAGATACCATAAAATGATAAAGG + Intergenic
993235333 5:85299767-85299789 TAAATCCCACATAATCATGATGG + Intergenic
993500143 5:88657653-88657675 TTGATCACTTAAAATGATAAAGG + Intergenic
994895747 5:105699351-105699373 TAGATTTCTTTAAATGATGAAGG - Intergenic
995047249 5:107666228-107666250 TACATATGTCAAAATGATGATGG + Intronic
998242862 5:140465236-140465258 GAAATCATTCAAAATGATGATGG - Intronic
999022525 5:148183693-148183715 TAGATCCCTCAAAAATAGAATGG + Intergenic
1000807854 5:165819375-165819397 TAGAAATCTCAAAATGATGATGG + Intergenic
1002666365 5:180828408-180828430 TAGAACCCTCAAATAGATGAAGG - Intergenic
1005697972 6:28369080-28369102 TAGATCCCTGAAAACCTTGAAGG - Exonic
1006655777 6:35591278-35591300 TTGATGCCTCAAAATACTGAAGG - Intronic
1011580937 6:88863894-88863916 TAGATCCCTAAAAATCAAGCAGG + Intronic
1014814132 6:125916966-125916988 AAGATCTTTCAACATGATGAAGG - Intronic
1015000420 6:128207837-128207859 GAGATCCTTCAAAATGATACCGG + Intronic
1016271536 6:142295754-142295776 CAGATTACTCAAAATGTTGATGG - Intergenic
1018110885 6:160535953-160535975 TAGATCCTTCAAGAGGATTATGG - Intronic
1018124575 6:160669459-160669481 TGGATCCCTCAACAGGATTATGG - Intergenic
1021028125 7:15694885-15694907 TATATCTGTCAAAATGATGTAGG + Intergenic
1024851433 7:53722009-53722031 TAGTTCATTCATAATGATGAAGG - Intergenic
1026719817 7:72820760-72820782 TTGATCCCTCACATTGGTGATGG - Intronic
1028262547 7:88683931-88683953 TAGATCCCTCACAGTGACCACGG + Intergenic
1029461942 7:100699794-100699816 TGGATCCCTCAAGATGATATTGG + Intergenic
1029901701 7:104047876-104047898 TACATCCATCAACATGATTAAGG - Intergenic
1030244352 7:107365420-107365442 TAGATAAGTCAAAATGAAGAAGG + Intronic
1030849910 7:114470952-114470974 CTCATCCCTGAAAATGATGAAGG - Intronic
1033207436 7:139435123-139435145 GAGATGCCTAAAAATGATAATGG + Intergenic
1033838532 7:145345343-145345365 TAGATCCATCAAAATTATAATGG - Intergenic
1044107552 8:88230098-88230120 GAGATATGTCAAAATGATGATGG - Intronic
1045566678 8:103323759-103323781 TAGATCCCCCAAAATAATACTGG + Intronic
1048014713 8:130486968-130486990 GAAATCCCTGAAGATGATGAGGG - Intergenic
1048507373 8:135033723-135033745 CAGATCCTAAAAAATGATGATGG + Intergenic
1048714160 8:137248861-137248883 AACATACCTCAAAATAATGAAGG + Intergenic
1049347951 8:142148686-142148708 CAGGTCCCTGAATATGATGAAGG + Intergenic
1049981419 9:907403-907425 TAGATTTCTCAAGATGAAGAAGG + Intronic
1050693521 9:8254870-8254892 AAGATTTCTCAAGATGATGATGG - Intergenic
1052723185 9:32197550-32197572 AATATCCCTCAAAATAATAAAGG - Intergenic
1053441439 9:38119611-38119633 TAGATGCCTAAAATTGATCAGGG + Intergenic
1055429473 9:76228982-76229004 TAGCTCCCTCAGAAAGAGGAAGG + Intronic
1058204186 9:102082378-102082400 TAGTTCTCAAAAAATGATGATGG + Intergenic
1059897433 9:118882654-118882676 TAAAACACTGAAAATGATGATGG + Intergenic
1060425900 9:123505414-123505436 TACATGCCTCAAAATGTGGAGGG - Intronic
1187146551 X:16642645-16642667 TGGATCCTACAAGATGATGATGG + Intronic
1187217927 X:17295199-17295221 TAGAACCCCCAAAATGGAGATGG + Intergenic
1189723660 X:43946904-43946926 TAAATGCTTAAAAATGATGAGGG + Intergenic
1191006941 X:55719359-55719381 TAGATACGTCAAAACCATGAAGG + Intronic
1191971886 X:66825979-66826001 TATATCTAACAAAATGATGAAGG - Intergenic
1193215441 X:78858018-78858040 TAGAGCTCTAAAAATAATGAAGG - Intergenic
1193398730 X:81016725-81016747 AACATACCTCAAAATAATGAGGG - Intergenic
1194923765 X:99798306-99798328 TTAATCCCTCAAAATTTTGAAGG + Intergenic
1195629401 X:107038687-107038709 TAGTTCTCTTAGAATGATGATGG - Intergenic
1196277653 X:113786626-113786648 TAGATCCCCAAAAATGCGGAGGG - Intergenic
1200387898 X:155912133-155912155 AATATCCCTCAACATGATAAAGG - Intronic
1200422325 Y:2984895-2984917 GAGAACCCTCAACATAATGATGG - Intergenic
1200807281 Y:7445784-7445806 TAGAACCTTCAACATGATGATGG - Intergenic