ID: 1161697255

View in Genome Browser
Species Human (GRCh38)
Location 19:5776305-5776327
Sequence GGGCCCACTCACCTGTAGTA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161697255_1161697262 5 Left 1161697255 19:5776305-5776327 CCGTACTACAGGTGAGTGGGCCC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161697262 19:5776333-5776355 CCCCTACGACAGGGGACGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 63
1161697255_1161697259 -3 Left 1161697255 19:5776305-5776327 CCGTACTACAGGTGAGTGGGCCC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161697259 19:5776325-5776347 CCCATCTGCCCCTACGACAGGGG 0: 1
1: 0
2: 1
3: 9
4: 70
1161697255_1161697266 15 Left 1161697255 19:5776305-5776327 CCGTACTACAGGTGAGTGGGCCC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161697266 19:5776343-5776365 AGGGGACGCCTGGTGCCCCTGGG 0: 1
1: 0
2: 1
3: 11
4: 191
1161697255_1161697267 16 Left 1161697255 19:5776305-5776327 CCGTACTACAGGTGAGTGGGCCC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161697267 19:5776344-5776366 GGGGACGCCTGGTGCCCCTGGGG 0: 1
1: 0
2: 0
3: 32
4: 311
1161697255_1161697257 -4 Left 1161697255 19:5776305-5776327 CCGTACTACAGGTGAGTGGGCCC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161697257 19:5776324-5776346 GCCCATCTGCCCCTACGACAGGG 0: 1
1: 0
2: 0
3: 7
4: 65
1161697255_1161697265 14 Left 1161697255 19:5776305-5776327 CCGTACTACAGGTGAGTGGGCCC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161697265 19:5776342-5776364 CAGGGGACGCCTGGTGCCCCTGG 0: 1
1: 1
2: 2
3: 27
4: 278
1161697255_1161697269 21 Left 1161697255 19:5776305-5776327 CCGTACTACAGGTGAGTGGGCCC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161697269 19:5776349-5776371 CGCCTGGTGCCCCTGGGGGCAGG 0: 1
1: 0
2: 3
3: 44
4: 408
1161697255_1161697268 17 Left 1161697255 19:5776305-5776327 CCGTACTACAGGTGAGTGGGCCC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161697268 19:5776345-5776367 GGGACGCCTGGTGCCCCTGGGGG 0: 1
1: 0
2: 2
3: 30
4: 251
1161697255_1161697256 -5 Left 1161697255 19:5776305-5776327 CCGTACTACAGGTGAGTGGGCCC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161697256 19:5776323-5776345 GGCCCATCTGCCCCTACGACAGG 0: 1
1: 0
2: 1
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161697255 Original CRISPR GGGCCCACTCACCTGTAGTA CGG (reversed) Exonic
902466943 1:16624267-16624289 GAGGCCACACACCTGCAGTAAGG - Intergenic
912271985 1:108220841-108220863 GGGCCCACTCACCTTAGGGAGGG - Intergenic
923719693 1:236456314-236456336 CCGCTCACTCACCTCTAGTAAGG + Intronic
1067181350 10:43988326-43988348 GGGCCCACAGTCCTGAAGTAGGG + Intergenic
1071499016 10:86190404-86190426 GGGCCCCCACACCTGTTGTGGGG - Intronic
1072702266 10:97651201-97651223 GGTCCCACTAACATGTAGCAGGG - Intronic
1075649593 10:124118974-124118996 GGGCTGACTCACCTGCAGTTGGG - Intergenic
1075838256 10:125474746-125474768 GGCCCCACTCACCTGGAGCTAGG - Intergenic
1076874159 10:133207854-133207876 GGGCCCACTCACCTCCACCAGGG + Intronic
1078186077 11:9053087-9053109 GGCCCCACTCACCTGAAGAGAGG + Exonic
1083762512 11:64826458-64826480 GGACCCGCTCACCTGCATTAGGG + Exonic
1084014680 11:66371551-66371573 GGGCCCACTCACCTGTCCCGCGG + Exonic
1087801958 11:102514170-102514192 GGGCCCACTCCACTTCAGTATGG + Intergenic
1090745977 11:129705071-129705093 CCACCCACTCACCTGTGGTAGGG + Intergenic
1092249380 12:6884142-6884164 GGGCCCATCCACCCATAGTAAGG + Intronic
1097030130 12:56083892-56083914 GGGCTCACTAACCTGCAGGAAGG - Exonic
1102217056 12:111169100-111169122 GGGCCCACCCTACTCTAGTATGG - Intronic
1104847029 12:131851855-131851877 GGGCCCACGCACCTGCACTTGGG + Intergenic
1114081854 14:19207835-19207857 GGTGGCACTCACCTGTACTAAGG + Intergenic
1114336069 14:21691276-21691298 GGTCACATTAACCTGTAGTATGG + Intergenic
1118743165 14:68755912-68755934 GTGCCCACTCAGCTGGAGTGGGG - Intergenic
1121025145 14:90610183-90610205 GGGTCTACTCCCCTGTAGTTAGG + Intronic
1136544756 16:30948816-30948838 GAGCCCACTCATCTGTAGGTAGG - Intergenic
1139290442 16:65853542-65853564 GGGCCCACCCACCTTAAGAAGGG - Intergenic
1146056231 17:29582665-29582687 GGGGCCACCCATCTGTTGTAGGG + Intronic
1151162218 17:72175384-72175406 GGGCCCACTCACCTCTCATGAGG + Intergenic
1152818142 17:82420958-82420980 GGTCCCACCCACTTGTAGTTTGG - Intronic
1158340321 18:56459166-56459188 TTGCCCACTCACCTTTTGTATGG + Intergenic
1159250929 18:65875463-65875485 GTGCCCACTAATTTGTAGTATGG + Intronic
1161697255 19:5776305-5776327 GGGCCCACTCACCTGTAGTACGG - Exonic
1162728825 19:12705670-12705692 GAGCCCACTCACCTCCAGCAGGG + Exonic
1167971492 19:53190277-53190299 GGGCCCACCCACCTGTCTTAAGG - Intronic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
927113504 2:19880764-19880786 TGGCCATCTCACCTGTAGTCTGG - Intergenic
928991271 2:37234905-37234927 GGCCCATGTCACCTGTAGTAAGG + Intronic
934927042 2:98389258-98389280 GGGCCCACTCACCTCTTCCAGGG - Intronic
935301655 2:101698127-101698149 GGGCCCACTCACCCGCAGGGAGG - Exonic
937087680 2:119182152-119182174 GGGCCCACTTCCCTGGAGCAGGG - Intergenic
938494730 2:131788762-131788784 GGTGGCACTCACCTGTACTAAGG - Intergenic
944837242 2:203591942-203591964 GGTCCCAGTAACCTGCAGTAGGG - Intergenic
947712370 2:232323499-232323521 CCGCCCACTCACCTATAGAAAGG + Intronic
947839416 2:233198138-233198160 GGCCCCACTCCCATGTAGTTGGG - Exonic
1175952266 20:62589687-62589709 GGACCCTCTCCCCTGTATTAGGG - Intergenic
1176613206 21:9005516-9005538 GGTGGCACTCACCTGTACTAAGG + Intergenic
1176711971 21:10158289-10158311 GGTGGCACTCACCTGTACTAAGG - Intergenic
1177725067 21:24956326-24956348 GGGTCCACTCACATTTTGTAGGG + Intergenic
1179610179 21:42545175-42545197 AGGCCCACTCACCTACAGGAAGG + Intronic
1180498921 22:15914835-15914857 GGTGGCACTCACCTGTACTAAGG - Intergenic
969501881 4:7558482-7558504 GGCCCCACTCTCCTGTAACAGGG + Intronic
973779841 4:54278009-54278031 GGGCTCACTGACCTGGAGTGAGG + Intronic
977603436 4:98958304-98958326 GTGCCCAGTCACCTGGAATATGG + Intergenic
986028994 5:3877928-3877950 GGATCCACTCACCTGGAGAACGG + Intergenic
986349659 5:6866039-6866061 GGGCTCACTCCTATGTAGTATGG - Intergenic
990240357 5:53810803-53810825 GTGCCCACTCACATGGAGTGAGG + Intergenic
1005996125 6:30932423-30932445 GGGCCCAGACACCTGCAGGAGGG - Intergenic
1006423534 6:33949972-33949994 GAGCCCACTCAGCTGTGGCAGGG + Intergenic
1007035185 6:38666745-38666767 GGGCCCAGACACCTGTATTTAGG + Intergenic
1007958881 6:45941035-45941057 GGGCCCACTGTCCTGCAGAAGGG + Intronic
1010452516 6:76018706-76018728 GGGTCTACTCACCTGAAGTTGGG + Exonic
1011741891 6:90369904-90369926 GGGCCCACTCTGCTCCAGTATGG + Intergenic
1016004628 6:139076968-139076990 GGGCCCACTCCACTTCAGTATGG - Intergenic
1016580323 6:145622520-145622542 GGGCCCACTCGACTCTAATATGG - Intronic
1018777646 6:167032323-167032345 GGGCACACTCACCATTAATAAGG - Intronic
1019062258 6:169264999-169265021 GGACTCACTCACCAGTAGTCTGG - Intergenic
1023498003 7:40818411-40818433 GGGCCCAGTCAGCTGTAGCCAGG + Intronic
1030712858 7:112772787-112772809 GAGCCCACTCTCCTGTACCATGG + Exonic
1035066637 7:156109812-156109834 GCGCCCACTCACTTGTGGAAGGG - Intergenic
1049497176 8:142941494-142941516 GGGCCCCATCACCTGTGGCACGG - Intergenic
1052392602 9:27898485-27898507 TGCCCTACTCACCTTTAGTAAGG - Intergenic
1053523813 9:38808729-38808751 GGGCCCACTCACATTGAGGAGGG + Intergenic
1054196043 9:62033143-62033165 GGGCCCACTCACATTGAGGAGGG + Intergenic
1054329944 9:63741920-63741942 GGTGGCACTCACCTGTACTAAGG - Intergenic
1054642362 9:67555546-67555568 GGGCCCACTCACATTGAGGAGGG - Intergenic
1057283630 9:93729947-93729969 GGACCCACTCTGCTTTAGTACGG - Intergenic
1062501616 9:136854320-136854342 GAACCCACTCACCTGTGGTGAGG + Exonic
1202796725 9_KI270719v1_random:127279-127301 GGTGGCACTCACCTGTACTAAGG - Intergenic
1194562351 X:95438273-95438295 GGGCCTACTCTACTCTAGTAGGG - Intergenic