ID: 1161697420

View in Genome Browser
Species Human (GRCh38)
Location 19:5777249-5777271
Sequence TAGGAGGATCAGCTCCGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161697405_1161697420 28 Left 1161697405 19:5777198-5777220 CCCCTGAAAAAAAAACACGTGGA No data
Right 1161697420 19:5777249-5777271 TAGGAGGATCAGCTCCGGGGTGG No data
1161697411_1161697420 -2 Left 1161697411 19:5777228-5777250 CCTTCTCTAGAGGCCCCAGACTA No data
Right 1161697420 19:5777249-5777271 TAGGAGGATCAGCTCCGGGGTGG No data
1161697407_1161697420 26 Left 1161697407 19:5777200-5777222 CCTGAAAAAAAAACACGTGGAGG No data
Right 1161697420 19:5777249-5777271 TAGGAGGATCAGCTCCGGGGTGG No data
1161697410_1161697420 2 Left 1161697410 19:5777224-5777246 CCTGCCTTCTCTAGAGGCCCCAG No data
Right 1161697420 19:5777249-5777271 TAGGAGGATCAGCTCCGGGGTGG No data
1161697406_1161697420 27 Left 1161697406 19:5777199-5777221 CCCTGAAAAAAAAACACGTGGAG No data
Right 1161697420 19:5777249-5777271 TAGGAGGATCAGCTCCGGGGTGG No data
1161697403_1161697420 29 Left 1161697403 19:5777197-5777219 CCCCCTGAAAAAAAAACACGTGG No data
Right 1161697420 19:5777249-5777271 TAGGAGGATCAGCTCCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161697420 Original CRISPR TAGGAGGATCAGCTCCGGGG TGG Intronic