ID: 1161698361

View in Genome Browser
Species Human (GRCh38)
Location 19:5782621-5782643
Sequence TTGGAGACACACAGCCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161698361_1161698371 29 Left 1161698361 19:5782621-5782643 CCCTGATGGCTGTGTGTCTCCAA No data
Right 1161698371 19:5782673-5782695 CTTTCCCCCACCAAACAAAGGGG No data
1161698361_1161698369 27 Left 1161698361 19:5782621-5782643 CCCTGATGGCTGTGTGTCTCCAA No data
Right 1161698369 19:5782671-5782693 TGCTTTCCCCCACCAAACAAAGG No data
1161698361_1161698370 28 Left 1161698361 19:5782621-5782643 CCCTGATGGCTGTGTGTCTCCAA No data
Right 1161698370 19:5782672-5782694 GCTTTCCCCCACCAAACAAAGGG No data
1161698361_1161698365 -3 Left 1161698361 19:5782621-5782643 CCCTGATGGCTGTGTGTCTCCAA No data
Right 1161698365 19:5782641-5782663 CAAGGAAGTTCCTGCTGCTCTGG No data
1161698361_1161698366 -2 Left 1161698361 19:5782621-5782643 CCCTGATGGCTGTGTGTCTCCAA No data
Right 1161698366 19:5782642-5782664 AAGGAAGTTCCTGCTGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161698361 Original CRISPR TTGGAGACACACAGCCATCA GGG (reversed) Intergenic