ID: 1161698590

View in Genome Browser
Species Human (GRCh38)
Location 19:5783508-5783530
Sequence GGTACAGGGGCACCCCAGGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161698577_1161698590 10 Left 1161698577 19:5783475-5783497 CCTCGGCCACCTTGAGCTCGCTG 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1161698590 19:5783508-5783530 GGTACAGGGGCACCCCAGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 140
1161698573_1161698590 21 Left 1161698573 19:5783464-5783486 CCCCTCCTTGACCTCGGCCACCT 0: 1
1: 0
2: 0
3: 15
4: 285
Right 1161698590 19:5783508-5783530 GGTACAGGGGCACCCCAGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 140
1161698576_1161698590 16 Left 1161698576 19:5783469-5783491 CCTTGACCTCGGCCACCTTGAGC 0: 1
1: 0
2: 1
3: 17
4: 129
Right 1161698590 19:5783508-5783530 GGTACAGGGGCACCCCAGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 140
1161698581_1161698590 1 Left 1161698581 19:5783484-5783506 CCTTGAGCTCGCTGAGGCCCGGT 0: 1
1: 0
2: 0
3: 5
4: 130
Right 1161698590 19:5783508-5783530 GGTACAGGGGCACCCCAGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 140
1161698575_1161698590 19 Left 1161698575 19:5783466-5783488 CCTCCTTGACCTCGGCCACCTTG 0: 1
1: 0
2: 1
3: 14
4: 205
Right 1161698590 19:5783508-5783530 GGTACAGGGGCACCCCAGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 140
1161698572_1161698590 22 Left 1161698572 19:5783463-5783485 CCCCCTCCTTGACCTCGGCCACC 0: 1
1: 0
2: 2
3: 56
4: 499
Right 1161698590 19:5783508-5783530 GGTACAGGGGCACCCCAGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 140
1161698574_1161698590 20 Left 1161698574 19:5783465-5783487 CCCTCCTTGACCTCGGCCACCTT 0: 1
1: 0
2: 1
3: 24
4: 214
Right 1161698590 19:5783508-5783530 GGTACAGGGGCACCCCAGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 140
1161698579_1161698590 4 Left 1161698579 19:5783481-5783503 CCACCTTGAGCTCGCTGAGGCCC 0: 1
1: 0
2: 2
3: 12
4: 147
Right 1161698590 19:5783508-5783530 GGTACAGGGGCACCCCAGGTCGG 0: 1
1: 0
2: 0
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161698590 Original CRISPR GGTACAGGGGCACCCCAGGT CGG Exonic
902513377 1:16977909-16977931 GGTGCAGGGGCACCCAAGGCAGG - Intronic
904332332 1:29768197-29768219 GGTACTGAGGCTCCCCAGCTGGG + Intergenic
904798640 1:33076939-33076961 GGTACTGGGGCAGCTGAGGTGGG - Intronic
906120471 1:43386853-43386875 GGTGCAGATGCAGCCCAGGTTGG - Exonic
909712988 1:78673461-78673483 GGTGGAGGGGCAAGCCAGGTTGG + Intergenic
918800000 1:188959781-188959803 GTAACAGGGGCAGCCAAGGTAGG - Intergenic
920775961 1:208937459-208937481 GGAAAAGGGGCATCCCAGGCAGG + Intergenic
921325467 1:213983323-213983345 GGTACACAGGCACACCAGGAGGG + Intronic
924606907 1:245542987-245543009 GGTACATGAGCACCCCAGGCTGG - Intronic
1066068306 10:31778569-31778591 GGTATAGGGCGACCCCAGATGGG + Intergenic
1067008932 10:42691534-42691556 GGTAGAAAGGCAGCCCAGGTAGG - Intergenic
1067763826 10:49070509-49070531 GGTGAAGGGGCACCCCAGGAAGG + Intronic
1069868599 10:71519441-71519463 GGCAGTGGGGCACCCCAAGTGGG + Intronic
1070145689 10:73772060-73772082 AGAGCAGGGGCATCCCAGGTGGG - Exonic
1070605085 10:77892998-77893020 GGGACAGGGCACCCCCAGGTTGG + Intronic
1071454322 10:85832922-85832944 GGTTCAGGGGAGTCCCAGGTTGG - Intronic
1073627172 10:105111181-105111203 GGTAAAGGGACATCCCAGGCAGG - Intronic
1075258948 10:120946392-120946414 GGTTCAGGGGATCCCCAGGCTGG + Intergenic
1075816038 10:125265465-125265487 GGTGGAGAGACACCCCAGGTGGG + Intergenic
1078410206 11:11108430-11108452 GACACATGGGCACCCCAGGCAGG + Intergenic
1078522052 11:12071252-12071274 GGAACAGGGGCTCCTCAGGATGG + Intergenic
1079901948 11:26197944-26197966 GGCACAGGGGCTCCACAGGTGGG - Intergenic
1080918885 11:36688761-36688783 GGTAAAGGGAGCCCCCAGGTGGG + Intergenic
1081669521 11:44935219-44935241 GGAACTGGGGCACAGCAGGTGGG + Intronic
1083613319 11:64014661-64014683 GGTACAGGGACACGCCCGCTTGG + Intronic
1083620518 11:64047171-64047193 GGGAGGGGGGCACCACAGGTGGG - Intronic
1084124260 11:67088591-67088613 GGGACAGGGCTTCCCCAGGTTGG + Intergenic
1084857651 11:71999209-71999231 GGCACTGGGGAACCCCAAGTTGG - Exonic
1084959626 11:72709727-72709749 GGGAGAGGGGCTCCACAGGTGGG + Intronic
1087150446 11:94854965-94854987 GGTGCAGGTGAACCCCAGGCTGG - Intronic
1089159241 11:116424771-116424793 GGTGCAGGGGCTCCCCTGATGGG + Intergenic
1089981649 11:122777409-122777431 GGCCCAGGAGCACCCCAGGATGG + Intronic
1092731072 12:11535078-11535100 GCTACAGTGGCTTCCCAGGTTGG + Intergenic
1097240272 12:57570181-57570203 GGCACTGAGGCACGCCAGGTGGG + Intronic
1098703955 12:73664510-73664532 GGTACAGGGTAACCCCATGCGGG - Intergenic
1098838939 12:75455689-75455711 GGGACAGGAGCAACCCAGGGAGG - Intergenic
1104013264 12:124946980-124947002 GGGACAGGAGCACCCCAGGCAGG - Exonic
1104260154 12:127174836-127174858 GGCTCAGGGGCATCACAGGTTGG - Intergenic
1104495344 12:129231837-129231859 GGTCCTGGGGCACCTGAGGTTGG + Intronic
1106136263 13:26975882-26975904 GCTGCAGGGTCACCCCAGGTCGG + Intergenic
1107958943 13:45542409-45542431 GGCACAGGGTCAGCCCACGTGGG - Intronic
1108389739 13:49936357-49936379 GGTACAGCGACACCCTAGGCCGG + Intronic
1109053759 13:57519092-57519114 GGTACAGTTTCACCCCAGGCAGG + Intergenic
1111429860 13:88136415-88136437 AGCACAGAGGCTCCCCAGGTAGG + Intergenic
1114064888 14:19052739-19052761 GGGCCAGGGGCCCCCCAGGCTGG - Intergenic
1114097373 14:19347263-19347285 GGGCCAGGGGCCCCCCAGGCTGG + Intergenic
1115554810 14:34536574-34536596 GCTACTGGGGAACCCGAGGTGGG - Intronic
1118808978 14:69260264-69260286 GGCAGACGGGCGCCCCAGGTGGG - Exonic
1129488901 15:75904224-75904246 GGTAGGGGGTCACCTCAGGTAGG - Intronic
1129525292 15:76209758-76209780 GGTACAGTGGCACCTGAGGTAGG - Intronic
1130322606 15:82853501-82853523 GATGCAGGGGCCCTCCAGGTCGG + Intronic
1131228480 15:90644025-90644047 GGTGGAGGGGCACCCCATGAGGG - Intronic
1132313693 15:100875971-100875993 GAGGCAGGAGCACCCCAGGTTGG - Intergenic
1132581396 16:686301-686323 TGTCCAGGCCCACCCCAGGTAGG + Intronic
1132655665 16:1040798-1040820 GGGTGAGGGGCACCCCAGCTTGG - Intergenic
1134331667 16:13256991-13257013 GGTTCAAGGGCACCAGAGGTTGG - Intergenic
1135615997 16:23911699-23911721 GGAACAGAGGCACCACAGGCTGG - Intronic
1141218013 16:82043246-82043268 GGGACTGGGGCTCCCCAGGCAGG + Intronic
1142039774 16:87885610-87885632 GGTACTGGGGCCCCACAGGCTGG - Exonic
1142147739 16:88499602-88499624 GATTCAGGGGCCACCCAGGTGGG - Intronic
1142202260 16:88766847-88766869 GGGCCGGGGCCACCCCAGGTTGG + Intronic
1144727059 17:17507309-17507331 GGCACAGGGGCAGCCAAGGAGGG - Intronic
1144756606 17:17683378-17683400 GGGTCAGGCCCACCCCAGGTGGG + Intronic
1146057589 17:29589131-29589153 GGAGCATGGGCACCCCAGGCCGG + Intronic
1146922231 17:36721414-36721436 GGTACAAGGGGACACGAGGTTGG - Intergenic
1147332698 17:39708244-39708266 AGTACTGGGGAACCCCAGGGAGG + Intronic
1149567289 17:57649102-57649124 GGACTAGGGGCACCCCAGCTGGG - Intronic
1150528173 17:65946118-65946140 GGTGAAAGGGCACTCCAGGTTGG - Intronic
1150760817 17:67959240-67959262 GGGACAGGGGCAAGCCAGGAGGG + Intronic
1150782535 17:68134777-68134799 GGTGCAGGGGAAGCCCCGGTTGG + Intergenic
1151471143 17:74318607-74318629 TGTGGAGGGGCACCCCAGGCAGG + Intergenic
1152287643 17:79422024-79422046 GGTACAGAGGCACCCAGGGAGGG + Intronic
1152500042 17:80701818-80701840 GGCACAGGGCTACCCCTGGTGGG + Intronic
1156484313 18:37455423-37455445 GGTACAGTGACACCCTTGGTGGG - Intronic
1157621491 18:49019495-49019517 GGACCAGGGGGACTCCAGGTGGG - Intergenic
1158896504 18:61918981-61919003 GGGACAGAGGCTCCCCAGCTAGG - Intergenic
1161159556 19:2754461-2754483 TGTAGAGGGTCACCCCAGGGTGG - Intergenic
1161397232 19:4051372-4051394 GGTAGAGGGGCATTCAAGGTAGG - Intronic
1161698590 19:5783508-5783530 GGTACAGGGGCACCCCAGGTCGG + Exonic
1163602117 19:18255462-18255484 GGAACAGGAGCGCCCCAGGGAGG - Intergenic
1164578232 19:29418561-29418583 GGTCCAGGTGCTCCCCAGGGAGG + Intergenic
1165694414 19:37889701-37889723 GGTAGATAGGCACCCCAGCTGGG - Exonic
924988053 2:288686-288708 GGAGCCGGCGCACCCCAGGTCGG - Intronic
929561198 2:42957617-42957639 GGCACTGGGTCAGCCCAGGTGGG + Intergenic
929586797 2:43121310-43121332 GGGACAGGGGCTACCCAGGGTGG + Intergenic
936153011 2:110031935-110031957 GGTCCAGGGACACCTCAGGGTGG - Intergenic
936191669 2:110339477-110339499 GGTCCAGGGACACCTCAGGGTGG + Intergenic
936922802 2:117706637-117706659 GGTACAGAGGCAGTCCAGATAGG + Intergenic
946425779 2:219595584-219595606 GCTACAGGGGCTACCCATGTGGG + Intergenic
1169514059 20:6297095-6297117 GGCACAGGGGCACCAAAGGAAGG + Intergenic
1170634612 20:18093549-18093571 GGGACGGGAGCAGCCCAGGTGGG - Intergenic
1172313033 20:33932758-33932780 GGTTCAGTGCCAGCCCAGGTGGG + Intergenic
1175611296 20:60353351-60353373 GCTACAGATGCACCCCAGGGAGG - Intergenic
1179547712 21:42123915-42123937 GGGACAGAGGGAGCCCAGGTGGG + Intronic
1180483377 22:15775359-15775381 GGGCCAGGGGCCCCCCAGGCTGG - Intergenic
1180733497 22:17999637-17999659 GGAACAGGATCATCCCAGGTGGG + Intronic
1181904593 22:26184298-26184320 GGTAGAGGGGCACCCTTGCTTGG - Intronic
949925459 3:9037633-9037655 GGTACATGGGGACCTCAGGCTGG + Intronic
950476244 3:13216571-13216593 GGGACAGGGGGACCGCAGGAGGG + Intergenic
950782349 3:15402681-15402703 AGTACAGTGGCACCCCATCTCGG - Intronic
952395699 3:32918732-32918754 GGTACTGGGGAGCCCAAGGTTGG + Intergenic
953436892 3:42884548-42884570 GGTAGGGGAGAACCCCAGGTGGG + Intronic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
954200407 3:49020581-49020603 GGGTCAGGGGCACCCCATCTGGG + Intronic
954439399 3:50513415-50513437 GGAACAGGGGCACTCCAGCCTGG - Intergenic
954659466 3:52219268-52219290 GGTACAGGGGCTCCTGTGGTGGG - Intergenic
954789098 3:53117660-53117682 TCTACAGGGGCACCCTAGCTAGG - Intronic
967251236 3:187541351-187541373 GGTACAAGTGCACCCCGTGTAGG - Intergenic
969627060 4:8311069-8311091 GCTCCAGGGACACCCCAGGCAGG + Intergenic
973588159 4:52412922-52412944 GATACAAGGGCATCCCAGGAAGG - Intergenic
985541263 5:488759-488781 GGTGCAGGGGCACCGCATGCTGG + Intronic
985903295 5:2813784-2813806 GGTACAGAGGGACCCCAAGCAGG - Intergenic
992091281 5:73319626-73319648 GGCTCAGGGGCCCCACAGGTGGG - Intergenic
997626063 5:135331249-135331271 GGTGCAGGAGCTCCCCAGCTGGG + Intronic
998231364 5:140363412-140363434 GGAGGAGGGGAACCCCAGGTTGG - Intronic
1001638996 5:173232290-173232312 AGTCCATGGGCACCCCCGGTTGG - Exonic
1002300196 5:178253385-178253407 GGAGCAGGGGGACCCCAGGCAGG - Intronic
1002373507 5:178772738-178772760 AGAACACAGGCACCCCAGGTAGG - Intergenic
1002454750 5:179339629-179339651 GGTGTCGGGGCTCCCCAGGTAGG - Intronic
1003094248 6:3130233-3130255 GGTAAAGGGACACCCCAGCTTGG - Intronic
1003510996 6:6780330-6780352 TGTACAGTCGCACCCCAGATCGG + Intergenic
1005450054 6:25963408-25963430 GGTACAGGGAGAGCCCAGCTAGG + Intronic
1007222771 6:40292196-40292218 GCTACAGCGGCACCCCTGCTTGG + Intergenic
1007400724 6:41600811-41600833 GGCACAGGGGAACCGGAGGTGGG - Exonic
1007808593 6:44470145-44470167 GGTGCAGGGGCTCCCCAGCCAGG + Intergenic
1011685414 6:89819747-89819769 GGGAGAGGGGCACCACACGTGGG + Intergenic
1013363648 6:109418311-109418333 AGTACAGGGGGCCCCCAGGAAGG - Intronic
1019167905 6:170110991-170111013 GGTACAGGGGAACTTCAAGTGGG + Intergenic
1019546494 7:1579539-1579561 GCCACAGGTGCACCCCAGGAGGG + Intergenic
1019974975 7:4573885-4573907 GGTCCTCAGGCACCCCAGGTGGG + Intergenic
1020474841 7:8582700-8582722 GGTCCATGGGCCCCACAGGTGGG + Intronic
1023031271 7:36092425-36092447 GGTGCAGGGGCTCCCCAGCCTGG + Intergenic
1025844351 7:65182864-65182886 GTTACATGGCCACCCCAGATGGG + Intergenic
1026837498 7:73648210-73648232 GGTGTGGGGCCACCCCAGGTGGG + Intergenic
1029597350 7:101544980-101545002 GGTACAGGGCCAGCCCAGGATGG + Intronic
1029659294 7:101948729-101948751 GGTACAGGAGCACCCCATTGAGG + Intronic
1029677177 7:102078122-102078144 GGTACCAGTGCACTCCAGGTTGG - Intronic
1034962521 7:155371815-155371837 GGTAAAGAGGCAGCACAGGTTGG + Intergenic
1035404908 7:158590352-158590374 GGAACAGCGGCACCCCTGGATGG + Intergenic
1036642790 8:10594478-10594500 GGGACAGAGGAAACCCAGGTGGG + Intergenic
1039317120 8:36385975-36385997 GGTACAGGGCCACCCCTAGGAGG + Intergenic
1040284953 8:46094852-46094874 GGTGCTGGGTCACCCCAGGGAGG + Intergenic
1042487936 8:69367148-69367170 GGTACAGCTGCACCCTAGGGTGG + Intergenic
1045150684 8:99403659-99403681 GGCCCAGTGGCAGCCCAGGTTGG + Intronic
1049425152 8:142534735-142534757 GGGACAGAGGCAGCCCAGGAAGG + Intronic
1051479004 9:17539494-17539516 GGGACAAGGGAACCCCATGTTGG + Intergenic
1061876218 9:133545448-133545470 GGAACAGGAGAACCCAAGGTGGG - Intronic
1062368021 9:136221175-136221197 GGCACACGGGCACCCCACGCAGG + Intronic
1203782216 EBV:106961-106983 GTAGCAGGGGTACCCCAGGTTGG - Intergenic
1189106183 X:38238088-38238110 AGGAGAAGGGCACCCCAGGTAGG - Intronic