ID: 1161702015

View in Genome Browser
Species Human (GRCh38)
Location 19:5800787-5800809
Sequence GAGGTCAAGCCACTAACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161702015_1161702026 30 Left 1161702015 19:5800787-5800809 CCTTAGGTTAGTGGCTTGACCTC No data
Right 1161702026 19:5800840-5800862 GGGCAGAGAGCAGGTGGAGGTGG No data
1161702015_1161702022 21 Left 1161702015 19:5800787-5800809 CCTTAGGTTAGTGGCTTGACCTC No data
Right 1161702022 19:5800831-5800853 CCACCACGTGGGCAGAGAGCAGG No data
1161702015_1161702025 27 Left 1161702015 19:5800787-5800809 CCTTAGGTTAGTGGCTTGACCTC No data
Right 1161702025 19:5800837-5800859 CGTGGGCAGAGAGCAGGTGGAGG No data
1161702015_1161702020 10 Left 1161702015 19:5800787-5800809 CCTTAGGTTAGTGGCTTGACCTC No data
Right 1161702020 19:5800820-5800842 GAGTTTCACAACCACCACGTGGG No data
1161702015_1161702024 24 Left 1161702015 19:5800787-5800809 CCTTAGGTTAGTGGCTTGACCTC No data
Right 1161702024 19:5800834-5800856 CCACGTGGGCAGAGAGCAGGTGG No data
1161702015_1161702019 9 Left 1161702015 19:5800787-5800809 CCTTAGGTTAGTGGCTTGACCTC No data
Right 1161702019 19:5800819-5800841 TGAGTTTCACAACCACCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161702015 Original CRISPR GAGGTCAAGCCACTAACCTA AGG (reversed) Intergenic
No off target data available for this crispr