ID: 1161702017

View in Genome Browser
Species Human (GRCh38)
Location 19:5800816-5800838
Sequence CGTGGTGGTTGTGAAACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161702017_1161702028 3 Left 1161702017 19:5800816-5800838 CCCTGAGTTTCACAACCACCACG No data
Right 1161702028 19:5800842-5800864 GCAGAGAGCAGGTGGAGGTGGGG No data
1161702017_1161702026 1 Left 1161702017 19:5800816-5800838 CCCTGAGTTTCACAACCACCACG No data
Right 1161702026 19:5800840-5800862 GGGCAGAGAGCAGGTGGAGGTGG No data
1161702017_1161702032 25 Left 1161702017 19:5800816-5800838 CCCTGAGTTTCACAACCACCACG No data
Right 1161702032 19:5800864-5800886 GTGAGTGTTGCAGGGAGTGGAGG No data
1161702017_1161702027 2 Left 1161702017 19:5800816-5800838 CCCTGAGTTTCACAACCACCACG No data
Right 1161702027 19:5800841-5800863 GGCAGAGAGCAGGTGGAGGTGGG No data
1161702017_1161702030 17 Left 1161702017 19:5800816-5800838 CCCTGAGTTTCACAACCACCACG No data
Right 1161702030 19:5800856-5800878 GAGGTGGGGTGAGTGTTGCAGGG No data
1161702017_1161702022 -8 Left 1161702017 19:5800816-5800838 CCCTGAGTTTCACAACCACCACG No data
Right 1161702022 19:5800831-5800853 CCACCACGTGGGCAGAGAGCAGG No data
1161702017_1161702025 -2 Left 1161702017 19:5800816-5800838 CCCTGAGTTTCACAACCACCACG No data
Right 1161702025 19:5800837-5800859 CGTGGGCAGAGAGCAGGTGGAGG No data
1161702017_1161702024 -5 Left 1161702017 19:5800816-5800838 CCCTGAGTTTCACAACCACCACG No data
Right 1161702024 19:5800834-5800856 CCACGTGGGCAGAGAGCAGGTGG No data
1161702017_1161702029 16 Left 1161702017 19:5800816-5800838 CCCTGAGTTTCACAACCACCACG No data
Right 1161702029 19:5800855-5800877 GGAGGTGGGGTGAGTGTTGCAGG No data
1161702017_1161702031 22 Left 1161702017 19:5800816-5800838 CCCTGAGTTTCACAACCACCACG No data
Right 1161702031 19:5800861-5800883 GGGGTGAGTGTTGCAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161702017 Original CRISPR CGTGGTGGTTGTGAAACTCA GGG (reversed) Intergenic
No off target data available for this crispr