ID: 1161702024

View in Genome Browser
Species Human (GRCh38)
Location 19:5800834-5800856
Sequence CCACGTGGGCAGAGAGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161702018_1161702024 -6 Left 1161702018 19:5800817-5800839 CCTGAGTTTCACAACCACCACGT No data
Right 1161702024 19:5800834-5800856 CCACGTGGGCAGAGAGCAGGTGG No data
1161702017_1161702024 -5 Left 1161702017 19:5800816-5800838 CCCTGAGTTTCACAACCACCACG No data
Right 1161702024 19:5800834-5800856 CCACGTGGGCAGAGAGCAGGTGG No data
1161702015_1161702024 24 Left 1161702015 19:5800787-5800809 CCTTAGGTTAGTGGCTTGACCTC No data
Right 1161702024 19:5800834-5800856 CCACGTGGGCAGAGAGCAGGTGG No data
1161702016_1161702024 5 Left 1161702016 19:5800806-5800828 CCTCTCTGATCCCTGAGTTTCAC No data
Right 1161702024 19:5800834-5800856 CCACGTGGGCAGAGAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161702024 Original CRISPR CCACGTGGGCAGAGAGCAGG TGG Intergenic
No off target data available for this crispr